SMART — Example Output

Verification 1  ·  18 variants (22 output rows)  ·  1 tumour sample (TUMOR)  ·  SMART v0.2.0  ·  OncoKB v7.0  ·  VEP 114.2  ·  GRCh38  |  ← Field reference  ·  GitHub ↗

About this dataset: Verification 1 contains 18 curated synthetic variants (14 SNV/indel + 4 CNA) covering NRAS, IDH1, PIK3CA, EGFR, BRAF, GNAQ, PTEN, KRAS, BRCA2, DICER1, TP53, ERBB2, MET, CDKN2A (×2 isoforms), and CDK4. The CDKN2A deletion appears as two rows — one per isoform (p16/INK4a & p14ARF). Tables match the actual file format: Tier 2 and Tier 3 show both header rows (field names + source metadata); Tier 1 shows the #SMART_VERSION comment line and MAF column headers. Click any column name to sort ↑↓. Use the search box to filter rows.

File: Final_result_tier3.tsv — Clinically focused. 77 columns, two-row header (field names + description | source | version). Includes variant identity, consequence, population frequency, pathogenicity scores, ClinVar, CancerHotspots, and top-line OncoKB actionability.

Tumor_Sample_BarcodeHGVSp_ShortHGVSpChromosomeStart_PositionEnd_PositionREFALTFILTERNM_TranscriptConsequenceIMPACTSYMBOLEXONINTRONHGVScExisting_variationVARIANT_CLASSSIFTPolyPhenAFgnomADe_AFgnomADg_AFMAX_AFMAX_AF_POPSSpliceAI_pred_DS_AGSpliceAI_pred_DS_ALSpliceAI_pred_DS_DGSpliceAI_pred_DS_DLREVELLOEUFClinVar_CLNDNClinVar_CLNHGVSClinVar_CLNREVSTATClinVar_CLNSIGClinVar_ONCClinVar_ONCREVSTATClinVar_ORIGINClinVar_SCIREVSTATClinVar_SCICIViC_GNCIViC_VTCancerHotspotsCancerHotspots_HOTSPOTONCOKB_DATA_VERSIONONCOKB_DIAG_LVLONCOKB_FDA_LVLONCOKB_HOTSPOTONCOKB_LAST_UPDATEONCOKB_SENS_LVLSVLENSVTYPEANNOTATEDGENE_IN_ONCOKBVARIANT_IN_ONCOKBMUTATION_EFFECTONCOGENICLEVEL_1LEVEL_2LEVEL_3ALEVEL_R1HIGHEST_LEVELHIGHEST_SENSITIVE_LEVELHIGHEST_RESISTANCE_LEVELHIGHEST_DX_LEVELHIGHEST_PX_LEVELADGTCIViC_CSQ_CIViC Variant NameCIViC_CSQ_CIViC Entity SignificanceCIViC_CSQ_CIViC Entity DirectionCIViC_CSQ_CIViC Entity DiseaseCIViC_CSQ_CIViC Entity TherapiesCIViC_CSQ_CIViC Evidence LevelCIViC_CSQ_CIViC Assertion AMP CategoryCIViC_CSQ_CIViC Assertion Regulatory ApprovalVAF
Tumour sample identifier | VCF | vcf_v2.4Short HGVS protein notation | VEP | 114.2The HGVS protein sequence name https://www.ensembl.org/info/docs/tools/vep/vep_formats.html | VEP | 114.2Chromosome name | VCF | vcf_v2.4Variant start position | VCF | vcf_v2.4Variant end position | Computed | internal_v1Reference allele from the VCF record | VCF | vcf_v2.4Alternate allele from the VCF record | VCF | vcf_v2.4Filter status from the VCF record | VCF | vcf_v2.4RefSeq NM transcript identifier | VEP | 114.2Predicted variant consequence | VEP | 114.2Predicted functional impact | VEP | 114.2Gene symbol | VEP | 114.2Exon number within transcript | VEP | 114.2Intron number within transcript | VEP | 114.2HGVS coding DNA notation | VEP | 114.2Known variant identifiers rs1234567 and or COSV1234567 | VEP | 114.2Sequence Ontology variant class https://www.ensembl.org/info/genome/variation/prediction/classification.html#classes | VEP | 114.2SIFT prediction score | VEP | 114.2PolyPhen prediction score | VEP | 114.2Global allele frequency from population datasets | VEP | 114.2Allele frequency in gnomAD exomes | gnomAD Exomes | gnomAD_v4.0Allele frequency in gnomAD genomes | gnomAD Genomes | gnomAD_v4.0Maximum allele frequency observed across all population datasets | VEP | 114.2Population in which the maximum allele frequency was observed | VEP | 114.2SpliceAI delta score predicting the probability that the variant creates a new splice acceptor site (acceptor gain). The score ranges from 0 to 1, where higher values indicate a higher likelihood of splice alteration. Values ≥0.2 are often considered potentially significant, and ≥0.5 indicate strong predicted splice impact. | SpliceAI | 1.3SpliceAI delta score predicting the probability that the variant disrupts an existing splice acceptor site (acceptor loss). The score ranges from 0 to 1, with higher values indicating stronger predicted disruption of the native acceptor site. | SpliceAI | 1.3SpliceAI delta score predicting the probability that the variant creates a new splice donor site (donor gain). The score ranges from 0 to 1, representing the predicted probability of a novel donor splice site being introduced by the variant. | SpliceAI | 1.3SpliceAI delta score predicting the probability that the variant disrupts an existing splice donor site (donor loss). Scores range from 0 to 1, where higher values indicate a greater predicted loss of the canonical donor splice site. | SpliceAI | 1.3Rare Exome Variant Ensemble Learner score predicting pathogenicity of missense variants. https://sites.google.com/site/revelgenomics/ | REVEL | 1.3Loss-of-function observed/expected upper bound fraction indicating gene intolerance | Karczewski et al., Nature 2020 The mutational constraint spectrum quantified from variation in 141,456 humans | gnomAD_v4.0ClinVar's preferred disease name for the concept specified by disease identifiers in CLNDISDB | ClinVar | ClinVar_2024-12Top-level (primary assembly, alt, or patch) HGVS expression. | ClinVar | ClinVar_2024-12ClinVar review status of germline classification for the Variation ID | ClinVar | ClinVar_2024-12Aggregate germline classification for this single variant; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12Aggregate oncogenicity classification for this single variant; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12ClinVar review status of oncogenicity classification for the Variation ID | ClinVar | ClinVar_2024-12Allele origin. One or more of the following values may be added: 0 - unknown; 1 - germline; 2 - somatic; 4 - inherited; 8 - paternal; 16 - maternal; 32 - de-novo; 64 - biparental; 128 - uniparental; 256 - not-tested; 512 - tested-inconclusive; 1073741824 - other | ClinVar | ClinVar_2024-12ClinVar review status of somatic clinical impact for the Variation ID | ClinVar | ClinVar_2024-12Aggregate somatic clinical impact for this single variant; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12HGNC Gene Symbol | CIViC | CIViC_v3.6CIViC Variant Name | CIViC | CIViC_v3.6Indicates whether the variant overlaps a curated cancer hotspot | Cancer Hotspots | changv2Protein-level hotspot annotation from Cancer Hotspots database | Cancer Hotspots | changv2Version of the OncoKB dataset used for annotation | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantHighest diagnostic implication level reported by OncoKB for the queried variant | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantHighest FDA-recognised level of evidence for the variant reported by OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantIndicates whether the variant is considered a hotspot by OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantDate of the most recent update to the OncoKB record | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantHighest therapeutic sensitivity level reported by OncoKB for the queried variant | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantLength of the structural variant event | Manta | Manta_v1.6Structural variant type (DEL, DUP, INV, BND, INS) | Manta | Manta_v1.6Whether the variant is annotated by OncoKB successfully. TRUE, FALSE | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantWhether the gene has been curated by the OncoKB Team. TRUE, FALSE | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantWhether the variant has been curated by the OncoKB Team. Note when a variant does not exist, it may still have annotations. True, False | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe biological effect of a mutation/alteration on the protein function that gives rise to changes in the biological properties of cells expressing the mutant/altered protein compared to cells expressing the wildtype protein. Gain-of-function, Likely Gain-of-function, Loss-of-function, Likely Loss-of-function, Switch-of-function, Likely Switch-of-function, Neutral, Likely Neutral, Inconclusive, Unknown | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantIn OncoKB, “oncogenic” is defined as “referring to the ability to induce or cause cancer” as described in the second edition of The Biology of Cancer by Robert Weinberg (2014). Oncogenic, Likely Oncogenic, Likely Neutral, Inconclusive, Unknown, Resistance | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe leveled therapeutic implications. | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPresence of Level 2 therapeutic evidence in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPresence of Level 3A therapeutic evidence in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPresence of Level R1 resistance evidence in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe highest level of evidence for therapeutic implications. Order LEVEL_R1 > LEVEL_1 > LEVEL_2 > LEVEL_3A > LEVEL_3B > LEVEL_4 > LEVEL_R2 | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe highest sensitive level of evidence for therapeutic implications. Order LEVEL_1 > LEVEL_2 > LEVEL_3A > LEVEL_3B > LEVEL_4 | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe highest resistance level of evidence for therapeutic implications. Order LEVEL_R1 > LEVEL_R2 | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe highest level of evidence for diagnostic implications. LEVEL_Dx1, LEVEL_Dx2, LEVEL_Dx3 | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe highest level of evidence for prognostic implications. LEVEL_Px1, LEVEL_Px2, LEVEL_Px3 | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantAllelic depths for reference and alternate alleles | VCF | VCF_v4.2Genotype call for the sample | VCF | VCF_v4.2CIViC variant name | CIViC | CIViC_v3.6Clinical significance of the variant according to CIViC evidence | CIViC | CIViC_v3.6Direction of clinical evidence (e.g. supports or does not support) | CIViC | CIViC_v3.6Unique CIViC identifier for Entity Disease | CIViC | CIViC_v3.6Therapies associated with the CIViC entity | CIViC | CIViC_v3.6CIViC evidence level classification | CIViC | CIViC_v3.6AMP classification category assigned by CIViC | CIViC | CIViC_v3.6Regulatory approval status associated with the CIViC assertion | CIViC | CIViC_v3.6Frequency of existing variant in 1000 Genomes https://www.ensembl.org/info/docs/tools/vep/vep_formats.html | VCF | vcf_v2.4
TUMORp.Q61RENSP00000358548.4:p.Gln61Argchr1114713908TCPASSNM_002524missense_variantMODERATENRAS3/7c.182A>Grs11554290&COSV54736340&COSV54736624&COSV54738969&COSV54747786SNVdeleterious_low_confidence(0.02)0.000.000.000.000.8885.5000e-01Vascular_malformation&Large_congenital_melanocytic_nevus&Colorectal_cancer&Neurocutaneous_melanocytosis&not_provided&Linear_nevus_sebaceous_syndrome&Epidermal_nevus&Non-small_cell_lung_carcinoma&Noonan_syndrome_6&Thyroid_cancer&_nonmedullary&_2NC_000001.11:g.114713908T>Ccriteria_provided&_multiple_submitters&_no_conflictsPathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongNRASQ61Rchr1:114713908-114713908v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot11/08/2024LEVEL_2TrueTrueTrueGain-of-functionOncogenicCobimetinib,TrametinibBinimetinib,Cobimetinib,Selumetinib+Iodine I 131-6-Beta-Iodomethyl-19-Norcholesterol,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_2LEVEL_R1LEVEL_Dx2LEVEL_Px155,230/1Q61R0.2948717948717949
TUMORp.R132HENSP00000260985.2:p.Arg132Hischr2208248388CTPASSNM_005896missense_variantMODERATEIDH14/10c.395G>Ars121913500&CM1310533&COSV61615239&COSV61615420SNVtolerated_low_confidence(0.07)benign(0.009)9.578e-061.317e-053.826e-05gnomADe_ASJ0.000.000.040.020.8528.2900e-01Metaphyseal_chondromatosis&Metaphyseal_chondromatosis_with_D-2-hydroxyglutaric_aciduria&Enchondromatosis&Glioblastoma_multiforme&_somatic&not_provided&Glioma_susceptibility_1NC_000002.12:g.208248388C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenicOncogeniccriteria_provided&_single_submitter35criteria_provided&_single_submitterTier_I_-_StrongIDH1R132Hrs121913500✓ Hotspotv7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot08/10/2024LEVEL_1TrueTrueTrueSwitch-of-functionOncogenicIvosidenib,Olutasidenib,VorasidenibIvosidenibIvosidenibLEVEL_1LEVEL_1LEVEL_Dx2LEVEL_Px262,300/1R132H0.32608695652173914
TUMORp.E545KENSP00000263967.3:p.Glu545Lyschr3179218303GAPASSNM_006218missense_variantMODERATEPIK3CA10/21c.1633G>Ars104886003&CM126692&COSV55873239&COSV55878227SNVdeleterious(0)probably_damaging(0.912)0.000.000.000.000.6542.2100e-01HEMIFACIAL_MYOHYPERPLASIA&_SOMATIC&PIK3CA_overgrowth_syndrome&Rare_combined_vascular_malformation&Rare_venous_malformation&Eccrine_angiomatous_hamartoma&Cerebrofacial_Vascular_Metameric_Syndrome_(CVMS)&PIK3CA-related_disorder&Gallbladder_cancer&Gastric_cancer&Sarcoma&PIK3CA_related_overgrowth_syndrome&Angioosteohypertrophic_syndrome&not_provided&Megalencephaly-capillary_malformation-polymicrogyria_syndrome&CLOVES_syndrome&Ovarian_neoplasm&Seborrheic_keratosis&OVARIAN_CANCER&_EPITHELIAL&_SOMATIC&Non-small_cell_lung_carcinoma&Carcinoma_of_colon&Breast_adenocarcinoma&Abnormal_cardiovascular_system_morphology&Segmental_undergrowth_associated_with_lymphatic_malformationNC_000003.12:g.179218303G>Acriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongPIK3CAE545Kchr3:179218303-179218303v7.0.LEVEL_Fda2✓ Hotspot10/16/2024LEVEL_1TrueTrueTrueGain-of-functionOncogenicAlpelisib+Fulvestrant,Capivasertib+Fulvestrant,Inavolisib+Palbociclib+FulvestrantLEVEL_1LEVEL_158,320/1E545K0.35555555555555557
TUMORp.H1047RENSP00000263967.3:p.His1047Argchr3179234297AGPASSNM_006218missense_variantMODERATEPIK3CA21/21c.3140A>Grs121913279&CM153086&COSV55873195&COSV55873401&COSV55888015SNVdeleterious(0)benign(0.088)0.000.000.000.000.4552.2100e-01Rare_venous_malformation&Rare_combined_vascular_malformation&Klippel-Trenaunay-like-Syndrome&CEREBRAL_CAVERNOUS_MALFORMATIONS_4&_SOMATIC&Cerebrofacial_Vascular_Metameric_Syndrome_(CVMS)&Overgrowth_syndrome_and/or_cerebral_malformations_due_to_abnormalities_in_MTOR_pathway_genes&Rosette-forming_glioneuronal_tumor&PIK3CA-Related_Overgrowth_Spectrum_Disorders&PIK3CA-related_disorder&MACRODACTYLY&_SOMATIC&Congenital_macrodactylia&CLAPO_syndrome&Lip_and_oral_cavity_carcinoma&Gastric_cancer&PIK3CA_related_overgrowth_syndrome&Megalencephaly-capillary_malformation-polymicrogyria_syndrome&not_provided&CLOVES_syndrome&Ovarian_neoplasm&Hepatocellular_carcinoma&Seborrheic_keratosis&OVARIAN_CANCER&_EPITHELIAL&_SOMATIC&Non-small_cell_lung_carcinoma&Carcinoma_of_colon&Breast_adenocarcinoma&Abnormal_cardiovascular_system_morphology&Breast_carcinoma&Segmental_undergrowth_associated_with_mainly_venous_malformation_with_capillary_component&Segmental_undergrowth_associated_with_lymphatic_malformationNC_000003.12:g.179234297A>Greviewed_by_expert_panelPathogenicOncogeniccriteria_provided&_single_submitter39criteria_provided&_single_submitterTier_I_-_StrongPIK3CAH1047Rrs121913279✓ Hotspotv7.0.LEVEL_Fda2✓ Hotspot10/16/2024LEVEL_1TrueTrueTrueGain-of-functionOncogenicAlpelisib+Fulvestrant,Capivasertib+Fulvestrant,Inavolisib+Palbociclib+FulvestrantLEVEL_1LEVEL_155,400/1H1047R0.42105263157894735
TUMORp.Glu746_Ala750delENSP00000275493.2:p.Glu746_Ala750delchr755174772GAATTAAGAGAAGCATGPASSNM_005228inframe_deletionMODERATEEGFR19/28c.2236_2250delCOSV51765066&COSV51849442deletion4.7500e-01v7.0.LEVEL_Fda2✓ Hotspot07/07/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAfatinib,Amivantamab+Chemotherapy,Amivantamab+Lazertinib,Dacomitinib,Datopotamab Deruxtecan,Erlotinib,Gefitinib,Osimertinib,Osimertinib+Chemotherapy,Erlotinib+RamucirumabPatritumab DeruxtecanLEVEL_1LEVEL_158,370/10.3894736842105263
TUMORp.T790MENSP00000275493.2:p.Thr790Metchr755181378CTPASSNM_005228missense_variantMODERATEEGFR20/28c.2369C>Trs121434569&CM054664&COSV51765492SNVdeleterious_low_confidence(0)probably_damaging(1)6.156e-064.599e-057.237e-05gnomADg_AFR0.000.000.000.000.5294.7500e-01EGFR-related_disorder&Lung_cancer&Inflammatory_skin_and_bowel_disease&_neonatal&_2&Hereditary_cancer-predisposing_syndrome&not_provided&EGFR-related_lung_cancer&Non-small_cell_lung_carcinoma&Lung_adenocarcinoma&Tyrosine_kinase_inhibitor_response&gefitinib_response_-_Efficacy&erlotinib_response_-_EfficacyNC_000007.14:g.55181378C>Treviewed_by_expert_paneldrug_responseOncogeniccriteria_provided&_single_submitter3EGFRT790Mrs121434569✓ Hotspotv7.0.LEVEL_Fda2✓ Hotspot07/07/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicDatopotamab Deruxtecan,OsimertinibErlotinib,Gefitinib,AfatinibLEVEL_R1LEVEL_1LEVEL_R160,350/1T790M0.3684210526315789
TUMORp.L858RENSP00000275493.2:p.Leu858Argchr755191822TGPASSNM_005228missense_variantMODERATEEGFR21/28c.2573T>Grs121434568&COSV51765161&COSV51854030SNVdeleterious_low_confidence(0)probably_damaging(0.997)0.000.000.000.010.9614.7500e-01Hereditary_cancer-predisposing_syndrome&Lung_carcinoma&Nonsmall_cell_lung_cancer&_response_to_tyrosine_kinase_inhibitor_in&_somatic&Adenocarcinoma_of_lung&_response_to_tyrosine_kinase_inhibitor_in&_somatic&Lung_adenocarcinoma&Tyrosine_kinase_inhibitor_response&gefitinib_response_-_EfficacyNC_000007.14:g.55191822T>Greviewed_by_expert_paneldrug_responseOncogeniccriteria_provided&_single_submitter3criteria_provided&_multiple_submittersTier_I_-_StrongEGFRL858Rchr7:55191822-55191822v7.0.LEVEL_Fda2✓ Hotspot07/07/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAfatinib,Amivantamab+Chemotherapy,Amivantamab+Lazertinib,Dacomitinib,Datopotamab Deruxtecan,Erlotinib,Gefitinib,Osimertinib,Osimertinib+Chemotherapy,Erlotinib+RamucirumabPatritumab DeruxtecanLEVEL_1LEVEL_165,400/1L858R0.38095238095238093
TUMORchr7116672196N<DUP>PASSNM_000245start_lost&feature_elongation&start_retained_variant&coding_sequence_variant&5_prime_UTR_variant&3_prime_UTR_variant&intron_variantHIGHMET1-21/211-20/20nanduplicationv7.0.LEVEL_Fda2False11/08/2024LEVEL_2125841DUPTrueTrueTrueGain-of-functionOncogenicCapmatinib,Crizotinib,TepotinibTelisotuzumab VedotinLEVEL_2LEVEL_R20/1
TUMORp.V600EENSP00000493543.1:p.Val600Gluchr7140753336ATPASSNM_004333missense_variantMODERATEBRAF15/18c.1799T>Ars113488022&CM112509&COSV56056643&COSV56065204&COSV56080151SNVdeleterious_low_confidence(0)probably_damaging(0.935)1.369e-061.16e-05gnomADe_SAS0.000.000.000.002.4500e-01Vascular_malformation&Lymphangioma&Malignant_neoplastic_disease&Cardiovascular_phenotype&Cystic_epithelial_invagination_containing_papillae_lined_by_columnar_epithelium&Melanoma&Cardio-facio-cutaneous_syndrome&Nephroblastoma&not_provided&RASopathy&Multiple_myeloma&Papillary_thyroid_carcinoma&Cerebral_arteriovenous_malformation&Nongerminomatous_germ_cell_tumor&Non-small_cell_lung_carcinoma&Astrocytoma&_low-grade&_somatic&Carcinoma_of_colonNC_000007.14:g.140753336A>Tcriteria_provided&_conflicting_classificationsConflicting_classifications_of_pathogenicityOncogeniccriteria_provided&_single_submitter3criteria_provided&_multiple_submittersTier_I_-_StrongBRAFV600Echr7:140753336-140753336v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot02/05/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicDabrafenib,Dabrafenib+Trametinib,Encorafenib+Binimetinib,Encorafenib+Cetuximab,Encorafenib+Cetuximab+FOLFOX Regimen,Tovorafenib,Trametinib,Vemurafenib,Vemurafenib+Atezolizumab+Cobimetinib,Vemurafenib+CobimetinibEncorafenib+Panitumumab,Selumetinib,Vemurafenib,Vemurafenib+Cobimetinib,DabrafenibVemurafenib,DabrafenibLEVEL_1LEVEL_1LEVEL_Dx255,450/1V600E0.45
TUMORchr921967753N<DEL>PASSNM_000077stop_lost&feature_truncation&coding_sequence_variant&5_prime_UTR_variant&3_prime_UTR_variant&intron_variantHIGHCDKN2A1-3/31-2/2nandeletionv7.0LEVEL_Dx2LEVEL_Fda3False04/15/2025LEVEL_4-42059DELTrueTrueTrueLoss-of-functionOncogenicLEVEL_4.0/1
TUMORp.Gln209=ENSP00000286548.4:p.Gln209=chr977794572ATPASSNM_002072synonymous_variantLOWGNAQ5/7nanCOSV54105903&COSV54105914&COSV54108414SNV8.1800e-01v7.0..False06/30/2020.TrueTrueFalseUnknownUnknown55,280/10.3373493975903614
TUMORp.R130*ENSP00000361021.3:p.Arg130Terchr1087933147CTPASSNM_000314stop_gainedHIGHPTEN5/9c.388C>Trs121909224&CM094223&CM971273&COSV64288384&COSV64288463&COSV64297940&COSV64311187SNV2.737e-063.827e-05gnomADe_ASJ0.000.000.000.006.8500e-01Cowden_syndrome_1&Familial_prostate_cancer&Glioma_susceptibility_2&Familial_meningioma&Macrocephaly-autism_syndrome&PTEN-related_disorder&Prostate_cancer&Gastric_cancer&Cowden_syndrome&Rhabdomyosarcoma&Hereditary_cancer-predisposing_syndrome&not_provided&Ovarian_neoplasm&PTEN_hamartoma_tumor_syndrome&Abnormal_cardiovascular_system_morphologyNC_000010.11:g.87933147C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenicOncogeniccriteria_provided&_single_submitter43no_assertion_criteria_providedTier_I_-_StrongPTENR130*chr10:87933147-87933147v7.0LEVEL_Dx3LEVEL_Fda2False11/08/2024LEVEL_1TrueTrueTrueLoss-of-functionOncogenicCapivasertib+FulvestrantLEVEL_1LEVEL_1LEVEL_Dx364,510/1R130*0.4434782608695652
TUMORp.G13DENSP00000308495.3:p.Gly13Aspchr1225245347CTPASSNM_004985missense_variantMODERATEKRAS2/5c.38G>Ars112445441&CM125166&COSV55497357&COSV55497388&COSV55522580SNVdeleterious_low_confidence(0.04)1.369e-061.971e-054.41e-05gnomADg_NFE0.010.000.000.000.8322.6400e-01KRAS-related_disorder&OCULOECTODERMAL_SYNDROME&_SOMATIC&Noonan_syndrome_and_Noonan-related_syndrome&Inborn_genetic_diseases&Familial_pancreatic_carcinoma&Encephalocraniocutaneous_lipomatosis&RASopathy&not_provided&Nevus_sebaceous&Non-small_cell_lung_carcinoma&Autoimmune_lymphoproliferative_syndrome_type_4&Breast_adenocarcinoma&Juvenile_myelomonocytic_leukemiaNC_000012.12:g.25245347C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongKRASG13Dchr12:25245347-25245347v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot05/13/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAvutometinib+DefactinibCobimetinib,TrametinibCobimetinib,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_1LEVEL_R1LEVEL_Dx280,310/1G13D0.27927927927927926
TUMORp.G12DENSP00000308495.3:p.Gly12Aspchr1225245350CTPASSNM_004985missense_variantMODERATEKRAS2/5c.35G>Ars121913529&COSV55497369&COSV55497419&COSV55497479SNVdeleterious_low_confidence(0.04)2.739e-061.314e-052.94e-05gnomADg_NFE0.010.000.000.000.8752.6400e-01Congenital_Pulmonary_Airway_Malformations&Lung_cancer&Gastric_cancer&Acute_myeloid_leukemia&Linear_nevus_sebaceous_syndrome&Noonan_syndrome_3&Familial_pancreatic_carcinoma&Cardiofaciocutaneous_syndrome_2&Autoimmune_lymphoproliferative_syndrome_type_4&Malignant_tumor_of_urinary_bladder&Cerebral_arteriovenous_malformation&Toriello-Lacassie-Droste_syndrome&Familial_cancer_of_breast&Atypical_endometrial_hyperplasia&Endometrial_hyperplasia_without_atypia&Primary_low_grade_serous_adenocarcinoma_of_ovary&Vascular_Tumors_Including_Pyogenic_Granuloma&Encephalocraniocutaneous_lipomatosis&Cardiovascular_phenotype&not_provided&RASopathy&Nevus_sebaceous&Ovarian_neoplasm&Carcinoma_of_pancreas&Epidermal_nevus&Capillary_malformation-arteriovenous_malformation_1&Non-small_cell_lung_carcinoma&Juvenile_myelomonocytic_leukemiaNC_000012.12:g.25245350C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenicOncogeniccriteria_provided&_single_submitter35criteria_provided&_single_submitterTier_I_-_StrongKRASG12Dchr12:25245350-25245350v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot05/13/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAvutometinib+DefactinibCobimetinib,TrametinibCobimetinib,Daraxonrasib,Setidegrasib,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_1LEVEL_R1LEVEL_Dx278,420/1G12D0.35
TUMORp.G12CENSP00000308495.3:p.Gly12Cyschr1225245351CAPASSNM_004985missense_variantMODERATEKRAS2/5c.34G>Trs121913530&CM076251&COSV55497461&COSV55497469&COSV55497582&COSV56157736SNVdeleterious_low_confidence(0)0.000.010.000.000.8532.6400e-01Gallbladder_cancer&Lung_cancer&RASopathy&not_provided&Lung_carcinoma&Non-small_cell_lung_carcinoma&Lung_adenocarcinoma&Endometrial_carcinomaNC_000012.12:g.25245351C>Acriteria_provided&_single_submitterLikely_pathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongKRASG12Cchr12:25245351-25245351v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot05/13/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAdagrasib,Adagrasib+Cetuximab,Avutometinib+Defactinib,Sotorasib,Sotorasib+PanitumumabAdagrasib,Adagrasib+Panitumumab,Cobimetinib,Sotorasib,Sotorasib+Cetuximab,TrametinibAdagrasib,Cobimetinib,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_1LEVEL_R1LEVEL_Dx270,300/1G12C0.3
TUMORchr1257748512N<DUP>PASSNM_000075coding_sequence_variant&5_prime_UTR_variant&3_prime_UTR_variant&intron_variantMODIFIERCDK41-8/81-7/7nanduplicationv7.0.LEVEL_Fda3False11/08/2024LEVEL_444728DUPTrueTrueTrueGain-of-functionOncogenicLEVEL_4.0/1
TUMORp.L3101RENSP00000369497.3:p.Leu3101Argchr1332394734TGPASSNM_000059missense_variantMODERATEBRCA225/27c.9302T>Grs28897758SNVdeleterious(0)possibly_damaging(0.888)4.857e-056.568e-066.206e-05gnomADe_NFE0.000.000.000.000.6718.0300e-01NICE_approved_PARP_inhibitor_treatment&Inherited_breast_cancer_and_ovarian_cancer&BRCA2-related_cancer_predisposition&Hereditary_cancer-predisposing_syndrome&Breast_and/or_ovarian_cancer&not_provided&Hereditary_breast_ovarian_cancer_syndrome&Breast-ovarian_cancer&_familial&_susceptibility_to&_2&Familial_cancer_of_breastNC_000013.11:g.32394734T>Gcriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenic1v7.0.LEVEL_Fda2False06/11/2024LEVEL_1TrueTrueTrueLikely Loss-of-functionLikely OncogenicNiraparib,Niraparib+Abiraterone Acetate+Prednisone,Olaparib,Olaparib+Abiraterone+Prednisone,Rucaparib,Talazoparib+Enzalutamide,Olaparib+BevacizumabOlaparib,Rucaparib,NiraparibOlaparib,TalazoparibLEVEL_1LEVEL_165,250/10.2777777777777778
TUMORp.E1705*NP_085124.2:p.Glu1705Terchr1495094139GAPASSNM_030621stop_gainedHIGHDICER126/29c.5113G>TCOSV58615252&COSV58618257SNV2.7500e-01v7.0..False04/15/2025.TrueTrueFalseLikely Loss-of-functionLikely Oncogenic60,300/10.3333333333333333
TUMORp.R248WENSP00000269305.4:p.Arg248Trpchr177674221GAPASSNM_000546missense_variantMODERATETP537/11c.742C>Trs121912651&CM010465&CM900211&COSV52662035&COSV52797251&COSV53097881SNVdeleterious(0)6.157e-0602.236e-05gnomADe_AMR0.000.000.000.000.9274.4900e-01TP53-related_disorder&Gallbladder_cancer&Congenital_fibrosarcoma&Lip_and_oral_cavity_carcinoma&Gastric_cancer&Breast_and/or_ovarian_cancer&Familial_pancreatic_carcinoma&Malignant_lymphoma&_large_B-cell&_diffuse&Hereditary_cancer-predisposing_syndrome&not_provided&Ovarian_neoplasm&Adrenocortical_carcinoma&_hereditary&Choroid_plexus_carcinoma&Li-Fraumeni_syndrome_1&Li-Fraumeni_syndromeNC_000017.11:g.7674221G>Areviewed_by_expert_panelPathogenicOncogeniccriteria_provided&_single_submitter35criteria_provided&_single_submitterTier_I_-_StrongTP53R248Wchr17:7674221-7674221v7.0..✓ Hotspot06/11/2024.TrueTrueTrueLoss-of-functionLikely OncogenicLEVEL_Px148,400/1R248W0.45454545454545453
TUMORp.R175HENSP00000269305.4:p.Arg175Hischr177675088CTPASSNM_000546missense_variantMODERATETP535/11c.524G>Ars28934578&CM062017&CM951224&COSV52661038&COSV52677601&COSV52731306&COSV53801286SNVtolerated(0.08)4.104e-066.57e-061.47e-05gnomADg_NFE0.000.000.010.000.9224.4900e-01TP53-related_disorder&Colorectal_cancer&Nasopharyngeal_carcinoma&Bone_osteosarcoma&Hepatocellular_carcinoma&Li-Fraumeni_syndrome_1&Glioma_susceptibility_1&Bone_marrow_failure_syndrome_5&Basal_cell_carcinoma&_susceptibility_to&_7&Adrenocortical_carcinoma&_hereditary&Carcinoma_of_pancreas&Choroid_plexus_papilloma&Familial_cancer_of_breast&Lip_and_oral_cavity_carcinoma&Gastric_cancer&Hereditary_cancer-predisposing_syndrome&not_provided&Ovarian_neoplasm&Malignant_tumor_of_esophagus&Li-Fraumeni_syndrome&Squamous_cell_carcinoma_of_the_head_and_neckNC_000017.11:g.7675088C>Treviewed_by_expert_panelPathogenicOncogeniccriteria_provided&_single_submitter19criteria_provided&_single_submitterTier_I_-_StrongTP53R175Hchr17:7675088-7675088v7.0..✓ Hotspot06/11/2024.TrueTrueTrueLoss-of-functionOncogenicLEVEL_Px143,450/1R175H0.5113636363636364
TUMORchr1739687914N<DUP>PASSNM_004448transcript_amplificationHIGHERBB2nanduplicationv7.0.LEVEL_Fda2False03/20/2026LEVEL_142512DUPTrueTrueTrueGain-of-functionOncogenicAdo-Trastuzumab Emtansine,Lapatinib,Capecitabine,Margetuximab,Chemotherapy,Neratinib,Pembrolizumab,Trastuzumab,Trastuzumab Deruxtecan,Pertuzumab,Tucatinib,LetrozoleAdo-Trastuzumab Emtansine,Lapatinib,Trastuzumab,Trastuzumab Deruxtecan,Carboplatin-Taxol Regimen,Pertuzumab,Tucatinib,DocetaxelTrastuzumab Deruxtecan,ZanidatamabLEVEL_1.0/1
TUMORp.S310FENSP00000269571.4:p.Ser310Phechr1739711955CTPASSNM_004448missense_variantMODERATEERBB28/27c.929C>Trs1057519816&COSV54062198&COSV54062802SNVdeleterious(0)probably_damaging(0.984)0.000.000.000.000.5335.1800e-01NC_000017.11:g.39711955C>TOncogeniccriteria_provided&_single_submitter2ERBB2S310F/YCOSM94225✓ Hotspotv7.0.LEVEL_Fda2✓ Hotspot09/11/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicTrastuzumab DeruxtecanAdo-Trastuzumab Emtansine,Neratinib,Neratinib+Trastuzumab+Fulvestrant,ZongertinibNeratinib,Sevabertinib,Trastuzumab+Pertuzumab+DocetaxelLEVEL_1LEVEL_172,580/1S310F/Y0.4461538461538462

File: Final_result_tier2.tsv — Bioinformatics view. 670 columns, two-row header (field names + description | source | version). Extends Tier 3 with full gnomAD stratification, all SpliceAI scores, complete CIViC fields, and all OncoKB JSON expansions (ONCOKB_TX_*, ONCOKB_DIAG_*, ONCOKB_PROG_*). Core columns (matching Tier 3) are shown first.

Default: 77 core columns shown.
Tumor_Sample_BarcodeHGVSp_ShortHGVSpChromosomeStart_PositionEnd_PositionREFALTFILTERNM_TranscriptConsequenceIMPACTSYMBOLEXONINTRONHGVScExisting_variationVARIANT_CLASSSIFTPolyPhenAFgnomADe_AFgnomADg_AFMAX_AFMAX_AF_POPSSpliceAI_pred_DS_AGSpliceAI_pred_DS_ALSpliceAI_pred_DS_DGSpliceAI_pred_DS_DLREVELLOEUFClinVar_CLNDNClinVar_CLNHGVSClinVar_CLNREVSTATClinVar_CLNSIGClinVar_ONCClinVar_ONCREVSTATClinVar_ORIGINClinVar_SCIREVSTATClinVar_SCICIViC_GNCIViC_VTCancerHotspotsCancerHotspots_HOTSPOTONCOKB_DATA_VERSIONONCOKB_DIAG_LVLONCOKB_FDA_LVLONCOKB_HOTSPOTONCOKB_LAST_UPDATEONCOKB_SENS_LVLSVLENSVTYPEANNOTATEDGENE_IN_ONCOKBVARIANT_IN_ONCOKBMUTATION_EFFECTONCOGENICLEVEL_1LEVEL_2LEVEL_3ALEVEL_R1HIGHEST_LEVELHIGHEST_SENSITIVE_LEVELHIGHEST_RESISTANCE_LEVELHIGHEST_DX_LEVELHIGHEST_PX_LEVELADGTCIViC_CSQ_CIViC Variant NameCIViC_CSQ_CIViC Entity SignificanceCIViC_CSQ_CIViC Entity DirectionCIViC_CSQ_CIViC Entity DiseaseCIViC_CSQ_CIViC Entity TherapiesCIViC_CSQ_CIViC Evidence LevelCIViC_CSQ_CIViC Assertion AMP CategoryCIViC_CSQ_CIViC Assertion Regulatory ApprovalVAFNCBI_BuildHugo_SymbolReference_AlleleTumor_Seq_Allele1Tumor_Seq_Allele2POSIDQUALFORMATFORMAT_DATAAlleleGeneFeature_typeFeatureBIOTYPEcDNA_positionCDS_positionProtein_positionAmino_acidsCodonsDISTANCESTRANDFLAGSSYMBOL_SOURCEHGNC_IDCANONICALMANEMANE_SELECTMANE_PLUS_CLINICALTSLAPPRISCCDSENSPSWISSPROTTREMBLUNIPARCUNIPROT_ISOFORMSOURCEGENE_PHENODOMAINSmiRNAHGVS_OFFSETAFR_AFAMR_AFEAS_AFEUR_AFSAS_AFgnomADe_AFR_AFgnomADe_AMR_AFgnomADe_ASJ_AFgnomADe_EAS_AFgnomADe_FIN_AFgnomADe_MID_AFgnomADe_NFE_AFgnomADe_REMAINING_AFgnomADe_SAS_AFgnomADg_AFR_AFgnomADg_AMI_AFgnomADg_AMR_AFgnomADg_ASJ_AFgnomADg_EAS_AFgnomADg_FIN_AFgnomADg_MID_AFgnomADg_NFE_AFgnomADg_REMAINING_AFgnomADg_SAS_AFCLIN_SIGSOMATICPHENOPUBMEDMOTIF_NAMEMOTIF_POSHIGH_INF_POSMOTIF_SCORE_CHANGETRANSCRIPTION_FACTORSSpliceAI_cutoffSpliceAI_pred_DP_AGSpliceAI_pred_DP_ALSpliceAI_pred_DP_DGSpliceAI_pred_DP_DLSpliceAI_pred_SYMBOLClinVarClinVar_AF_ESPClinVar_AF_EXACClinVar_AF_TGPClinVar_ALLELEIDClinVar_CLNDNINCLClinVar_CLNDISDBClinVar_CLNDISDBINCLClinVar_CLNSIGCONFClinVar_CLNSIGINCLClinVar_CLNSIGSCVClinVar_CLNVCClinVar_CLNVCSOClinVar_CLNVIClinVar_DBVARIDClinVar_GENEINFOClinVar_MCClinVar_ONCDNClinVar_ONCDNINCLClinVar_ONCDISDBClinVar_ONCDISDBINCLClinVar_ONCINCLClinVar_ONCSCVClinVar_ONCCONFClinVar_RSClinVar_SCIDNClinVar_SCIDNINCLClinVar_SCIDISDBClinVar_SCIDISDBINCLClinVar_SCIINCLClinVar_SCISCVCIViCCancerHotspots_HOTSPOT_GENECancerHotspots_HOTSPOT_HGVSpCancerHotspots_HOTSPOT3DCancerHotspots_HOTSPOT3D_GENECancerHotspots_HOTSPOT3D_HGVSpCancerHotspots_HOTSPOTNCCancerHotspots_HOTSPOTNC_GENECancerHotspots_HOTSPOTNC_HGVScCIENDCIPOSENDONCOKB_ALLELE_EXISTONCOKB_EFFECT_DESCONCOKB_GENE_SUMMARYONCOKB_PMIDSONCOKB_QUERY_ALTERATIONONCOKB_QUERY_ENTREZ_GENE_IDONCOKB_QUERY_HUGO_SYMBOLONCOKB_QUERY_REF_GENOMEONCOKB_QUERY_TUMOR_TYPEONCOKB_QUERY_TYPEONCOKB_TUMOR_TYPE_SUMMARYONCOKB_VARIANT_SUMMARYONCOKB_VUSONCOKB_highestFdaLevelONCOKB_otherSignificantSensitiveLevelsONCOKB_otherSignificantResistanceLevelsONCOKB_prognosticSummaryONCOKB_diagnosticSummaryONCOKB_mutationEffect.descriptionONCOKB_mutationEffect.citations.pmidsONCOKB_mutationEffect.citations.abstractsONCOKB_DIAG_0_levelOfEvidenceONCOKB_DIAG_0_pmidsONCOKB_DIAG_0_descriptionONCOKB_DIAG_0_tumorType.nameONCOKB_DIAG_0_tumorType.mainType.nameONCOKB_DIAG_0_tumorType.mainType.tumorFormONCOKB_DIAG_0_tumorType.tissueONCOKB_DIAG_1_levelOfEvidenceONCOKB_DIAG_1_pmidsONCOKB_DIAG_1_descriptionONCOKB_DIAG_1_tumorType.nameONCOKB_DIAG_1_tumorType.mainType.nameONCOKB_DIAG_1_tumorType.mainType.tumorFormONCOKB_DIAG_1_tumorType.tissueONCOKB_DIAG_2_levelOfEvidenceONCOKB_DIAG_2_pmidsONCOKB_DIAG_2_descriptionONCOKB_DIAG_2_tumorType.nameONCOKB_DIAG_2_tumorType.mainType.nameONCOKB_DIAG_2_tumorType.mainType.tumorFormONCOKB_DIAG_2_tumorType.tissueONCOKB_DIAG_3_levelOfEvidenceONCOKB_DIAG_3_pmidsONCOKB_DIAG_3_descriptionONCOKB_DIAG_3_tumorType.nameONCOKB_DIAG_3_tumorType.mainType.nameONCOKB_DIAG_3_tumorType.mainType.tumorFormONCOKB_DIAG_3_tumorType.tissueONCOKB_TX_0_drugsONCOKB_TX_0_approvedIndicationsONCOKB_TX_0_levelONCOKB_TX_0_fdaLevelONCOKB_TX_0_levelExcludedCancerTypesONCOKB_TX_0_pmidsONCOKB_TX_0_descriptionONCOKB_TX_0_levelAssociatedCancerType.nameONCOKB_TX_0_levelAssociatedCancerType.mainType.nameONCOKB_TX_0_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_0_levelAssociatedCancerType.tissueONCOKB_TX_1_drugsONCOKB_TX_1_approvedIndicationsONCOKB_TX_1_levelONCOKB_TX_1_fdaLevelONCOKB_TX_1_levelExcludedCancerTypesONCOKB_TX_1_pmidsONCOKB_TX_1_descriptionONCOKB_TX_1_levelAssociatedCancerType.nameONCOKB_TX_1_levelAssociatedCancerType.mainType.nameONCOKB_TX_1_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_1_levelAssociatedCancerType.tissueONCOKB_TX_2_drugsONCOKB_TX_2_approvedIndicationsONCOKB_TX_2_levelONCOKB_TX_2_fdaLevelONCOKB_TX_2_levelExcludedCancerTypesONCOKB_TX_2_pmidsONCOKB_TX_2_descriptionONCOKB_TX_2_levelAssociatedCancerType.nameONCOKB_TX_2_levelAssociatedCancerType.mainType.nameONCOKB_TX_2_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_2_levelAssociatedCancerType.tissueONCOKB_TX_3_drugsONCOKB_TX_3_approvedIndicationsONCOKB_TX_3_levelONCOKB_TX_3_fdaLevelONCOKB_TX_3_levelExcludedCancerTypesONCOKB_TX_3_pmidsONCOKB_TX_3_descriptionONCOKB_TX_3_levelAssociatedCancerType.nameONCOKB_TX_3_levelAssociatedCancerType.mainType.nameONCOKB_TX_3_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_3_levelAssociatedCancerType.tissueONCOKB_TX_4_drugsONCOKB_TX_4_approvedIndicationsONCOKB_TX_4_levelONCOKB_TX_4_fdaLevelONCOKB_TX_4_levelExcludedCancerTypesONCOKB_TX_4_pmidsONCOKB_TX_4_descriptionONCOKB_TX_4_levelAssociatedCancerType.nameONCOKB_TX_4_levelAssociatedCancerType.mainType.nameONCOKB_TX_4_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_4_levelAssociatedCancerType.tissueONCOKB_TX_5_drugsONCOKB_TX_5_approvedIndicationsONCOKB_TX_5_levelONCOKB_TX_5_fdaLevelONCOKB_TX_5_levelExcludedCancerTypesONCOKB_TX_5_pmidsONCOKB_TX_5_descriptionONCOKB_TX_5_levelAssociatedCancerType.nameONCOKB_TX_5_levelAssociatedCancerType.mainType.nameONCOKB_TX_5_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_5_levelAssociatedCancerType.tissueONCOKB_TX_6_drugsONCOKB_TX_6_approvedIndicationsONCOKB_TX_6_levelONCOKB_TX_6_fdaLevelONCOKB_TX_6_levelExcludedCancerTypesONCOKB_TX_6_pmidsONCOKB_TX_6_descriptionONCOKB_TX_6_levelAssociatedCancerType.nameONCOKB_TX_6_levelAssociatedCancerType.mainType.nameONCOKB_TX_6_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_6_levelAssociatedCancerType.tissueONCOKB_TX_7_drugsONCOKB_TX_7_approvedIndicationsONCOKB_TX_7_levelONCOKB_TX_7_fdaLevelONCOKB_TX_7_levelExcludedCancerTypesONCOKB_TX_7_pmidsONCOKB_TX_7_descriptionONCOKB_TX_7_levelAssociatedCancerType.nameONCOKB_TX_7_levelAssociatedCancerType.mainType.nameONCOKB_TX_7_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_7_levelAssociatedCancerType.tissueONCOKB_TX_8_drugsONCOKB_TX_8_approvedIndicationsONCOKB_TX_8_levelONCOKB_TX_8_fdaLevelONCOKB_TX_8_levelExcludedCancerTypesONCOKB_TX_8_pmidsONCOKB_TX_8_descriptionONCOKB_TX_8_levelAssociatedCancerType.nameONCOKB_TX_8_levelAssociatedCancerType.mainType.nameONCOKB_TX_8_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_8_levelAssociatedCancerType.tissueONCOKB_TX_9_drugsONCOKB_TX_9_approvedIndicationsONCOKB_TX_9_levelONCOKB_TX_9_fdaLevelONCOKB_TX_9_levelExcludedCancerTypesONCOKB_TX_9_pmidsONCOKB_TX_9_descriptionONCOKB_TX_9_levelAssociatedCancerType.nameONCOKB_TX_9_levelAssociatedCancerType.mainType.nameONCOKB_TX_9_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_9_levelAssociatedCancerType.tissueONCOKB_TX_10_drugsONCOKB_TX_10_approvedIndicationsONCOKB_TX_10_levelONCOKB_TX_10_fdaLevelONCOKB_TX_10_levelExcludedCancerTypesONCOKB_TX_10_pmidsONCOKB_TX_10_descriptionONCOKB_TX_10_levelAssociatedCancerType.nameONCOKB_TX_10_levelAssociatedCancerType.mainType.nameONCOKB_TX_10_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_10_levelAssociatedCancerType.tissueONCOKB_TX_11_drugsONCOKB_TX_11_approvedIndicationsONCOKB_TX_11_levelONCOKB_TX_11_fdaLevelONCOKB_TX_11_levelExcludedCancerTypesONCOKB_TX_11_pmidsONCOKB_TX_11_descriptionONCOKB_TX_11_levelAssociatedCancerType.nameONCOKB_TX_11_levelAssociatedCancerType.mainType.nameONCOKB_TX_11_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_11_levelAssociatedCancerType.tissueONCOKB_TX_12_drugsONCOKB_TX_12_approvedIndicationsONCOKB_TX_12_levelONCOKB_TX_12_fdaLevelONCOKB_TX_12_levelExcludedCancerTypesONCOKB_TX_12_pmidsONCOKB_TX_12_descriptionONCOKB_TX_12_levelAssociatedCancerType.nameONCOKB_TX_12_levelAssociatedCancerType.mainType.nameONCOKB_TX_12_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_12_levelAssociatedCancerType.tissueONCOKB_TX_13_drugsONCOKB_TX_13_approvedIndicationsONCOKB_TX_13_levelONCOKB_TX_13_fdaLevelONCOKB_TX_13_levelExcludedCancerTypesONCOKB_TX_13_pmidsONCOKB_TX_13_descriptionONCOKB_TX_13_levelAssociatedCancerType.nameONCOKB_TX_13_levelAssociatedCancerType.mainType.nameONCOKB_TX_13_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_13_levelAssociatedCancerType.tissueONCOKB_TX_14_drugsONCOKB_TX_14_approvedIndicationsONCOKB_TX_14_levelONCOKB_TX_14_fdaLevelONCOKB_TX_14_levelExcludedCancerTypesONCOKB_TX_14_pmidsONCOKB_TX_14_descriptionONCOKB_TX_14_levelAssociatedCancerType.nameONCOKB_TX_14_levelAssociatedCancerType.mainType.nameONCOKB_TX_14_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_14_levelAssociatedCancerType.tissueONCOKB_TX_15_drugsONCOKB_TX_15_approvedIndicationsONCOKB_TX_15_levelONCOKB_TX_15_fdaLevelONCOKB_TX_15_levelExcludedCancerTypesONCOKB_TX_15_pmidsONCOKB_TX_15_descriptionONCOKB_TX_15_levelAssociatedCancerType.nameONCOKB_TX_15_levelAssociatedCancerType.mainType.nameONCOKB_TX_15_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_15_levelAssociatedCancerType.tissueONCOKB_TX_16_drugsONCOKB_TX_16_approvedIndicationsONCOKB_TX_16_levelONCOKB_TX_16_fdaLevelONCOKB_TX_16_levelExcludedCancerTypesONCOKB_TX_16_pmidsONCOKB_TX_16_descriptionONCOKB_TX_16_levelAssociatedCancerType.nameONCOKB_TX_16_levelAssociatedCancerType.mainType.nameONCOKB_TX_16_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_16_levelAssociatedCancerType.tissueONCOKB_TX_17_drugsONCOKB_TX_17_approvedIndicationsONCOKB_TX_17_levelONCOKB_TX_17_fdaLevelONCOKB_TX_17_levelExcludedCancerTypesONCOKB_TX_17_pmidsONCOKB_TX_17_descriptionONCOKB_TX_17_levelAssociatedCancerType.nameONCOKB_TX_17_levelAssociatedCancerType.mainType.nameONCOKB_TX_17_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_17_levelAssociatedCancerType.tissueONCOKB_TX_18_drugsONCOKB_TX_18_approvedIndicationsONCOKB_TX_18_levelONCOKB_TX_18_fdaLevelONCOKB_TX_18_levelExcludedCancerTypesONCOKB_TX_18_pmidsONCOKB_TX_18_descriptionONCOKB_TX_18_levelAssociatedCancerType.nameONCOKB_TX_18_levelAssociatedCancerType.mainType.nameONCOKB_TX_18_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_18_levelAssociatedCancerType.tissueONCOKB_TX_19_drugsONCOKB_TX_19_approvedIndicationsONCOKB_TX_19_levelONCOKB_TX_19_fdaLevelONCOKB_TX_19_levelExcludedCancerTypesONCOKB_TX_19_pmidsONCOKB_TX_19_descriptionONCOKB_TX_19_levelAssociatedCancerType.nameONCOKB_TX_19_levelAssociatedCancerType.mainType.nameONCOKB_TX_19_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_19_levelAssociatedCancerType.tissueONCOKB_TX_20_drugsONCOKB_TX_20_approvedIndicationsONCOKB_TX_20_levelONCOKB_TX_20_fdaLevelONCOKB_TX_20_levelExcludedCancerTypesONCOKB_TX_20_pmidsONCOKB_TX_20_descriptionONCOKB_TX_20_levelAssociatedCancerType.nameONCOKB_TX_20_levelAssociatedCancerType.mainType.nameONCOKB_TX_20_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_20_levelAssociatedCancerType.tissueONCOKB_TX_21_drugsONCOKB_TX_21_approvedIndicationsONCOKB_TX_21_levelONCOKB_TX_21_fdaLevelONCOKB_TX_21_levelExcludedCancerTypesONCOKB_TX_21_pmidsONCOKB_TX_21_descriptionONCOKB_TX_21_levelAssociatedCancerType.nameONCOKB_TX_21_levelAssociatedCancerType.mainType.nameONCOKB_TX_21_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_21_levelAssociatedCancerType.tissueONCOKB_TX_22_drugsONCOKB_TX_22_approvedIndicationsONCOKB_TX_22_levelONCOKB_TX_22_fdaLevelONCOKB_TX_22_levelExcludedCancerTypesONCOKB_TX_22_pmidsONCOKB_TX_22_descriptionONCOKB_TX_22_levelAssociatedCancerType.nameONCOKB_TX_22_levelAssociatedCancerType.mainType.nameONCOKB_TX_22_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_22_levelAssociatedCancerType.tissueONCOKB_TX_23_drugsONCOKB_TX_23_approvedIndicationsONCOKB_TX_23_levelONCOKB_TX_23_fdaLevelONCOKB_TX_23_levelExcludedCancerTypesONCOKB_TX_23_pmidsONCOKB_TX_23_descriptionONCOKB_TX_23_levelAssociatedCancerType.nameONCOKB_TX_23_levelAssociatedCancerType.mainType.nameONCOKB_TX_23_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_23_levelAssociatedCancerType.tissueONCOKB_TX_24_drugsONCOKB_TX_24_approvedIndicationsONCOKB_TX_24_levelONCOKB_TX_24_fdaLevelONCOKB_TX_24_levelExcludedCancerTypesONCOKB_TX_24_pmidsONCOKB_TX_24_descriptionONCOKB_TX_24_levelAssociatedCancerType.nameONCOKB_TX_24_levelAssociatedCancerType.mainType.nameONCOKB_TX_24_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_24_levelAssociatedCancerType.tissueONCOKB_TX_25_drugsONCOKB_TX_25_approvedIndicationsONCOKB_TX_25_levelONCOKB_TX_25_fdaLevelONCOKB_TX_25_levelExcludedCancerTypesONCOKB_TX_25_pmidsONCOKB_TX_25_descriptionONCOKB_TX_25_levelAssociatedCancerType.nameONCOKB_TX_25_levelAssociatedCancerType.mainType.nameONCOKB_TX_25_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_25_levelAssociatedCancerType.tissueONCOKB_TX_26_drugsONCOKB_TX_26_approvedIndicationsONCOKB_TX_26_levelONCOKB_TX_26_fdaLevelONCOKB_TX_26_levelExcludedCancerTypesONCOKB_TX_26_pmidsONCOKB_TX_26_descriptionONCOKB_TX_26_levelAssociatedCancerType.nameONCOKB_TX_26_levelAssociatedCancerType.mainType.nameONCOKB_TX_26_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_26_levelAssociatedCancerType.tissueONCOKB_TX_27_drugsONCOKB_TX_27_approvedIndicationsONCOKB_TX_27_levelONCOKB_TX_27_fdaLevelONCOKB_TX_27_levelExcludedCancerTypesONCOKB_TX_27_pmidsONCOKB_TX_27_descriptionONCOKB_TX_27_levelAssociatedCancerType.nameONCOKB_TX_27_levelAssociatedCancerType.mainType.nameONCOKB_TX_27_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_27_levelAssociatedCancerType.tissueONCOKB_TX_28_drugsONCOKB_TX_28_approvedIndicationsONCOKB_TX_28_levelONCOKB_TX_28_fdaLevelONCOKB_TX_28_levelExcludedCancerTypesONCOKB_TX_28_pmidsONCOKB_TX_28_descriptionONCOKB_TX_28_levelAssociatedCancerType.nameONCOKB_TX_28_levelAssociatedCancerType.mainType.nameONCOKB_TX_28_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_28_levelAssociatedCancerType.tissueONCOKB_TX_29_drugsONCOKB_TX_29_approvedIndicationsONCOKB_TX_29_levelONCOKB_TX_29_fdaLevelONCOKB_TX_29_levelExcludedCancerTypesONCOKB_TX_29_pmidsONCOKB_TX_29_descriptionONCOKB_TX_29_levelAssociatedCancerType.nameONCOKB_TX_29_levelAssociatedCancerType.mainType.nameONCOKB_TX_29_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_29_levelAssociatedCancerType.tissueONCOKB_TX_30_drugsONCOKB_TX_30_approvedIndicationsONCOKB_TX_30_levelONCOKB_TX_30_fdaLevelONCOKB_TX_30_levelExcludedCancerTypesONCOKB_TX_30_pmidsONCOKB_TX_30_descriptionONCOKB_TX_30_levelAssociatedCancerType.nameONCOKB_TX_30_levelAssociatedCancerType.mainType.nameONCOKB_TX_30_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_30_levelAssociatedCancerType.tissueONCOKB_TX_31_drugsONCOKB_TX_31_approvedIndicationsONCOKB_TX_31_levelONCOKB_TX_31_fdaLevelONCOKB_TX_31_levelExcludedCancerTypesONCOKB_TX_31_pmidsONCOKB_TX_31_descriptionONCOKB_TX_31_levelAssociatedCancerType.nameONCOKB_TX_31_levelAssociatedCancerType.mainType.nameONCOKB_TX_31_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_31_levelAssociatedCancerType.tissueONCOKB_TX_32_drugsONCOKB_TX_32_approvedIndicationsONCOKB_TX_32_levelONCOKB_TX_32_fdaLevelONCOKB_TX_32_levelExcludedCancerTypesONCOKB_TX_32_pmidsONCOKB_TX_32_descriptionONCOKB_TX_32_levelAssociatedCancerType.nameONCOKB_TX_32_levelAssociatedCancerType.mainType.nameONCOKB_TX_32_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_32_levelAssociatedCancerType.tissueONCOKB_TX_33_drugsONCOKB_TX_33_approvedIndicationsONCOKB_TX_33_levelONCOKB_TX_33_fdaLevelONCOKB_TX_33_levelExcludedCancerTypesONCOKB_TX_33_pmidsONCOKB_TX_33_descriptionONCOKB_TX_33_levelAssociatedCancerType.nameONCOKB_TX_33_levelAssociatedCancerType.mainType.nameONCOKB_TX_33_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_33_levelAssociatedCancerType.tissueMUTATION_EFFECT_CITATIONSLEVEL_3BLEVEL_4LEVEL_R2TX_CITATIONSLEVEL_Dx1LEVEL_Dx2LEVEL_Dx3DX_CITATIONSLEVEL_Px1LEVEL_Px2LEVEL_Px3PX_CITATIONSDPPRSRCIViC_CSQ_AlleleCIViC_CSQ_ConsequenceCIViC_CSQ_SYMBOLCIViC_CSQ_Entrez Gene IDCIViC_CSQ_Feature_typeCIViC_CSQ_FeatureCIViC_CSQ_HGVScCIViC_CSQ_HGVSpCIViC_CSQ_CIViC Variant IDCIViC_CSQ_CIViC Variant AliasesCIViC_CSQ_CIViC Variant URLCIViC_CSQ_CIViC Molecular Profile NameCIViC_CSQ_CIViC Molecular Profile IDCIViC_CSQ_CIViC Molecular Profile AliasesCIViC_CSQ_CIViC Molecular Profile URLCIViC_CSQ_CIViC HGVSCIViC_CSQ_Allele Registry IDCIViC_CSQ_ClinVar IDsCIViC_CSQ_CIViC Molecular Profile ScoreCIViC_CSQ_CIViC Entity TypeCIViC_CSQ_CIViC Entity URLCIViC_CSQ_CIViC Entity SourceCIViC_CSQ_CIViC Entity Variant OriginCIViC_CSQ_CIViC Entity StatusCIViC_CSQ_CIViC Entity Therapy Interaction TypeCIViC_CSQ_CIViC Evidence PhenotypesCIViC_CSQ_CIViC Evidence RatingCIViC_CSQ_CIViC Assertion ACMG CodesCIViC_CSQ_CIViC Assertion NCCN GuidelineCIViC_CSQ_CIViC Assertion FDA Companion Test
Tumour sample identifier | VCF | vcf_v2.4Short HGVS protein notation | VEP | 114.2The HGVS protein sequence name https://www.ensembl.org/info/docs/tools/vep/vep_formats.html | VEP | 114.2Chromosome name | VCF | vcf_v2.4Variant start position | VCF | vcf_v2.4Variant end position | Computed | internal_v1Reference allele from the VCF record | VCF | vcf_v2.4Alternate allele from the VCF record | VCF | vcf_v2.4Filter status from the VCF record | VCF | vcf_v2.4RefSeq NM transcript identifier | VEP | 114.2Predicted variant consequence | VEP | 114.2Predicted functional impact | VEP | 114.2Gene symbol | VEP | 114.2Exon number within transcript | VEP | 114.2Intron number within transcript | VEP | 114.2HGVS coding DNA notation | VEP | 114.2Known variant identifiers rs1234567 and or COSV1234567 | VEP | 114.2Sequence Ontology variant class https://www.ensembl.org/info/genome/variation/prediction/classification.html#classes | VEP | 114.2SIFT prediction score | VEP | 114.2PolyPhen prediction score | VEP | 114.2Global allele frequency from population datasets | VEP | 114.2Allele frequency in gnomAD exomes | gnomAD Exomes | gnomAD_v4.0Allele frequency in gnomAD genomes | gnomAD Genomes | gnomAD_v4.0Maximum allele frequency observed across all population datasets | VEP | 114.2Population in which the maximum allele frequency was observed | VEP | 114.2SpliceAI delta score predicting the probability that the variant creates a new splice acceptor site (acceptor gain). The score ranges from 0 to 1, where higher values indicate a higher likelihood of splice alteration. Values ≥0.2 are often considered potentially significant, and ≥0.5 indicate strong predicted splice impact. | SpliceAI | 1.3SpliceAI delta score predicting the probability that the variant disrupts an existing splice acceptor site (acceptor loss). The score ranges from 0 to 1, with higher values indicating stronger predicted disruption of the native acceptor site. | SpliceAI | 1.3SpliceAI delta score predicting the probability that the variant creates a new splice donor site (donor gain). The score ranges from 0 to 1, representing the predicted probability of a novel donor splice site being introduced by the variant. | SpliceAI | 1.3SpliceAI delta score predicting the probability that the variant disrupts an existing splice donor site (donor loss). Scores range from 0 to 1, where higher values indicate a greater predicted loss of the canonical donor splice site. | SpliceAI | 1.3Rare Exome Variant Ensemble Learner score predicting pathogenicity of missense variants. https://sites.google.com/site/revelgenomics/ | REVEL | 1.3Loss-of-function observed/expected upper bound fraction indicating gene intolerance | Karczewski et al., Nature 2020 The mutational constraint spectrum quantified from variation in 141,456 humans | gnomAD_v4.0ClinVar's preferred disease name for the concept specified by disease identifiers in CLNDISDB | ClinVar | ClinVar_2024-12Top-level (primary assembly, alt, or patch) HGVS expression. | ClinVar | ClinVar_2024-12ClinVar review status of germline classification for the Variation ID | ClinVar | ClinVar_2024-12Aggregate germline classification for this single variant; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12Aggregate oncogenicity classification for this single variant; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12ClinVar review status of oncogenicity classification for the Variation ID | ClinVar | ClinVar_2024-12Allele origin. One or more of the following values may be added: 0 - unknown; 1 - germline; 2 - somatic; 4 - inherited; 8 - paternal; 16 - maternal; 32 - de-novo; 64 - biparental; 128 - uniparental; 256 - not-tested; 512 - tested-inconclusive; 1073741824 - other | ClinVar | ClinVar_2024-12ClinVar review status of somatic clinical impact for the Variation ID | ClinVar | ClinVar_2024-12Aggregate somatic clinical impact for this single variant; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12HGNC Gene Symbol | CIViC | CIViC_v3.6CIViC Variant Name | CIViC | CIViC_v3.6Indicates whether the variant overlaps a curated cancer hotspot | Cancer Hotspots | changv2Protein-level hotspot annotation from Cancer Hotspots database | Cancer Hotspots | changv2Version of the OncoKB dataset used for annotation | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantHighest diagnostic implication level reported by OncoKB for the queried variant | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantHighest FDA-recognised level of evidence for the variant reported by OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantIndicates whether the variant is considered a hotspot by OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantDate of the most recent update to the OncoKB record | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantHighest therapeutic sensitivity level reported by OncoKB for the queried variant | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantLength of the structural variant event | Manta | Manta_v1.6Structural variant type (DEL, DUP, INV, BND, INS) | Manta | Manta_v1.6Whether the variant is annotated by OncoKB successfully. TRUE, FALSE | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantWhether the gene has been curated by the OncoKB Team. TRUE, FALSE | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantWhether the variant has been curated by the OncoKB Team. Note when a variant does not exist, it may still have annotations. True, False | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe biological effect of a mutation/alteration on the protein function that gives rise to changes in the biological properties of cells expressing the mutant/altered protein compared to cells expressing the wildtype protein. Gain-of-function, Likely Gain-of-function, Loss-of-function, Likely Loss-of-function, Switch-of-function, Likely Switch-of-function, Neutral, Likely Neutral, Inconclusive, Unknown | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantIn OncoKB, “oncogenic” is defined as “referring to the ability to induce or cause cancer” as described in the second edition of The Biology of Cancer by Robert Weinberg (2014). Oncogenic, Likely Oncogenic, Likely Neutral, Inconclusive, Unknown, Resistance | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe leveled therapeutic implications. | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPresence of Level 2 therapeutic evidence in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPresence of Level 3A therapeutic evidence in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPresence of Level R1 resistance evidence in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe highest level of evidence for therapeutic implications. Order LEVEL_R1 > LEVEL_1 > LEVEL_2 > LEVEL_3A > LEVEL_3B > LEVEL_4 > LEVEL_R2 | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe highest sensitive level of evidence for therapeutic implications. Order LEVEL_1 > LEVEL_2 > LEVEL_3A > LEVEL_3B > LEVEL_4 | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe highest resistance level of evidence for therapeutic implications. Order LEVEL_R1 > LEVEL_R2 | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe highest level of evidence for diagnostic implications. LEVEL_Dx1, LEVEL_Dx2, LEVEL_Dx3 | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe highest level of evidence for prognostic implications. LEVEL_Px1, LEVEL_Px2, LEVEL_Px3 | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantAllelic depths for reference and alternate alleles | VCF | VCF_v4.2Genotype call for the sample | VCF | VCF_v4.2CIViC variant name | CIViC | CIViC_v3.6Clinical significance of the variant according to CIViC evidence | CIViC | CIViC_v3.6Direction of clinical evidence (e.g. supports or does not support) | CIViC | CIViC_v3.6Unique CIViC identifier for Entity Disease | CIViC | CIViC_v3.6Therapies associated with the CIViC entity | CIViC | CIViC_v3.6CIViC evidence level classification | CIViC | CIViC_v3.6AMP classification category assigned by CIViC | CIViC | CIViC_v3.6Regulatory approval status associated with the CIViC assertion | CIViC | CIViC_v3.6Frequency of existing variant in 1000 Genomes https://www.ensembl.org/info/docs/tools/vep/vep_formats.html | VCF | vcf_v2.4Genome build used in the OncoKB annotation | OncoKB | Refer to the ONCOKB_DATA_VERSION columnHGNC gene symbol used in OncoKB annotation. Only added when annotating genomic change or HGVSg. When annotating genomic change, we obtained gene hugo symbol from GenomeNexus. This can be cross-referenced with your own gene name. | OncoKB | Refer to the ONCOKB_DATA_VERSION columnReference allele | VCF | vcf_v2.4Tumour allele 1 | VCF | vcf_v2.4Tumour allele 2 | VCF | vcf_v2.4Genomic position of the variant in the VCF record | VCF | vcf_v2.4Variant identifier from the VCF record | VCF | vcf_v2.4Variant quality score from the VCF record | VCF | vcf_v2.4FORMAT column describing the genotype fields available for each sample | VCF | VCF_v4.2Raw sample-level data extracted from the FORMAT column | VCF | VCF_v4.2Alternate allele used in annotation | VEP | 114.2Ensembl gene ID | VEP | 114.2Feature type (Transcript, Regulatory, etc.) | VEP | 114.2Ensembl feature identifier | VEP | 114.2Transcript biotype | VEP | 114.2Position within cDNA | VEP | 114.2Position within CDS | VEP | 114.2Position within protein sequence | VEP | 114.2Reference and alternate amino acids | VEP | 114.2Reference and alternate codons | VEP | 114.2Shortest distance from variant to transcript. Note DISTANCE of 0 is possible for insertions happening just before or after a transcript because variant coordinates are considered to be the flanking bases where insertion happens. | VEP | 114.2Strand of the feature (1/-1) | VEP | 114.2Transcript quality flags. Transcript annotation flags indicating potential issues with transcript completeness or coding sequence annotation (e.g. cds_start_NF, cds_end_NF) 3https://www.ensembl.org/info/genome/genebuild/transcript_quality_tags.html | VEP | 114.2Source of gene symbol | VEP | 114.2HGNC gene identifier | VEP | 114.2Indicates canonical transcript | VEP | 114.2Matched Annotation from NCBI and EMBL-EBI flag. https://www.ensembl.org/info/genome/genebuild/mane.html | VEP | 114.2MANE Select transcript. https://www.ensembl.org/info/genome/genebuild/mane.html | VEP | 114.2MANE Plus Clinical transcript. https://www.ensembl.org/info/genome/genebuild/mane.html | VEP | 114.2Transcript support level | VEP | 114.2APPRIS annotation indicating whether the transcript is a principal or alternative isoform https://appris.bioinfo.cnio.es/#/ | VEP | 114.2CCDS transcript identifier | VEP | 114.2Ensembl protein identifier | VEP | 114.2UniProt Swiss-Prot identifier | VEP | 114.2UniProt TrEMBL identifier | VEP | 114.2UniParc identifier | VEP | 114.2UniProt isoform identifier | VEP | 114.2Annotation source | VEP | 114.2Gene phenotype association | VEP | 114.2Protein domains overlapping variant | VEP | 114.2microRNA annotation | VEP | 114.2Offset applied to HGVS notation | VEP | 114.2Allele frequency in African populations (1000G/gnomAD) | gnomAD/1000G | VEP_114.2Allele frequency in Admixed American populations | gnomAD/1000G | VEP_114.2Allele frequency in East Asian populations | gnomAD/1000G | VEP_114.2Allele frequency in European populations | gnomAD/1000G | VEP_114.2Allele frequency in South Asian populations | gnomAD/1000G | VEP_114.2Allele frequency in African/African-American populations (gnomAD exomes) | gnomAD Exomes | gnomAD_v4.0Allele frequency in Admixed American populations (gnomAD exomes) | gnomAD Exomes | gnomAD_v4.0Allele frequency in Ashkenazi Jewish population (gnomAD exomes) | gnomAD Exomes | gnomAD_v4.0Allele frequency in East Asian populations (gnomAD exomes) | gnomAD Exomes | gnomAD_v4.0Allele frequency in Finnish populations (gnomAD exomes) | gnomAD Exomes | gnomAD_v4.0Allele frequency in Middle Eastern populations (gnomAD exomes) | gnomAD Exomes | gnomAD_v4.0Allele frequency in Non-Finnish European populations (gnomAD exomes) | gnomAD Exomes | gnomAD_v4.0Allele frequency in remaining populations (gnomAD exomes) | gnomAD Exomes | gnomAD_v4.0Allele frequency in South Asian populations (gnomAD exomes) | gnomAD Exomes | gnomAD_v4.0Allele frequency in African populations (gnomAD genomes) | gnomAD Genomes | gnomAD_v4.0Allele frequency in Amish population (gnomAD genomes) | gnomAD Genomes | gnomAD_v4.0Allele frequency in Admixed American populations (gnomAD genomes) | gnomAD Genomes | gnomAD_v4.0Allele frequency in Ashkenazi Jewish populations (gnomAD genomes) | gnomAD Genomes | gnomAD_v4.0Allele frequency in East Asian populations (gnomAD genomes) | gnomAD Genomes | gnomAD_v4.0Allele frequency in Finnish populations (gnomAD genomes) | gnomAD Genomes | gnomAD_v4.0Allele frequency in Middle Eastern populations (gnomAD genomes) | gnomAD Genomes | gnomAD_v4.0Allele frequency in Non-Finnish European populations (gnomAD genomes) | gnomAD Genomes | gnomAD_v4.0Allele frequency in remaining populations (gnomAD genomes) | gnomAD Genomes | gnomAD_v4.0Allele frequency in South Asian populations (gnomAD genomes) | gnomAD Genomes | gnomAD_v4.0Clinical significance assigned in ClinVar | ClinVar | ClinVar_2024-12Indicates whether the variant has a somatic clinical interpretation | ClinVar | ClinVar_2024-12Phenotype or disease associated with the variant | ClinVar | ClinVar_2024-12PubMed identifiers supporting the ClinVar submission | ClinVar | ClinVar_2024-12Regulatory motif affected | VEP | 114.2Position of the variant within the regulatory motif | VEP | 114.2Indicates whether the variant falls at a highly informative position in the motif | VEP | 114.2Change in motif binding score caused by the variant | VEP | 114.2Transcription factors associated with the regulatory motif | VEP | 114.2Decision threshold applied to SpliceAI delta scores to classify variants as likely splice-altering. Variants with a delta score equal to or greater than the specified cutoff (commonly 0.2 or 0.5 depending on pipeline configuration) are considered to have a predicted impact on splicing. This threshold is defined by the analysis pipeline rather than by SpliceAI itself. | SpliceAI | 1.3Predicted distance in base pairs between the variant position and the newly created splice acceptor site (acceptor gain). Positive or negative values indicate the position of the predicted splice site relative to the variant within the transcript sequence. | SpliceAI | 1.3Predicted distance in base pairs between the variant position and the disrupted splice acceptor site (acceptor loss). This value indicates where the affected splice acceptor site is located relative to the variant position. | SpliceAI | 1.3Predicted distance in base pairs between the variant position and the newly created splice donor site (donor gain). The value indicates the relative location of the predicted donor splice site with respect to the variant. | SpliceAI | 1.3Predicted distance in base pairs between the variant position and the disrupted splice donor site (donor loss). Indicates the relative location of the canonical donor splice site predicted to be affected by the variant. | SpliceAI | 1.3Gene symbol associated with the SpliceAI prediction. This represents the gene for which the splice impact prediction was calculated based on the transcript model used during annotation. | SpliceAI | 1.3ClinVar variant identifier | ClinVar | ClinVar_2024-12allele frequencies from GO-ESP | ClinVar | ClinVar_2024-12allele frequencies from ExAC | ClinVar | ClinVar_2024-12allele frequencies from TGP | ClinVar | ClinVar_2024-12the ClinVar Allele ID | ClinVar | ClinVar_2024-12For included Variant : ClinVar's preferred disease name for the concept specified by disease identifiers in CLNDISDB | ClinVar | ClinVar_2024-12Tag-value pairs of disease database name and identifier submitted for germline classifications, e.g. OMIM:NNNNNN | ClinVar | ClinVar_2024-12For included Variant: Tag-value pairs of disease database name and identifier for germline classifications, e.g. OMIM:NNNNNN | ClinVar | ClinVar_2024-12Conflicting germline classification for this single variant; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12Germline classification for a haplotype or genotype that includes this variant. Reported as pairs of VariationID:classification; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12SCV accession numbers for the submissions that contribute to the aggregate germline classification in ClinVar; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12Variant type | ClinVar | ClinVar_2024-12Sequence Ontology id for variant type | ClinVar | ClinVar_2024-12the variant's clinical sources reported as tag-value pairs of database and variant identifier | ClinVar | ClinVar_2024-12nsv accessions from dbVar for the variant | ClinVar | ClinVar_2024-12Gene(s) for the variant reported as gene symbol:gene id. The gene symbol and id are delimited by a colon (:) and each pair is delimited by a vertical bar (|) | ClinVar | ClinVar_2024-12comma separated list of molecular consequence in the form of Sequence Ontology ID|molecular_consequence | ClinVar | ClinVar_2024-12ClinVar's preferred disease name for the concept specified by disease identifiers in ONCDISDB | ClinVar | ClinVar_2024-12For included variant: ClinVar's preferred disease name for the concept specified by disease identifiers in ONCDISDBINCL | ClinVar | ClinVar_2024-12Tag-value pairs of disease database name and identifier submitted for oncogenicity classifications, e.g. MedGen:NNNNNN | ClinVar | ClinVar_2024-12For included variant: Tag-value pairs of disease database name and identifier for oncogenicity classifications, e.g. OMIM:NNNNNN | ClinVar | ClinVar_2024-12Oncogenicity classification for a haplotype or genotype that includes this variant. Reported as pairs of VariationID:classification; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12SCV accession numbers for the submissions that contribute to the aggregate oncogenicity classification in ClinVar; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12Conflicting oncogenicity classification for this single variant; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12dbSNP ID (i.e. rs number) | ClinVar | ClinVar_2024-12ClinVar's preferred disease name for the concept specified by disease identifiers in SCIDISDB | ClinVar | ClinVar_2024-12For included variant: ClinVar's preferred disease name for the concept specified by disease identifiers in SCIDISDBINCL | ClinVar | ClinVar_2024-12Tag-value pairs of disease database name and identifier submitted for somatic clinial impact classifications, e.g. MedGen:NNNNNN | ClinVar | ClinVar_2024-12For included variant: Tag-value pairs of disease database name and identifier for somatic clinical impact classifications, e.g. OMIM:NNNNNN | ClinVar | ClinVar_2024-12Somatic clinical impact classification for a haplotype or genotype that includes this variant. Reported as pairs of VariationID:classification; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12SCV accession numbers for the submissions that contribute to the aggregate somatic clinical impact in ClinVar; multiple values are separated by a vertical bar | ClinVar | ClinVar_2024-12CIViC variant identifier linking the variant to CIViC knowledgebase entries | CIViC | CIViC_v3.6Gene associated with the Cancer Hotspots protein-level hotspot | Cancer Hotspots | changv2HGVS protein change defining the Cancer Hotspots protein hotspot | Cancer Hotspots | changv2Indicates whether the variant lies within a 3D structural hotspot cluster | Cancer Hotspots | changv2Gene associated with the 3D structural hotspot cluster | Cancer Hotspots | changv2HGVS protein change associated with the 3D hotspot cluster | Cancer Hotspots | changv2Non-coding hotspot annotation from Cancer Hotspots dataset | Cancer Hotspots | changv2Gene associated with the non-coding hotspot | Cancer Hotspots | changv2HGVS coding notation associated with the non-coding hotspot | Cancer Hotspots | changv2Confidence interval around the END coordinate | Manta | Manta_v1.6Confidence interval around the POS coordinate | Manta | Manta_v1.6End position of the structural variant | Manta | Manta_v1.6Indicates whether the queried allele exists in the OncoKB knowledgebase. TRUE or FALSE | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnDescription of the mutation effect reported by OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantBrief overview of the gene and its role in cancer. Only when parameter -d is specified | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPubMed identifiers supporting the OncoKB annotation for the queried variant | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantVariant alteration string submitted in the OncoKB query | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnEntrez gene identifier used in the OncoKB query | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnHGNC gene symbol used in the OncoKB query. | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnReference genome build used for the OncoKB query | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnTumor type used in the OncoKB query context | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnQuery type used for the OncoKB annotation request | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantTumor type summary describes the therapeutic implication that applies to the indication. Only when parameter -d is specified | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantVariant summary describes the variant oncogenicity, last review if it is VUS. Only when parameter -d is specified | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantIndicates whether the variant is classified as a Variant of Uncertain Significance | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnHighest FDA-recognized level of evidence for the variant https://www.oncokb.org/fda-levels | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnOther significant therapeutic sensitivity levels | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnOther significant therapeutic resistance levels | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnText summary of prognostic implications from OncoKB https://www.oncokb.org/prognostic-levels | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnText summary of diagnostic implications from OncoKB https://www.oncokb.org/diagnostic-levels | OncoKB | Version-Refer to the ONCOKB_DATA_VERSION columnDescription of the mutation effect reported by OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPubMed identifiers supporting the mutation effect in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantAbstract-based citations supporting the mutation effect in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication tumor type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication main tumor type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication main tumor type form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication tumor tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication tumor type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication main tumor type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication main tumor type form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication tumor tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication tumor type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication main tumor type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication main tumor type form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication tumor tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication tumor type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication main tumor type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication main tumor type form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB diagnostic implication tumor tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment drugs (combined as Drug1 + Drug2) | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment approved indications | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication level of evidence | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication FDA level | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment excluded cancer types | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication supporting PubMed IDs | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment implication evidence description | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer type name | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated main cancer tumor form | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantOncoKB treatment associated cancer tissue | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantAll citations related to the biological effect. PMID, Abstract, Website link | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPresence of Level 3B therapeutic evidence in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPresence of Level 4 therapeutic evidence in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantPresence of Level R2 resistance evidence in OncoKB | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantAll citations related to therapeutic implications. PMID, Abstract, Website link | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe leveled diagnostic implications. Tumor type the level of evidence is assigned to | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe leveled diagnostic implications. Tumor type the level of evidence is assigned to | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe leveled diagnostic implications. Tumor type the level of evidence is assigned to | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantAll citations related to diagnostic implications. PMID, Abstract, Website link | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe leveled prognostic implications. Tumor type the level of evidence is assigned to | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe leveled prognostic implications. Tumor type the level of evidence is assigned to | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantThe leveled prognostic implications. Tumor type the level of evidence is assigned to | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantAll citations related to prognostic implications. PMID, Abstract, Website link | OncoKB | Refer to the ONCOKB_DATA_VERSION column and datetime of the last update of the variantApproximate read depth at the variant position | VCF Standard | VCF_v4.2Paired-read support for structural variant breakpoints | VCF | VCF_v4.2Split-read support for structural variant breakpoints | VCF | VCF_v4.2Allele reported in CIViC annotation | CIViC | CIViC_v3.6Variant consequence annotation associated with the CIViC record | CIViC | CIViC_v3.6Gene symbol associated with the CIViC variant | CIViC | CIViC_v3.6Entrez Gene identifier for the gene associated with the CIViC variant | CIViC | CIViC_v3.6Feature type associated with the variant annotation (e.g. transcript) | CIViC | CIViC_v3.6Transcript or genomic feature identifier used for the CIViC annotation | CIViC | CIViC_v3.6HGVS coding DNA notation associated with the CIViC variant | CIViC | CIViC_v3.6HGVS protein notation associated with the CIViC variant | CIViC | CIViC_v3.6Unique CIViC identifier for the variant | CIViC | CIViC_v3.6Alternative names used for the CIViC variant | CIViC | CIViC_v3.6URL linking to the CIViC variant page | CIViC | CIViC_v3.6Name of the CIViC molecular profile associated with the variant | CIViC | CIViC_v3.6Unique identifier of the CIViC molecular profile | CIViC | CIViC_v3.6Molecular Profile Aliases | CIViC | CIViC_v3.6URL linking to the CIViC molecular profile page | CIViC | CIViC_v3.6HGVS notation describing the variant used in CIViC | CIViC | CIViC_v3.6ClinGen Allele Registry identifier associated with the CIViC variant | CIViC | CIViC_v3.6ClinVar identifiers associated with the CIViC variant | CIViC | CIViC_v3.6Score assigned by CIViC representing evidence strength for the molecular profile | CIViC | CIViC_v3.6Type of CIViC entity represented (e.g. evidence, assertion) | CIViC | CIViC_v3.6URL linking to the CIViC entity page | CIViC | CIViC_v3.6Source publication or database supporting the CIViC entity | CIViC | CIViC_v3.6Variant origin classification (e.g. somatic, germline) | CIViC | CIViC_v3.6Curation status of the CIViC entity | CIViC | CIViC_v3.6Interaction type between therapies in CIViC evidence (e.g. combination) | CIViC | CIViC_v3.6Phenotypes associated with CIViC evidence records | CIViC | CIViC_v3.6CIViC evidence rating score | CIViC | CIViC_v3.6ACMG codes associated with CIViC assertions | CIViC | CIViC_v3.6NCCN guideline references associated with the CIViC assertion | CIViC | CIViC_v3.6FDA companion diagnostic test associated with the CIViC assertion | CIViC | CIViC_v3.6
TUMORp.Q61RENSP00000358548.4:p.Gln61Argchr1114713908TCPASSNM_002524missense_variantMODERATENRAS3/7c.182A>Grs11554290&COSV54736340&COSV54736624&COSV54738969&COSV54747786SNVdeleterious_low_confidence(0.02)0.000.000.000.000.8885.5000e-01Vascular_malformation&Large_congenital_melanocytic_nevus&Colorectal_cancer&Neurocutaneous_melanocytosis&not_provided&Linear_nevus_sebaceous_syndrome&Epidermal_nevus&Non-small_cell_lung_carcinoma&Noonan_syndrome_6&Thyroid_cancer&_nonmedullary&_2NC_000001.11:g.114713908T>Ccriteria_provided&_multiple_submitters&_no_conflictsPathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongNRASQ61Rchr1:114713908-114713908v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot11/08/2024LEVEL_2TrueTrueTrueGain-of-functionOncogenicCobimetinib,TrametinibBinimetinib,Cobimetinib,Selumetinib+Iodine I 131-6-Beta-Iodomethyl-19-Norcholesterol,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_2LEVEL_R1LEVEL_Dx2LEVEL_Px155,230/1Q61R0.2948717948717949GRCh38NRASTTC114713908NRAS_Q61R.GT:AD:AF:DP0/1:55,23:0.29:78CENSG00000213281TranscriptENST00000369535protein_coding31318261Q/RcAa/cGa-1HGNCHGNC:7989YESMANE_SelectNM_002524.51P1CCDS877.1ENSP00000358548P01111.251Q5U091.171UPI0000001254Ensembl1PDB-ENSP_mappings:3con.A&PDB-ENSP_mappings:5uhv.A&PDB-ENSP_mappings:6e6h.A&PDB-ENSP_mappings:6mpp.B&PDB-ENSP_mappings:6wgh.A&PDB-ENSP_mappings:6wgh.B&PDB-ENSP_mappings:6zio.A&PDB-ENSP_mappings:6zio.B&PDB-ENSP_mappings:6zir.A&PDB-ENSP_mappings:6ziz.A&PDB-ENSP_mappings:6ziz.B&PDB-ENSP_mappings:7f68.A&PDB-ENSP_mappings:8tbi.A&PDB-ENSP_mappings:8tbi.B&PDB-ENSP_mappings:8vm2.A&PDB-ENSP_mappings:8vm2.B&PDB-ENSP_mappings:8vm2.C&SMART:SM00173&SMART:SM00175&SMART:SM00174&Superfamily:SSF52540&CDD:cd04138&PANTHER:PTHR24070&PROSITE_profiles:PS51419&PROSITE_profiles:PS51420&PROSITE_profiles:PS51421&Pfam:PF00071&NCBIFAM:TIGR00231&Gene3D:3.40.50.300&Prints:PR00449&AFDB-ENSP_mappings:AF-P01111-F1likely_pathogenic&pathogenic&uncertain_significance0&1&1&1&11&1&1&1&124033266&1654209&2278970&2674680&3122217&6587382&8120410&12460918&12727991&14508525&16273091&16291983&16434492&17699718&18390968&18633438&18948947&19075190&19880792&20130576&20149136&20179705&20406486&20619739&20736745&21107323&21305640&21576590&21729679&21829508&22407852&22499344&22761467&22773810&23392294&23414587&23515407&23538902&23569304&23614898&24006476&24370118&25032700&25157968&26619011&29525983&31752122&35117297&29721857&38684670FAIL6-42-6-1NRAS1390028939MONDO:MONDO:0024291&MedGen:C0158570&Human_Phenotype_Ontology:HP:0005600&Human_Phenotype_Ontology:HP:0005604&MONDO:MONDO:0044792&MedGen:C1842036&OMIM:137550&Orphanet:626&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500&MONDO:MONDO:0009578&MedGen:C0544862&OMIM:249400&Orphanet:2481&MedGen:C3661900&Human_Phenotype_Ontology:HP:0010817&MONDO:MONDO:0008097&MedGen:C4552097&OMIM:163200&Orphanet:2612&Human_Phenotype_Ontology:HP:0010816&MONDO:MONDO:0008093&MedGen:C0334082&OMIM:162900&Orphanet:79414&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&MONDO:MONDO:0013186&MedGen:C2750732&OMIM:613224&Orphanet:648&MONDO:MONDO:0008566&MedGen:C4225426&OMIM:188470SCV000061232&SCV000490986&SCV002525697&SCV004810324&SCV005902174&SCV006279548single_nucleotide_variantSO:0001483ClinGen:CA123618&OMIM:164790.0002&UniProtKB:P01111#VAR_006847NRAS:4893SO:0001583&missense_variantNodal_T-follicular_helper_cell_lymphoma&Neoplasm.&Human_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV00509416511554290Melanoma&Follicular_thyroid_carcinoma&Embryonal_rhabdomyosarcoma&Diffuse_midline_glioma&_H3_K27M-mutant&GerminomaHuman_Phenotype_Ontology:HP:0002861&Human_Phenotype_Ontology:HP:0002887&Human_Phenotype_Ontology:HP:0006777&Human_Phenotype_Ontology:HP:0007474&MONDO:MONDO:0005105&MeSH:D008545&MedGen:C0025202&Human_Phenotype_Ontology:HP:0006731&MONDO:MONDO:0005034&MedGen:C0206682&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0957196&MedGen:C4289688&Human_Phenotype_Ontology:HP:0100620&MONDO:MONDO:0002598&MedGen:C0206660SCV007104959&SCV007104971&SCV007104972&SCV0071055111:114713908-1147139081NRASp.Q61RTrueThe NRAS Q61R mutation is located in the switch II region of the catalytic domain of the protein. This mutation has been found in melanoma and lung cancer and is a statistically significant hotspot (PMID:23515407, 30552700, 26619011). Knockdown of this endogenously expressed mutation in lung cancer and melanoma cell lines demonstrates that it is activating as measured by decreased cell proliferation, decreased tumor volume in xenograft models and decreased pathway activation compared to control knockdown (PMID: 23515407). Structural analysis of the Q61 residue demonstrates that it is crucial for NRAS GTP hydrolyzing activity suggesting that any mutation at Q61 would render the protein constitutively active (PMID: 10574788, 20194776, 9219684). In vitro studies have demonstrated that this mutation was resistant to the EGFR tyrosine kinase inhibitor, erlotinib, the ALK/MET/RON/ROS1 inhibitor, crizotinib, and the insulin-like growth factor-1 receptor inhibitor, linsitinib, and sensitive to two different MEK inhibitors, selumetinib and trametinib in lung cancer cell line models as measured by decreased cell viability and inhibited pathway activation in the presence of the drug (PMID: 23515407). In a basket trial of refractory solid tumors treated with a single-agent MEK inhibitor, binimetinib, eight patients with codon 61 NRAS-mutated colorectal cancer (n = 1 patient with Q61R) had a significantly longer OS and PFS compared to sixteen patients with colorectal cancer harboring a mutation in codon 12/13 (PMID: 33637626).NRAS, a GTPase, is mutated in a diverse range of cancers, most frequently in melanoma and thyroid cancer.10574788|9219684|20194776|33637626|23515407|26619011|30552700Q61R4893NRASGRCh38.MUTATION.The NRAS Q61R mutation is known to be oncogenic.FalseLEVEL_Fda2The NRAS Q61R mutation is located in the switch II region of the catalytic domain of the protein. This mutation has been found in melanoma and lung cancer and is a statistically significant hotspot (PMID:23515407, 30552700, 26619011). Knockdown of this endogenously expressed mutation in lung cancer and melanoma cell lines demonstrates that it is activating as measured by decreased cell proliferation, decreased tumor volume in xenograft models and decreased pathway activation compared to control knockdown (PMID: 23515407). Structural analysis of the Q61 residue demonstrates that it is crucial for NRAS GTP hydrolyzing activity suggesting that any mutation at Q61 would render the protein constitutively active (PMID: 10574788, 20194776, 9219684). In vitro studies have demonstrated that this mutation was resistant to the EGFR tyrosine kinase inhibitor, erlotinib, the ALK/MET/RON/ROS1 inhibitor, crizotinib, and the insulin-like growth factor-1 receptor inhibitor, linsitinib, and sensitive to two different MEK inhibitors, selumetinib and trametinib in lung cancer cell line models as measured by decreased cell viability and inhibited pathway activation in the presence of the drug (PMID: 23515407). In a basket trial of refractory solid tumors treated with a single-agent MEK inhibitor, binimetinib, eight patients with codon 61 NRAS-mutated colorectal cancer (n = 1 patient with Q61R) had a significantly longer OS and PFS compared to sixteen patients with colorectal cancer harboring a mutation in codon 12/13 (PMID: 33637626).['10574788', '9219684', '20194776', '33637626', '23515407', '26619011', '30552700']LEVEL_Dx2['26341525', '23690417']This assertion is supported by (PMID: 23690417, 26341525, Abstract: Patel, B. et al., Abstract# Blood 124:1893, 2014. http://www.bloodjournal.org/content/124/21/1893?sso-checked=true).Chronic Myelomonocytic LeukemiaMyelodysplastic/Myeloproliferative NeoplasmsLIQUIDMyeloidLEVEL_Dx2['29146900', '24881041', '24030381', '21714648', '24220272']This assertion is supported by (PMID: 24881041, 21714648, 24220272, 24030381, 29146900).Myelodysplastic SyndromesMyelodysplastic SyndromesLIQUIDMyeloidLEVEL_Dx3['22237106']This assertion is supported by (PMID: 22237106).Early T-Cell Precursor Lymphoblastic LeukemiaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidLEVEL_Dx2['10049057', '23832011', '25691160', '26457647', '12717436']This assertion is supported by (PMID: 23832011, 26457647, 12717436, 10049057, PMID: 25691160).Juvenile Myelomonocytic LeukemiaMyelodysplastic/Myeloproliferative NeoplasmsLIQUIDMyeloidCetuximabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR-expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring NRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).Colorectal CancerSOLIDBowelTucatinib + TrastuzumabLEVEL_R1LEVEL_Fda2['30857956']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Patients with metastatic colorectal cancer harboring RAS mutations do not respond favorably to trastuzumab as seen in the MyPath trial. In the multiple basket MyPath Phase IIa trial of pertuzumab and trastuzumab in which 56 metastatic colorectal cancer patients with HER2 amplification received combination therapy, the objective response rate for patients with RAS wildtype colorectal cancer (43/56 patients) compared to RAS mutated colorectal cancer (13/56 patients) was 40% (17/43, 95% CI, 25%56%) versus 8% (1/13, 95% CI 0.2%36%), respectively (PMID: 30857956).Colorectal CancerSOLIDBowelPanitumumabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR-expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring NRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).Colorectal CancerSOLIDBowelCobimetinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 0/12 patients with NRAS mutations), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).Erdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidCobimetinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase I trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with NRAS G12D), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MAP2K1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidCobimetinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).Rosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 0/12 patients with NRAS mutations), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).Erdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase I trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with NRAS G12D), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MAP2K1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).Rosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidBinimetinibLEVEL_3ALEVEL_Fda3['28284557', '16273091']Binimetinib is a small molecule inhibitor of MEK1/2 kinases. In the Phase III NEMO trial of binimetinib versus dacarbazine in melanoma harboring NRAS mutation, though there was no difference in median overall survival between the treatment arms (11.0 versus 10.1 months, respectively, HR = 1.0, p=0.5), median progression-free survival was longer with binimetinib than dacarbazine (3.0 months versus 1.8 months, respectively, HR = 0.63, p<0.001) and binimetinib treatment was associated with a higher number of patients with overall response and disease control than dacarbazine treatment (PMID: 28284557). Melanoma cell lines harboring NRAS activating mutations, such as NRAS Q61R, are sensitive to MEK inhibition in vitro, showing decreased RAS pathway signaling and decreased cell proliferation upon treatment with a MEK inhibitor (PMID: 16273091).MelanomaMelanomaSOLIDSkinCobimetinibLEVEL_3ALEVEL_Fda3['30361829']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).HistiocytosisLIQUIDMyeloidSelumetinib + Iodine I 131-6-Beta-Iodomethyl-19-NorcholesterolLEVEL_3ALEVEL_Fda3['22105174', '23406027']Selumetinib is a small molecule inhibitor of MEK1/2 kinases. In a clinical study of selumetinib in combination with radioiodine uptake therapy, five of five patients with radioiodine-refractory metastatic thyroid cancer harboring activating NRAS mutations (Q61R or Q61K) achieved dosimetry threshold for radioiodine uptake after selumetinib treatment, with four of five patients and one of five patients achieving partial response or stable disease, respectively (PMID: 23406027). Mouse models of dedifferentiated, radioiodine-refractory thyroid cancer harboring MAPK-activating mutations (such as BRAF V600E) showed re-expression of thyroid-specific genes and increased response to radioiodine after administration of a MEK inhibitor (PMID: 22105174).Thyroid CancerSOLIDThyroidTrametinibLEVEL_3ALEVEL_Fda3['30361829']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).HistiocytosisLIQUIDMyeloidBinimetinib + RibociclibLEVEL_4LEVEL_Fda3['30819666', '29496665', '22983396']Binimetinib is a small molecule inhibitor of MEK1/2 kinases. Ribociclib is a selective inhibitor of CDK4/6. In a Phase Ib/II trial of binimetinib in combination with ribociclib in melanoma harboring activating NRAS mutation, four of sixteen patients had partial responses and seven of sixteen patients had stable disease in response to combined drug treatment (Abstract: Schuler et al. Abstract #9519, ASCO 2017. http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.9519). A patient with melanoma harboring an NRAS G13R mutation had a partial response to binimetinib + ribociclib for four months before developing a PIK3CA resistance mutation and progressing (PMID: 29496665). Mouse allograft studies of melanoma harboring the NRAS Q61K mutation demonstrated synergistically decreased cell proliferation and tumor shrinkage in response to combined MEK1/2 and CDK4/6 inhibition compared to inhibition of either target alone (PMID: 22983396). In vitro studies have shown that resistance to combined MEK1/2 and CDK4/6 inhibition may occur through the reactivation of RAS and/or PI3K signaling (PMID: 30819666).MelanomaMelanomaSOLIDSkin10574788;9219684;20194776;33637626;23515407;26619011;30552700Binimetinib+Ribociclib20921465;21228335;20619739;24024839;18316791;30857956;30867592;32991018;29236635;28284557;16273091;30361829;22105174;23406027;30819666;29496665;22983396;Schuler et al. Abstract #9519, ASCO 2017.(http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.9519)CMML,MDS,JMMLETPLL26341525;23690417;Patel, B. et al., Abstract# Blood 124:1893, 2014.(http://www.bloodjournal.org/content/124/21/1893?sso-checked=true);29146900;24881041;24030381;21714648;24220272;22237106;10049057;23832011;25691160;26457647;12717436MDS24881041;21714648;8329714;2422027278Cmissense_variantNRAS4893GeneENST00000369535.4ENST00000369535.4:c.182A>GNP_002515.1:p.Gln61Arg96GLN61ARG/RS11554290https://civicdb.org/links/variants/96NRAS_Q61R96NM_002524.4:c.182A>G/NP_002515.1:p.Gln61Arg/NC_000001.10:g.115256529T>C/ENST00000369535.4:c.182A>GCA12361813900
TUMORp.R132HENSP00000260985.2:p.Arg132Hischr2208248388CTPASSNM_005896missense_variantMODERATEIDH14/10c.395G>Ars121913500&CM1310533&COSV61615239&COSV61615420SNVtolerated_low_confidence(0.07)benign(0.009)9.578e-061.317e-053.826e-05gnomADe_ASJ0.000.000.040.020.8528.2900e-01Metaphyseal_chondromatosis&Metaphyseal_chondromatosis_with_D-2-hydroxyglutaric_aciduria&Enchondromatosis&Glioblastoma_multiforme&_somatic&not_provided&Glioma_susceptibility_1NC_000002.12:g.208248388C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenicOncogeniccriteria_provided&_single_submitter35criteria_provided&_single_submitterTier_I_-_StrongIDH1R132Hrs121913500✓ Hotspotv7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot08/10/2024LEVEL_1TrueTrueTrueSwitch-of-functionOncogenicIvosidenib,Olutasidenib,VorasidenibIvosidenibIvosidenibLEVEL_1LEVEL_1LEVEL_Dx2LEVEL_Px262,300/1R132H0.32608695652173914GRCh38IDH1CCT208248388IDH1_R132H.GT:AD:AF:DP0/1:62,30:0.33:92TENSG00000138413TranscriptENST00000345146protein_coding618395132R/HcGt/cAt-1HGNCHGNC:5382YESMANE_SelectNM_005896.41P1CCDS2381.1ENSP00000260985O75874.233A0A024R3Y6.24UPI000012D1B4Ensembl1PDB-ENSP_mappings:1t09.A&PDB-ENSP_mappings:1t09.B&PDB-ENSP_mappings:1t0l.A&PDB-ENSP_mappings:1t0l.B&PDB-ENSP_mappings:1t0l.C&PDB-ENSP_mappings:1t0l.D&Gene3D:3.40.718.10&PDB-ENSP_mappings:3inm.A&PDB-ENSP_mappings:3inm.B&PDB-ENSP_mappings:3inm.C&PDB-ENSP_mappings:3map.A&PDB-ENSP_mappings:3map.B&PDB-ENSP_mappings:3mar.A&PDB-ENSP_mappings:3mar.B&PDB-ENSP_mappings:3mas.A&PDB-ENSP_mappings:3mas.B&PDB-ENSP_mappings:4i3k.A&PDB-ENSP_mappings:4i3k.B&PDB-ENSP_mappings:4i3l.A&PDB-ENSP_mappings:4i3l.B&PDB-ENSP_mappings:4kzo.A&PDB-ENSP_mappings:4kzo.B&PDB-ENSP_mappings:4kzo.C&PDB-ENSP_mappings:4l03.A&PDB-ENSP_mappings:4l03.B&PDB-ENSP_mappings:4l03.C&PDB-ENSP_mappings:4l04.A&PDB-ENSP_mappings:4l04.B&PDB-ENSP_mappings:4l04.C&PDB-ENSP_mappings:4l04.D&PDB-ENSP_mappings:4l04.E&PDB-ENSP_mappings:4l04.F&PDB-ENSP_mappings:4l06.A&PDB-ENSP_mappings:4l06.B&PDB-ENSP_mappings:4l06.C&PDB-ENSP_mappings:4l06.D&PDB-ENSP_mappings:4l06.E&PDB-ENSP_mappings:4l06.F&PDB-ENSP_mappings:4umx.A&PDB-ENSP_mappings:4umx.B&PDB-ENSP_mappings:4umy.A&PDB-ENSP_mappings:4umy.B&PDB-ENSP_mappings:4xrx.A&PDB-ENSP_mappings:4xrx.B&PDB-ENSP_mappings:4xs3.A&PDB-ENSP_mappings:4xs3.B&PDB-ENSP_mappings:5de1.A&PDB-ENSP_mappings:5de1.B&PDB-ENSP_mappings:5gir.C&PDB-ENSP_mappings:5gir.D&PDB-ENSP_mappings:5k10.A&PDB-ENSP_mappings:5k10.B&PDB-ENSP_mappings:5k11.A&PDB-ENSP_mappings:5k11.B&PDB-ENSP_mappings:5l57.A&PDB-ENSP_mappings:5l58.A&PDB-ENSP_mappings:5lge.A&PDB-ENSP_mappings:5lge.B&PDB-ENSP_mappings:5lge.C&PDB-ENSP_mappings:5lge.D&PDB-ENSP_mappings:5sun.A&PDB-ENSP_mappings:5sun.B&PDB-ENSP_mappings:5svf.A&PDB-ENSP_mappings:5svf.B&PDB-ENSP_mappings:5svf.C&PDB-ENSP_mappings:5svf.D&PDB-ENSP_mappings:5tqh.A&PDB-ENSP_mappings:5tqh.B&PDB-ENSP_mappings:5tqh.C&PDB-ENSP_mappings:5tqh.D&PDB-ENSP_mappings:5yfm.A&PDB-ENSP_mappings:5yfm.B&PDB-ENSP_mappings:5yfm.C&PDB-ENSP_mappings:5yfn.A&PDB-ENSP_mappings:5yfn.B&PDB-ENSP_mappings:6adg.A&PDB-ENSP_mappings:6adg.B&PDB-ENSP_mappings:6adg.C&PDB-ENSP_mappings:6b0z.A&PDB-ENSP_mappings:6b0z.B&PDB-ENSP_mappings:6b0z.C&PDB-ENSP_mappings:6b0z.D&PDB-ENSP_mappings:6bkx.A&PDB-ENSP_mappings:6bkx.B&PDB-ENSP_mappings:6bkx.C&PDB-ENSP_mappings:6bky.A&PDB-ENSP_mappings:6bky.B&PDB-ENSP_mappings:6bky.C&PDB-ENSP_mappings:6bky.D&PDB-ENSP_mappings:6bky.E&PDB-ENSP_mappings:6bky.F&PDB-ENSP_mappings:6bkz.A&PDB-ENSP_mappings:6bkz.B&PDB-ENSP_mappings:6bl0.A&PDB-ENSP_mappings:6bl0.B&PDB-ENSP_mappings:6bl0.C&PDB-ENSP_mappings:6bl1.A&PDB-ENSP_mappings:6bl1.B&PDB-ENSP_mappings:6bl1.C&PDB-ENSP_mappings:6bl2.A&PDB-ENSP_mappings:6bl2.B&PDB-ENSP_mappings:6bl2.C&PDB-ENSP_mappings:6io0.A&PDB-ENSP_mappings:6io0.B&PDB-ENSP_mappings:6o2y.A&PDB-ENSP_mappings:6o2y.B&PDB-ENSP_mappings:6o2y.C&PDB-ENSP_mappings:6o2z.A&PDB-ENSP_mappings:6o2z.B&PDB-ENSP_mappings:6pay.A&PDB-ENSP_mappings:6pay.B&PDB-ENSP_mappings:6pay.C&PDB-ENSP_mappings:6pay.D&PDB-ENSP_mappings:6q6f.A&PDB-ENSP_mappings:6q6f.B&PDB-ENSP_mappings:6u4j.A&PDB-ENSP_mappings:6u4j.B&PDB-ENSP_mappings:6vei.A&PDB-ENSP_mappings:6vei.B&PDB-ENSP_mappings:6vg0.A&PDB-ENSP_mappings:6vg0.B&PDB-ENSP_mappings:6vg0.C&PDB-ENSP_mappings:7pjm.A&PDB-ENSP_mappings:7pjm.B&PDB-ENSP_mappings:7pjm.C&PDB-ENSP_mappings:7pjn.A&PDB-ENSP_mappings:7pjn.B&PDB-ENSP_mappings:7pjn.C&PDB-ENSP_mappings:7pjn.D&PDB-ENSP_mappings:8bay.A&PDB-ENSP_mappings:8bay.B&PDB-ENSP_mappings:8bay.C&PDB-ENSP_mappings:8hb9.AAA&PDB-ENSP_mappings:8hb9.BBB&PDB-ENSP_mappings:8hb9.CCC&PDB-ENSP_mappings:8hb9.DDD&PDB-ENSP_mappings:8t7d.A&PDB-ENSP_mappings:8t7d.B&PDB-ENSP_mappings:8t7d.C&PDB-ENSP_mappings:8t7d.D&PDB-ENSP_mappings:8t7n.A&PDB-ENSP_mappings:8t7n.B&PDB-ENSP_mappings:8t7o.A&PDB-ENSP_mappings:8t7o.B&PDB-ENSP_mappings:8vh9.A&PDB-ENSP_mappings:8vh9.B&PDB-ENSP_mappings:8vha.A&PDB-ENSP_mappings:8vha.B&PDB-ENSP_mappings:8vha.C&PDB-ENSP_mappings:8vha.D&PDB-ENSP_mappings:8vhb.A&PDB-ENSP_mappings:8vhb.B&PDB-ENSP_mappings:8vhb.C&PDB-ENSP_mappings:8vhb.D&PDB-ENSP_mappings:8vhc.A&PDB-ENSP_mappings:8vhc.B&PDB-ENSP_mappings:8vhd.A&PDB-ENSP_mappings:8vhd.B&PDB-ENSP_mappings:8vhd.C&PDB-ENSP_mappings:8vhd.D&PDB-ENSP_mappings:8vhe.A&PDB-ENSP_mappings:8vhe.B&PDB-ENSP_mappings:8vhe.C&PDB-ENSP_mappings:8vhe.D&AFDB-ENSP_mappings:AF-O75874-F1&Pfam:PF00180&PIRSF:PIRSF000108&PANTHER:PTHR11822&SMART:SM01329&Superfamily:SSF53659&NCBIFAM:TIGR0012702.236e-053.826e-052.519e-053.744e-0507.195e-0601.159e-0500000002.942e-0500pathogenic&not_provided&pathogenic/likely_pathogenic&likely_pathogenic0&1&1&11&1&1&132069381&25157968&26619011&19657110&32326111&22160010&22397365&22417203&22898539&18772396&19798509&19818334&21446021&23558169&24606448&25043048&31371350&34854890&36061173&29066617&36233525&35509721&33106175&34946913&36201590&37478088&37774069&38409772&39110525&39165999FAIL35335-19IDH11564440.00002166215.&MONDO:MONDO:0013941&MedGen:C3553958&OMIM:614875&Orphanet:99646&Human_Phenotype_Ontology:HP:0005701&MONDO:MONDO:0008145&MedGen:C0014084&OMIM:166000&Orphanet:296&MedGen:C4016231&MedGen:C3661900&MONDO:MONDO:0024498&MedGen:C2750850&OMIM:137800SCV000996209&SCV001449548&SCV002507195&SCV002764259&SCV004011290&SCV004099007&SCV005438530&SCV005685410single_nucleotide_variantSO:0001483ClinGen:CA170874&OMIM:147700.0001&UniProtKB:O75874#VAR_055455IDH1:3417SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094442121913500Acute_myeloid_leukemia_with_NPM1_somatic_mutations&Astrocytoma_IDH-mutant&OligodendrogliomaMONDO:MONDO:0018437&MedGen:C4706386&Orphanet:402026&MedGen:C5669733&Human_Phenotype_Ontology:HP:0033681&MONDO:MONDO:0016695&MeSH:D009837&MedGen:C0028945&Orphanet:251627SCV007105305&SCV007105307&SCV0071053112:208248388-208248388IDH1p.R132HTrueThe IDH1 R132H mutation is located in the catalytic site of the IDH1 protein. This mutation has been found in acute myeloid leukemia and gliomas, among others (PMID: 19935646, 29860938). In vitro and in vivo studies have demonstrated that this mutation changes IDH1 enzymatic activity, allowing for the conversion of -ketoglutarate (-KG) to the "oncometabolite" D-2-hydroxyglutarate (2-HG), and leads to oncogenic activity, as evidenced by aberrant changes in DNA methylation, cytokine independence, dedifferentiation and in vivo increases in early hematopoietic progenitors compared to wildtype IDH1 (PMID: 19935646, 22763442, 23393090). IDH1 mutations at the R132 residue, including R132H, are sensitive to inhibition by AG-120 (Ivosidenib), a small-molecule inhibitor of mutant IDH1, as measured by a decrease in 2-HG level, an increase in the proportion of mature myeloid cells and increased levels of cell surface differentiation markers in treated cells compared to untreated cells (PMID: 29670690). A Phase I clinical trial for ivosidenib involving 268 patients with relapsed or refractory AML harboring IDH1 R132 mutations, including 59 with IDH1 R132H mutation, achieved an overall response rate of 41.6% and a reduction in the percentage of bone marrow blasts in treated patients (PMID: 29860938).IDH1, a cell metabolism enzyme, is recurrently mutated in various cancer types including acute myeloid leukemia and gliomas.23393090|22763442|29670690|19935646|29860938R132H3417IDH1GRCh38.MUTATION.The IDH1 R132H mutation is known to be oncogenic.FalseLEVEL_Fda2The IDH1 R132H mutation is located in the catalytic site of the IDH1 protein. This mutation has been found in acute myeloid leukemia and gliomas, among others (PMID: 19935646, 29860938). In vitro and in vivo studies have demonstrated that this mutation changes IDH1 enzymatic activity, allowing for the conversion of -ketoglutarate (-KG) to the "oncometabolite" D-2-hydroxyglutarate (2-HG), and leads to oncogenic activity, as evidenced by aberrant changes in DNA methylation, cytokine independence, dedifferentiation and in vivo increases in early hematopoietic progenitors compared to wildtype IDH1 (PMID: 19935646, 22763442, 23393090). IDH1 mutations at the R132 residue, including R132H, are sensitive to inhibition by AG-120 (Ivosidenib), a small-molecule inhibitor of mutant IDH1, as measured by a decrease in 2-HG level, an increase in the proportion of mature myeloid cells and increased levels of cell surface differentiation markers in treated cells compared to untreated cells (PMID: 29670690). A Phase I clinical trial for ivosidenib involving 268 patients with relapsed or refractory AML harboring IDH1 R132 mutations, including 59 with IDH1 R132H mutation, achieved an overall response rate of 41.6% and a reduction in the percentage of bone marrow blasts in treated patients (PMID: 29860938).['23393090', '22763442', '29670690', '19935646', '29860938']LEVEL_Dx2['22389253', '25465125', '20962861', '24220272', '24030381', '21714648', '26228814']This assertion is supported by (PMID: 21714648, 24220272, 24030381, 22389253, 25465125, 26228814, 20962861).Myelodysplastic SyndromesMyelodysplastic SyndromesLIQUIDMyeloidLEVEL_Dx2['22417203', '20538800', '22397365', '19657110', '20097881', '20368543', '20567020']This assertion is supported by (PMID: 22417203, 20538800, 22397365, 20097881, 20368543, 19657110, 20567020).Acute Myeloid LeukemiaLeukemiaLIQUIDMyeloidLEVEL_Dx3['23349305', '25573287']This assertion is supported by (PMID: 25573287, 23349305).Therapy-Related Myeloid NeoplasmsLeukemiaLIQUIDMyeloidIvosidenibLEVEL_1LEVEL_Fda2['23393090', '29860938', '23558169']Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation. FDA approval was based on the results from a Phase I dose escalation and expansion study of ivosidenib in IDH1-mutant AML in which 27 and eleven of 125 patients who received ivosidenib achieved complete remission and complete remission with partial hematologic recovery, respectfully, yielding a complete response rate of 30.4% (PMID: 29860938). In the multicenter, double-blind, randomized, placebo-controlled Phase III AGILE study of combination treatment of ivosidenib and azacitidine in 146 patients with newly diagnosed, untreated IDH1-mutant AML (ivosidenib plus azacitidine treatment, n=72, placebo and azacitidine treatment, n=72), 46.2% maintained red blood cell transfusion independence in the ivosidenib plus azacitidine group and 17.5% in the placebo plus azacitidine group (Abstract: Dohner et al. Abstract# 7042, ASCO 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.16_suppl.7042). In a real-world retrospective study of ivosidenib plus hypomethylating agent versus venetoclax plus hypomethylating agent in 283 patients with IDH1-mutant AML, the ivosidenib cohort (n=182) demonstrated a complete response of 42.9% and a median time to best response of 3.3 months versus 26.7% (p=0.007) and 4.1 months (p=0.02), respectively, in the venetoclax cohort (n=101) (Abstract: Smith et al. Abstract# 971, 2023 ASH Annual Meeting & Exposition. https://ash.confex.com/ash/2023/webprogram/Paper173033.html). Preclinical studies in glioma and acute myeloid leukemia (AML) models demonstrated that ivosidenib promotes cellular differentiation by inhibiting the production of the mutant IDH1 "oncometabolite," 2-hydroxyglutarate (2-HG), which can inhibit cell growth in vitro (PMID: 23558169, 23393090) (Abstract: Hansen et al. Abstract# 3734, ASH 2014. http://www.bloodjournal.org/content/124/21/3734?sso-checked=true).Acute Myeloid LeukemiaLeukemiaLIQUIDMyeloidIvosidenibLEVEL_1LEVEL_Fda2['32416072', '34554208']Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for the treatment of IDH1-mutant cholangiocarcinoma as detected by an FDA-approved test. FDA approval was based on the results of the Phase III ClarIDHy trial of ivosidenib versus placebo in 185 patients with IDH1-mutant cholangiocarcinoma in which the median progression-free survival was 2.7 months in the patients treated with ivosidenib compared to 1.4 months in the patients receiving placebo, with six- and twelve-month progression-free survival rates in the ivosidenib group of 32% and 21.9%, respectively (HR= 0.37, 95% CI= 0.25-0.54, p < 0.001) (PMID: 32416072). Overall survival was 10.8 months in the ivosidenib group versus six months (adjusted for crossover) for the placebo group (HR= 0.46, p = 0.0008) (PMID: 32416072). Final results demonstrated a mean overall survival of 10.3 months (95% CI= 7.8-12.4 months) with ivosidenib vs 7.5 months (95% CI= 4.8-11.1 months) with placebo (HR= 0.79 [95% CI, 0.56-1.12], p = .09) (PMID: 34554208).CholangiocarcinomaHepatobiliary CancerSOLIDBiliary TractIvosidenibLEVEL_1LEVEL_Fda2['32416072', '34554208']Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for the treatment of IDH1-mutant cholangiocarcinoma as detected by an FDA-approved test. FDA approval was based on the results of the Phase III ClarIDHy trial of ivosidenib versus placebo in 185 patients with IDH1-mutant cholangiocarcinoma in which the median progression-free survival was 2.7 months in the patients treated with ivosidenib compared to 1.4 months in the patients receiving placebo, with six- and twelve-month progression-free survival rates in the ivosidenib group of 32% and 21.9%, respectively (HR= 0.37, 95% CI= 0.25-0.54, p < 0.001) (PMID: 32416072). Overall survival was 10.8 months in the ivosidenib group versus six months (adjusted for crossover) for the placebo group (HR= 0.46, p = 0.0008) (PMID: 32416072). Final results demonstrated a mean overall survival of 10.3 months (95% CI= 7.8-12.4 months) with ivosidenib vs 7.5 months (95% CI= 4.8-11.1 months) with placebo (HR= 0.79 [95% CI, 0.56-1.12], p = .09) (PMID: 34554208).Intrahepatic CholangiocarcinomaHepatobiliary CancerSOLIDBiliary TractIvosidenibLEVEL_1LEVEL_Fda2Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for the treatment of IDH1 R132-mutant myelodysplastic syndromes. FDA approval was based on the results of the AG120-C-001 trial of ivosidenib in 18 patients with IDH1-mutant myelodysplastic syndrome in which 7 patients demonstrated complete remission (38.9%, 95% CI = 17.3, 64.3) with a non-evaluable (range = 1.9, 80.8 months) median complete remission duration (Abstract: DiNardo et al. Abstract# MDS-457, Clinical Lymphoma, Myeloma and Leukemia Vol 23, Supplement 1. https://www.sciencedirect.com/science/article/pii/S2152265023011898).Myelodysplastic SyndromesLIQUIDMyeloidOlutasidenibLEVEL_1LEVEL_Fda2Olutasidenib is a small-molecule inhibitor of mutant IDH1 that is FDA-approved in patients with acute myeloid leukemia (AML) with a susceptible IDH1 mutation. FDA approval was based on the results of the Phase II cohort of the phase I/II trial (Study 2102-HEM-101) of olutasidenib in 147 evaluable IDH1 inhibitor-nave patients with relapsed/refractory IDH1 R132-mutant AML in which the complete remission (CR) plus complete remission with partial hematologic recovery (CRh) rate was 35% (n=51, 95%CI= 27, 43), with a median duration of CR + CRh of 25.9 months (95% CI= 13.5, NR). The median duration of CR alone was 28.1 months (95% CI= 13.8, NR), and the observed duration of CRh (n=4) was 1.8, 5.6, 13.5 and 28.5+ months, respectively (Abstract: Cortes et al. Abstract #6193, ASH 2022. https://ashpublications.org/blood/article/140/Supplement%201/6193/487212).Acute Myeloid LeukemiaLeukemiaLIQUIDMyeloidVorasidenibLEVEL_1LEVEL_Fda2['37272516']Vorasidenib is an orally available, small molecule inhibitor of IDH1/2 that is FDA approved for the treatment of adult and pediatric patients twelve years and older with grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation, following surgery including biopsy, sub-total resection, or gross total resection. FDA approval is based on the results of the Phase III INDIGO (NCT04164901) trial of vorasidenib versus placebo in 331 patients with IDH1/2-mutant low-grade glioma. In the Phase III INDIGO (NCT04164901) trial, the vorasidenib cohort (n=168 [n=163, IDH1 mutant, n=5, IDH2 mutant]) demonstrated a median imaging-based progression-free survival (PFS) of 27.7 months (95% CI=17.0-NE) and the time to next intervention (TTNT) was 85.6% (95% CI=77.8-90.8) at eighteen months and 83.4% (95% CI=74.0-89.6) at 24 months while the placebo cohort (n=163 [n=152, IDH1 mutant, n=11, IDH2 mutant]) demonstrated a median imaging-based PFS of 11.1 months (95% CI=11.0-13.7) (HR=0.39 [95% CI=0.27-0.56], p<0.001) and the TTNT was 47.4% (95% CI=35.8-58.2) at eighteen months and 27.0% (95% CI=7.9-50.8) at 24 months (PMID: 37272516).Astrocytoma, IDH-MutantGliomaSOLIDCNS/BrainVorasidenibLEVEL_1LEVEL_Fda2['37272516']Vorasidenib is an orally available, small molecule inhibitor of IDH1/2 that is FDA approved for the treatment of adult and pediatric patients twelve years and older with grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation, following surgery including biopsy, sub-total resection, or gross total resection. FDA approval is based on the results of the Phase III INDIGO (NCT04164901) trial of vorasidenib versus placebo in 331 patients with IDH1/2-mutant low-grade glioma. In the Phase III INDIGO (NCT04164901) trial, the vorasidenib cohort (n=168 [n=163, IDH1 mutant, n=5, IDH2 mutant]) demonstrated a median imaging-based progression-free survival (PFS) of 27.7 months (95% CI=17.0-NE) and the time to next intervention (TTNT) was 85.6% (95% CI=77.8-90.8) at eighteen months and 83.4% (95% CI=74.0-89.6) at 24 months while the placebo cohort (n=163 [n=152, IDH1 mutant, n=11, IDH2 mutant]) demonstrated a median imaging-based PFS of 11.1 months (95% CI=11.0-13.7) (HR=0.39 [95% CI=0.27-0.56], p<0.001) and the TTNT was 47.4% (95% CI=35.8-58.2) at eighteen months and 27.0% (95% CI=7.9-50.8) at 24 months (PMID: 37272516).Oligodendroglioma, IDH-mutant, and 1p/19q-CodeletedGliomaSOLIDCNS/BrainIvosidenibLEVEL_2LEVEL_Fda2['32530764']Ivosidenib is an orally available, small-molecule IDH1 inhibitor that is FDA-approved for adult patients with a susceptible IDH1 mutation, as detected by an FDA-approved test, with acute myeloid leukemia or locally advanced or metastatic cholangiocarcinoma. Ivosidenib is also recommended in the NCCN Central Nervous System Cancers Guidelines (V1.2024) as an adjuvant treatment option that is "Useful in Certain Circumstances" for patients with IDH1-mutant grade 2 oligodendroglioma or astrocytoma. NCCN recommendation is based on the results of the Phase I AG120-C-002 (NCT02073994) trial of ivosidenib in 66 patients with IDH1-mutant advanced glioma (n=35, non-enhancing glioma, n=31, enhancing glioma). In the Phase I AG120-C-002 (NCT02073994) trial, the nonenhancing glioma cohort demonstrated a 2.9% (n=1) partial response rate, an 85.7% (n=30) stable disease (SD) rate and a median progression-free survival (PFS) of 13.6 months (95% CI=9.2-33.2), while the enhancing glioma cohort demonstrated a 45.2% SD rate and a median PFS of 1.4 months (95% CI=1.0-1.9) (PMID: 32530764).Astrocytoma, IDH-MutantGliomaSOLIDCNS/BrainIvosidenibLEVEL_2LEVEL_Fda2['32530764']Ivosidenib is an orally available, small-molecule IDH1 inhibitor that is FDA-approved for adult patients with a susceptible IDH1 mutation, as detected by an FDA-approved test, with acute myeloid leukemia or locally advanced or metastatic cholangiocarcinoma. Ivosidenib is also recommended in the NCCN Central Nervous System Cancers Guidelines (V1.2024) as an adjuvant treatment option that is "Useful in Certain Circumstances" for patients with IDH1-mutant grade 2 oligodendroglioma or astrocytoma. NCCN recommendation is based on the results of the Phase I AG120-C-002 (NCT02073994) trial of ivosidenib in 66 patients with IDH1-mutant advanced glioma (n=35, non-enhancing glioma, n=31, enhancing glioma). In the Phase I AG120-C-002 (NCT02073994) trial, the nonenhancing glioma cohort demonstrated a 2.9% (n=1) partial response rate, an 85.7% (n=30) stable disease (SD) rate and a median progression-free survival (PFS) of 13.6 months (95% CI=9.2-33.2), while the enhancing glioma cohort demonstrated a 45.2% SD rate and a median PFS of 1.4 months (95% CI=1.0-1.9) (PMID: 32530764).Oligodendroglioma, IDH-mutant, and 1p/19q-CodeletedGliomaSOLIDCNS/BrainIvosidenibLEVEL_2LEVEL_Fda2['32208957']Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation. Ivosidenib is listed in the Bone Cancer NCCN (v1.2021) as a category 2A recommendation for patients with IDH1-mutant chondrosarcoma. In a Phase I study of ivosidenib in 21 patients with IDH1-mutant chondrosarcoma, the median progression-free survival was 5.6 months (95%CI= 1.9 to 7.4 mos) with eleven of 21 patients having stable disease (PMID: 32208957).ChondrosarcomaBone CancerSOLIDBoneIvosidenibLEVEL_3ALEVEL_Fda3['29670690', '32530764']Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation. In a clinical trial of ivosidenib in 66 patients with IDH1-mutant glioma, one patient with non-enhancing glioma (n= 1 of 35) had a partial response and 30 patients (n= 30 of 35) had stable disease, with an objective response rate in the cohort of 2.9% and a median progression-free survival of 13.6 months (95% CI= 9.2 to 33.2 months)(PMID: 29670690). Preclinical studies have demonstrated the efficacy of ivosidenib in reducing 2-HG levels in IDH1-mutant tumor models (PMID: 32530764).GliomaSOLIDCNS/Brain23393090;22763442;29670690;19935646;2986093823393090;29860938;23558169;Smith et al. Abstract# 971, 2023 ASH Annual Meeting & Exposition.(https://ash.confex.com/ash/2023/webprogram/Paper173033.html);Hansen et al. Abstract# 3734, ASH 2014.(http://www.bloodjournal.org/content/124/21/3734?sso-checked=true);Dohner et al. Abstract# 7042, ASCO 2022.(https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.16_suppl.7042);32416072;34554208;DiNardo et al. Abstract# MDS-457, Clinical Lymphoma, Myeloma and Leukemia Vol 23, Supplement 1.(https://www.sciencedirect.com/science/article/pii/S2152265023011898);Cortes et al. Abstract #6193, ASH 2022.(https://ashpublications.org/blood/article/140/Supplement%201/6193/487212);37272516;32530764;32208957;29670690MDS,AMLTMN22389253;25465125;20962861;24220272;24030381;21714648;26228814;22417203;20538800;22397365;19657110;20097881;20368543;20567020;23349305;25573287PMF23619563;2666868092Tmissense_variantIDH13417GeneENST00000415913.1ENST00000415913.1:c.395G>ANP_005887.2:p.Arg132His420ARG132HIS/RS121913500https://civicdb.org/links/variants/420IDH1_R132H416NM_001282386.1:c.395G>A/NP_005887.2:p.Arg132His/NC_000002.11:g.209113112C>T/ENST00000415913.1:c.395G>ACA170874156444
TUMORp.E545KENSP00000263967.3:p.Glu545Lyschr3179218303GAPASSNM_006218missense_variantMODERATEPIK3CA10/21c.1633G>Ars104886003&CM126692&COSV55873239&COSV55878227SNVdeleterious(0)probably_damaging(0.912)0.000.000.000.000.6542.2100e-01HEMIFACIAL_MYOHYPERPLASIA&_SOMATIC&PIK3CA_overgrowth_syndrome&Rare_combined_vascular_malformation&Rare_venous_malformation&Eccrine_angiomatous_hamartoma&Cerebrofacial_Vascular_Metameric_Syndrome_(CVMS)&PIK3CA-related_disorder&Gallbladder_cancer&Gastric_cancer&Sarcoma&PIK3CA_related_overgrowth_syndrome&Angioosteohypertrophic_syndrome&not_provided&Megalencephaly-capillary_malformation-polymicrogyria_syndrome&CLOVES_syndrome&Ovarian_neoplasm&Seborrheic_keratosis&OVARIAN_CANCER&_EPITHELIAL&_SOMATIC&Non-small_cell_lung_carcinoma&Carcinoma_of_colon&Breast_adenocarcinoma&Abnormal_cardiovascular_system_morphology&Segmental_undergrowth_associated_with_lymphatic_malformationNC_000003.12:g.179218303G>Acriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongPIK3CAE545Kchr3:179218303-179218303v7.0.LEVEL_Fda2✓ Hotspot10/16/2024LEVEL_1TrueTrueTrueGain-of-functionOncogenicAlpelisib+Fulvestrant,Capivasertib+Fulvestrant,Inavolisib+Palbociclib+FulvestrantLEVEL_1LEVEL_158,320/1E545K0.35555555555555557GRCh38PIK3CAGGA179218303PIK3CA_E545K.GT:AD:AF:DP0/1:58,32:0.35:90AENSG00000121879TranscriptENST00000263967protein_coding19561633545E/KGag/Aag1HGNCHGNC:8975YESMANE_SelectNM_006218.42P1CCDS43171.1ENSP00000263967P42336.236UPI000013D494Ensembl1Gene3D:1.25.40.70&PDB-ENSP_mappings:2rd0.A&PDB-ENSP_mappings:3hhm.A&PDB-ENSP_mappings:3hiz.A&PDB-ENSP_mappings:3zim.A&PDB-ENSP_mappings:4jps.A&PDB-ENSP_mappings:4l1b.A&PDB-ENSP_mappings:4l23.A&PDB-ENSP_mappings:4l2y.A&PDB-ENSP_mappings:4ovu.A&PDB-ENSP_mappings:4ovv.A&PDB-ENSP_mappings:4tuu.A&PDB-ENSP_mappings:4tv3.A&PDB-ENSP_mappings:4waf.A&PDB-ENSP_mappings:4ykn.A&PDB-ENSP_mappings:4zop.A&PDB-ENSP_mappings:5dxh.A&PDB-ENSP_mappings:5dxh.D&PDB-ENSP_mappings:5dxt.A&PDB-ENSP_mappings:5fi4.A&PDB-ENSP_mappings:5itd.A&PDB-ENSP_mappings:5sw8.A&PDB-ENSP_mappings:5swg.A&PDB-ENSP_mappings:5swo.A&PDB-ENSP_mappings:5swp.A&PDB-ENSP_mappings:5swr.A&PDB-ENSP_mappings:5swt.A&PDB-ENSP_mappings:5sx8.A&PDB-ENSP_mappings:5sx9.A&PDB-ENSP_mappings:5sxa.A&PDB-ENSP_mappings:5sxb.A&PDB-ENSP_mappings:5sxc.A&PDB-ENSP_mappings:5sxd.A&PDB-ENSP_mappings:5sxe.A&PDB-ENSP_mappings:5sxf.A&PDB-ENSP_mappings:5sxi.A&PDB-ENSP_mappings:5sxj.A&PDB-ENSP_mappings:5sxk.A&PDB-ENSP_mappings:5ubr.A&PDB-ENSP_mappings:5uk8.A&PDB-ENSP_mappings:5ukj.A&PDB-ENSP_mappings:5ul1.A&PDB-ENSP_mappings:5xgh.A&PDB-ENSP_mappings:5xgi.A&PDB-ENSP_mappings:5xgj.A&PDB-ENSP_mappings:6gvf.A&PDB-ENSP_mappings:6gvg.A&PDB-ENSP_mappings:6gvh.A&PDB-ENSP_mappings:6gvi.A&PDB-ENSP_mappings:6nct.A&PDB-ENSP_mappings:6oac.A&PDB-ENSP_mappings:6pys.A&PDB-ENSP_mappings:7jiu.A&PDB-ENSP_mappings:7k6m.A&PDB-ENSP_mappings:7k6n.A&PDB-ENSP_mappings:7k6o.A&PDB-ENSP_mappings:7k71.A&PDB-ENSP_mappings:7mlk.A&PDB-ENSP_mappings:7myn.A&PDB-ENSP_mappings:7myo.A&PDB-ENSP_mappings:7pg5.A&PDB-ENSP_mappings:7pg6.A&PDB-ENSP_mappings:7r9v.A&PDB-ENSP_mappings:7r9y.A&PDB-ENSP_mappings:7tz7.A&PDB-ENSP_mappings:8am0.A&PDB-ENSP_mappings:8bfu.A&PDB-ENSP_mappings:8dcp.A&PDB-ENSP_mappings:8dcx.A&PDB-ENSP_mappings:8dd4.A&PDB-ENSP_mappings:8dd8.A&PDB-ENSP_mappings:8exl.A&PDB-ENSP_mappings:8exo.A&PDB-ENSP_mappings:8exu.A&PDB-ENSP_mappings:8exv.A&PDB-ENSP_mappings:8gua.A&PDB-ENSP_mappings:8gub.A&PDB-ENSP_mappings:8gud.A&PDB-ENSP_mappings:8ilr.A&PDB-ENSP_mappings:8ils.A&PDB-ENSP_mappings:8ilv.A&PDB-ENSP_mappings:8ow2.A&PDB-ENSP_mappings:8sbc.A&PDB-ENSP_mappings:8sbj.A&PDB-ENSP_mappings:8tdu.A&PDB-ENSP_mappings:8tdu.C&PDB-ENSP_mappings:8tgd.A&PDB-ENSP_mappings:8tgd.C&PDB-ENSP_mappings:8ts7.A&PDB-ENSP_mappings:8ts8.A&PDB-ENSP_mappings:8ts9.A&PDB-ENSP_mappings:8tsa.A&PDB-ENSP_mappings:8tsb.A&PDB-ENSP_mappings:8tsc.A&PDB-ENSP_mappings:8tsd.A&PDB-ENSP_mappings:8tu6.A&PDB-ENSP_mappings:8twy.A&PDB-ENSP_mappings:8v8h.A&PDB-ENSP_mappings:8v8h.C&PDB-ENSP_mappings:8v8i.A&PDB-ENSP_mappings:8v8i.C&PDB-ENSP_mappings:8v8j.A&PDB-ENSP_mappings:8v8j.C&PDB-ENSP_mappings:8v8u.A&PDB-ENSP_mappings:8v8u.C&PDB-ENSP_mappings:8v8v.A&PDB-ENSP_mappings:8v8v.C&PDB-ENSP_mappings:8w9a.A&PDB-ENSP_mappings:8w9b.A&AFDB-ENSP_mappings:AF-P42336-F1&Pfam:PF00613&PROSITE_profiles:PS51545&PANTHER:PTHR10048&SMART:SM00145&Superfamily:SSF48371&CDD:cd00872pathogenic&pathogenic/likely_pathogenic&not_provided&likely_pathogenic0&1&1&11&1&1&125741868&30089490&26900293&20619739&25157968&26619011&25307848&22729224&22729223&35127508&31188922&15016963&15254419&15520168&15608678&15647370&15805248&16906227&17673550&18676830&18725974&19029981&19223544&19366826&19513541&19903786&20453058&21430269&22162582&22162589&22271473&23408298&23888070&23946963&22658544&21264207&25599672&34776939&31949278&33105631&31749428&32422573&28708103&37195967&33795829&36866106&36765720&34058070&32934698&37712948FAIL363531PIK3CA136550.0000128694.&.&MedGen:C5681115&Orphanet:458837&MedGen:C0265950&Orphanet:211252&MONDO:MONDO:0975755&MedGen:C0406801&Orphanet:673568&.&.&MONDO:MONDO:0005411&MedGen:C0153452&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&Human_Phenotype_Ontology:HP:0100242&MONDO:MONDO:0005089&MedGen:C1261473&MONDO:MONDO:1040002&MedGen:C4728213&Orphanet:530313&MONDO:MONDO:0007864&MeSH:D007715&MedGen:C0022739&OMIM:149000&Orphanet:2346&MedGen:C3661900&MONDO:MONDO:0011240&MedGen:C1865285&OMIM:602501&Orphanet:60040&MONDO:MONDO:0013038&MedGen:C2752042&OMIM:612918&Orphanet:140944&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&Human_Phenotype_Ontology:HP:0031287&MONDO:MONDO:0008420&MedGen:C0022603&OMIM:182000&MedGen:C1868358&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&MONDO:MONDO:0002032&MedGen:C0699790&MONDO:MONDO:0004988&MedGen:C0858252&Human_Phenotype_Ontology:HP:0001632&Human_Phenotype_Ontology:HP:0002564&Human_Phenotype_Ontology:HP:0002565&Human_Phenotype_Ontology:HP:0030680&MedGen:C4049796&.SCV001248954&SCV001440692&SCV001478679&SCV001737090&SCV001772130&SCV001934208&SCV002028353&SCV002525703&SCV004176947&SCV006583190single_nucleotide_variantSO:0001483ClinGen:CA123334&OMIM:171834.0003&UniProtKB:P42336#VAR_026178PIK3CA:5290SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094533104886003Medulloblastoma_WNT_activated&Adenocarcinoma_of_the_large_intestine&Cervical_squamous_cell_carcinoma&IDH-wildtype_glioblastoma&Rosette-forming_glioneuronal_tumor&Embryonal_rhabdomyosarcoma&Congenital_fibrosarcoma&Lymphatic_malformation&Cerebral_cavernous_malformationMONDO:MONDO:0850196&MedGen:C4331965&Human_Phenotype_Ontology:HP:0040275&MONDO:MONDO:0005008&MedGen:C1319315&MONDO:MONDO:0006143&MedGen:C0279671&Orphanet:213767&MONDO:MONDO:0850335&MedGen:CN372125&Human_Phenotype_Ontology:HP:0025171&MONDO:MONDO:0016736&MedGen:C4331262&Orphanet:251975&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0004557&MedGen:C0334459&MONDO:MONDO:0019313&MedGen:C0398368&OMIM:PS153100&Human_Phenotype_Ontology:HP:0033522&MONDO:MONDO:0000820&MedGen:C2919945&OMIM:116860&Orphanet:221061SCV007104438&SCV007104441&SCV007104449&SCV007104453&SCV007104454&SCV007104475&SCV0071045143:179218303-1792183031PIK3CAp.E545KTrueThe PIK3CA E545K mutation is located in the helical domain in exon 10 of the protein. This mutation has been found in breast and colon cancer and glioblastoma (PMID: 17376864, 31996845). Expression of this mutation in chicken embryonic fibroblasts, Ba/F3 cells, MCF10A breast cells and in a transgenic mouse model demonstrated that it is activating as measured by increased kinase activity, downstream pathway activation, factor-independent proliferation, anchorage-independent colony formation, in vivo tumor growth in xenograft models, and in vivo glioblastoma formation compared to wildtype PIK3CA (PMID: 17376864, 26627007, 16432179, 16322248, 31996845). Mutations at this position are predicted to abrogate p85-mediated inhibition of catalytic activity, thus likely resulting in constitutive activation of PIK3CA enzymatic activity (PMID: 20593314). In a phase III trial for ER+, HER2 advanced breast cancer that had previously progressed on endocrine therapy, patients were given either palbociclib (CDK4/6 inhibitor) plus fulvestrant (ESR1 antagonist) or placebo plus fulvestrant. PIK3CA alterations, including the E545K mutation, were found at a significantly higher percentage in end-of-treatment samples as compared to pre-treatment samples in patients from both treatment arms, suggesting that PIK3CA alterations may play a role in resistance to fulvestrant (PMID: 30206110). Expression of this mutation in a patient-derived xenograft model of lung squamous cell carcinoma demonstrated that it was sensitive to the pan-PIK3CA inhibitor BKM120 and the PIK3CAalpha-specific inhibitor BYL719 compared to PDX models expressing wildtype PIK3CA (PMID: 30093452). Preclinical studies with mice expressing PIK3CA E545K demonstrated sensitivity to treatment with RLY-2608 as measured by reduced tumor volume following treatment (Abstract: Varkaris et al. Abstract# CT017, AACR 2023. https://www.abstractsonline.com/pp8/#!/10828/presentation/10256).PIK3CA, the catalytic subunit of PI3-kinase, is frequently mutated in a diverse range of cancers including breast, endometrial and cervical cancers.16322248|30206110|20593314|16432179|26627007|17376864|30093452|31996845E545K5290PIK3CAGRCh38.MUTATION.The PIK3CA E545K mutation is known to be oncogenic.FalseLEVEL_Fda2The PIK3CA E545K mutation is located in the helical domain in exon 10 of the protein. This mutation has been found in breast and colon cancer and glioblastoma (PMID: 17376864, 31996845). Expression of this mutation in chicken embryonic fibroblasts, Ba/F3 cells, MCF10A breast cells and in a transgenic mouse model demonstrated that it is activating as measured by increased kinase activity, downstream pathway activation, factor-independent proliferation, anchorage-independent colony formation, in vivo tumor growth in xenograft models, and in vivo glioblastoma formation compared to wildtype PIK3CA (PMID: 17376864, 26627007, 16432179, 16322248, 31996845). Mutations at this position are predicted to abrogate p85-mediated inhibition of catalytic activity, thus likely resulting in constitutive activation of PIK3CA enzymatic activity (PMID: 20593314). In a phase III trial for ER+, HER2 advanced breast cancer that had previously progressed on endocrine therapy, patients were given either palbociclib (CDK4/6 inhibitor) plus fulvestrant (ESR1 antagonist) or placebo plus fulvestrant. PIK3CA alterations, including the E545K mutation, were found at a significantly higher percentage in end-of-treatment samples as compared to pre-treatment samples in patients from both treatment arms, suggesting that PIK3CA alterations may play a role in resistance to fulvestrant (PMID: 30206110). Expression of this mutation in a patient-derived xenograft model of lung squamous cell carcinoma demonstrated that it was sensitive to the pan-PIK3CA inhibitor BKM120 and the PIK3CAalpha-specific inhibitor BYL719 compared to PDX models expressing wildtype PIK3CA (PMID: 30093452). Preclinical studies with mice expressing PIK3CA E545K demonstrated sensitivity to treatment with RLY-2608 as measured by reduced tumor volume following treatment (Abstract: Varkaris et al. Abstract# CT017, AACR 2023. https://www.abstractsonline.com/pp8/#!/10828/presentation/10256).['16322248', '30206110', '20593314', '16432179', '26627007', '17376864', '30093452', '31996845'][{'abstract': 'Varkaris et al. Abstract# CT017, AACR 2023.', 'link': 'https://www.abstractsonline.com/pp8/#!/10828/presentation/10256'}]Alpelisib + FulvestrantLEVEL_1LEVEL_Fda2['25877889', '31091374', '30543347']Alpelisib is a selective inhibitor of the alpha form of PI3K (PI3K) that is FDA-approved in combination with the selective estrogen receptor (ER) degrader fulvestrant for the treatment of postmenopausal patients with ER+ HER2- PIK3CA-mutated, advanced or metastatic breast cancer. FDA approval is based on data from the Phase III randomized, double-blind, placebo-controlled SOLAR-1 trial of alpelisib plus fulvestrant versus placebo plus fulvestrant in 572 patients with breast cancer in which the progression-free survival in patients with PIK3CA mutation (n=341) was eleven months (95% CI= 7.5-14.5) with alpelisib plus fulvestrant versus 5.7 months (95% CI= 3.7-7.4) with placebo plus fulvestrant (HR= 0.65, 95% CI= 0.5-0.85, p= 0.0013) compared to PIK3CA-wildtype patients in which the hazard ratio was 0.85 (95% CI= 0.58-1.25) (PMID: 31091374). Overall response in the PIK3CA-mutant population was 35.7 months (95% CI= 27.4-44.7, n=126) with alpelisib plus fulvestrant versus 16.2 months (95% CI= 10.4-23.5, n=136) with placebo plus fulvestrant (PMID: 31091374). Previous studies, including in vivo xenograft studies and a phase I trial, also demonstrated that treatment of ER+ PIK3CA-mutant breast cancer with the combination of fulvestrant and alpelisib results in greater tumor shrinkage than either drug alone, with fulvestrant inhibiting the induction of ER-dependent gene transcription resulting from PI3K inhibition with alpelisib (PMID: 25877889, 30543347).Breast CancerSOLIDBreastCapivasertib + FulvestrantLEVEL_1LEVEL_Fda2['37256976']Capivasertib is an orally available, ATP-competitive pan-AKT small molecule inhibitor that is FDA-approved with fulvestrant for adult patients with ER+/HER2- locally advanced or metastatic breast cancer with one or more PIK3CA/AKT1/PTEN-alterations, as detected by an FDA-approved test, following progression on at least one endocrine-based regimen in the metastatic setting or recurrence on or within twelve months of completing adjuvant therapy. Eligible PIK3CA/AKT1/PTEN-alterations (PIK3CA R88Q, N345K, C420R, E542K, E545A, E545D, E545Q, E545K, E545G, Q546E, Q546K, Q546R, Q546P, M1043V, M1043I, H1047Y, H1047R, H1047L and G1049R, AKT1 E17K, all PTEN oncogenic mutations) for treatment with capivasertib plus fulvestrant were detected by the FoundationOne CDx assay. FDA approval was based on the results from the Phase III CAPItello-291 (NCT04305496) trial of capivasertib plus fulvestrant versus placebo plus fulvestrant in 708 adult patients with ER+/HER2- locally advanced or metastatic breast cancer (n=289, patients with eligible PIK3CA/AKT1/PTEN alterations). In the Phase III CAPItello-291 (NCT04305496) trial, the capivasertib plus fulvestrant cohort with PIK3CA/AKT1/PTEN-altered tumors (n=155) demonstrated an objective response rate (ORR) of 26% (95% CI=19-34), with a 2.3% complete response (CR) rate, 23% partial response (PR) rate, and a median progression-free survival (PFS) of 7.3 months (95% CI=5.5-9.0)(PMID: 37256976). The placebo plus fulvestrant cohort with PIK3CA/AKT1/PTEN-altered tumors (n=134) demonstrated an ORR of 8% (95% CI=4-14), with an 8% PR rate and a median PFS of 3.1 months (95% CI=2.0-3.7) (HR=0.50 [95% CI=0.38-0.65], p<0.0001) (PMID: 37256976).Breast CancerSOLIDBreastInavolisib + Palbociclib + FulvestrantLEVEL_1LEVEL_Fda2['39476340']Inavolisib is an orally available, small molecule PI3K inhibitor that is FDA-approved in combination with palbociclib and fulvestrant for the treatment of adults with endocrine-resistant, PIK3CA-mutated, HR-positive, HER2-negative, locally advanced or metastatic breast cancer, as detected by an FDA-approved test following recurrence on or after completing adjuvant endocrine therapy. PIK3CA oncogenic mutations for treatment with inavolisib plus palbociclib and fulvestrant were detected by the FoundationOne Liquid CDx. FDA approval was based on the results of the Phase III INAVO120 (NCT04191499) trial of inavolisib plus palbociclib and fulvestrant versus palbociclib plus fulvestrant in 325 patients with PIK3CA-mutated, HR+/HER2- breast cancer. In the Phase III INAVO120 (NCT04191499) trial, the inavolisib cohort (n=161) demonstrated an overall response rate (ORR) of 58.4%, with seven complete responses (CR) and 87 partial responses (PR), a median progression-free survival (PFS) of 15.0 months (95% CI=11.3-20.5), median overall survival (OS) was not evaluable (95% CI=0.43-0.97) and a median duration of response (DOR) of 18.4 months (95% CI=10.4-22.2) (PMID: 39476340). In contrast, the palbociclib plus fulvestrant only cohort (n=164) demonstrated an ORR of 25.0%, with one CR and 40 PRs, a median PFS of 7.3 months (95% CI=5.6-9.3) (HR=0.43 [95% CI=0.32-0.59], p<0.0001), a median OS of 31.1 months (95% CI=22.3-NE) (HR=0.64 [95% CI=0.43-0.97], p=0.0338) and a median DOR of 9.6 months (95% CI=7.4-16.6) (PMID: 39476340).Breast CancerSOLIDBreastRLY-2608LEVEL_4LEVEL_Fda3['37916956']RLY-2608 is an orally available, small-molecule, allosteric PI3K inhibitor. There are promising laboratory and anecdotal clinical data to support use of RLY-2608 in patients with PIK3CA-mutated solid tumors. In the Phase I ReDiscover (NCT05216432) trial of RLY-2608, one patient with HER2-low breast cancer harboring PIK3CA H1047R and E453K was treated with RLY-2608 and one patient with HER2-negative breast cancer harboring PIK3CA E542K was treated with RLY-2608 plus fulvestrant and both patients demonstrated partial responses (PMID: 37916956). Biochemical assays have demonstrated that RLY-2608 inhibits PI3K activity in kinase and helical domain mutants with high isoform selectivity (Abstract: Pazolli et al. Abstract# P251, TARG 2021. https://aacrjournals.org/mct/article/20/12_Supplement/P251/676005/Abstract-P251-Discovery-and-characterization-of). In vivo xenograft models harboring PIK3CA E545K and H1047R mutations demonstrated sensitivity to RLY-2608 as measured by dose-dependent tumor regression and anti-tumor activity (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vitro studies with MCF10A cells expressing PIK3CA E545K or H1047R demonstrate sensitivity to RLY-2608 as measured by inhibition of cellular signaling and proliferation (PMID: 37916956).All Solid TumorsSOLIDRLY-2608 + FulvestrantLEVEL_4LEVEL_Fda3['37916956']RLY-2608 is an orally available, small-molecule, allosteric PI3K inhibitor, and fulvestrant is an FDA-approved estrogen receptor antagonist indicated for the treatment of patients with hormone receptor (HR)-positive, HER2-negative metastatic breast cancer. There are promising laboratory and anecdotal clinical data to support use of RLY-2608 plus fulvestrant in patients with PIK3CA-mutated breast cancer. In the Phase I ReDiscover (NCT05216432) trial of RLY-2608, one patient with HER2-low breast cancer harboring PIK3CA H1047R and E453K was treated with RLY-2608 and one patient with HER2-negative breast cancer harboring PIK3CA E542K was treated with RLY-2608 plus fulvestrant and both patients demonstrated partial responses (PMID: 37916956). In vitro studies with HR+ PI3K mutant cell lines demonstrated synergistic sensitivity to treatment with RLY-2608 in combination with fulvestrant (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vivo cell-derived xenograft models harboring the PIK3CA E545K mutation demonstrated sensitivity to RLY-2608 + fulvestrant treatment as measured by dose-dependent tumor regression (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vitro studies with MCF10A cells expressing PIK3CA E545K or H1047R demonstrate sensitivity to RLY-2608 as measured by inhibition of cellular signaling and proliferation (PMID: 37916956).Breast CancerSOLIDBreast16322248;30206110;20593314;16432179;26627007;17376864;30093452;31996845;Varkaris et al. Abstract# CT017, AACR 2023.(https://www.abstractsonline.com/pp8/#!/10828/presentation/10256)RLY-2608,RLY-2608+Fulvestrant25877889;31091374;30543347;37256976;39476340;37916956;Pazolli et al. Abstract# P5-16-10, SABCS 2021.(https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459);Pazolli et al. Abstract# P251, TARG 2021.(https://aacrjournals.org/mct/article/20/12_Supplement/P251/676005/Abstract-P251-Discovery-and-characterization-of)90Amissense_variantPIK3CA5290GeneENST00000263967.3ENST00000263967.3:c.1633G>ANP_006209.2:p.Glu545Lys104GLU545LYS/RS104886003https://civicdb.org/links/variants/104PIK3CA_E545K104NM_006218.3:c.1633G>A/NP_006209.2:p.Glu545Lys/ENST00000263967.3:c.1633G>A/NC_000003.11:g.178936091G>ACA12333413655
TUMORp.H1047RENSP00000263967.3:p.His1047Argchr3179234297AGPASSNM_006218missense_variantMODERATEPIK3CA21/21c.3140A>Grs121913279&CM153086&COSV55873195&COSV55873401&COSV55888015SNVdeleterious(0)benign(0.088)0.000.000.000.000.4552.2100e-01Rare_venous_malformation&Rare_combined_vascular_malformation&Klippel-Trenaunay-like-Syndrome&CEREBRAL_CAVERNOUS_MALFORMATIONS_4&_SOMATIC&Cerebrofacial_Vascular_Metameric_Syndrome_(CVMS)&Overgrowth_syndrome_and/or_cerebral_malformations_due_to_abnormalities_in_MTOR_pathway_genes&Rosette-forming_glioneuronal_tumor&PIK3CA-Related_Overgrowth_Spectrum_Disorders&PIK3CA-related_disorder&MACRODACTYLY&_SOMATIC&Congenital_macrodactylia&CLAPO_syndrome&Lip_and_oral_cavity_carcinoma&Gastric_cancer&PIK3CA_related_overgrowth_syndrome&Megalencephaly-capillary_malformation-polymicrogyria_syndrome&not_provided&CLOVES_syndrome&Ovarian_neoplasm&Hepatocellular_carcinoma&Seborrheic_keratosis&OVARIAN_CANCER&_EPITHELIAL&_SOMATIC&Non-small_cell_lung_carcinoma&Carcinoma_of_colon&Breast_adenocarcinoma&Abnormal_cardiovascular_system_morphology&Breast_carcinoma&Segmental_undergrowth_associated_with_mainly_venous_malformation_with_capillary_component&Segmental_undergrowth_associated_with_lymphatic_malformationNC_000003.12:g.179234297A>Greviewed_by_expert_panelPathogenicOncogeniccriteria_provided&_single_submitter39criteria_provided&_single_submitterTier_I_-_StrongPIK3CAH1047Rrs121913279✓ Hotspotv7.0.LEVEL_Fda2✓ Hotspot10/16/2024LEVEL_1TrueTrueTrueGain-of-functionOncogenicAlpelisib+Fulvestrant,Capivasertib+Fulvestrant,Inavolisib+Palbociclib+FulvestrantLEVEL_1LEVEL_155,400/1H1047R0.42105263157894735GRCh38PIK3CAAAG179234297PIK3CA_H1047R.GT:AD:AF:DP0/1:55,40:0.42:95GENSG00000121879TranscriptENST00000263967protein_coding346331401047H/RcAt/cGt1HGNCHGNC:8975YESMANE_SelectNM_006218.42P1CCDS43171.1ENSP00000263967P42336.236UPI000013D494Ensembl1Gene3D:1.10.1070.11&PDB-ENSP_mappings:2rd0.A&PDB-ENSP_mappings:3hhm.A&PDB-ENSP_mappings:3hiz.A&PDB-ENSP_mappings:4jps.A&PDB-ENSP_mappings:4l1b.A&PDB-ENSP_mappings:4l23.A&PDB-ENSP_mappings:4l2y.A&PDB-ENSP_mappings:4ovu.A&PDB-ENSP_mappings:4ovv.A&PDB-ENSP_mappings:4tuu.A&PDB-ENSP_mappings:4tv3.A&PDB-ENSP_mappings:4waf.A&PDB-ENSP_mappings:4ykn.A&PDB-ENSP_mappings:4zop.A&PDB-ENSP_mappings:5dxh.A&PDB-ENSP_mappings:5dxh.D&PDB-ENSP_mappings:5dxt.A&PDB-ENSP_mappings:5fi4.A&PDB-ENSP_mappings:5itd.A&PDB-ENSP_mappings:5sw8.A&PDB-ENSP_mappings:5swg.A&PDB-ENSP_mappings:5swo.A&PDB-ENSP_mappings:5swp.A&PDB-ENSP_mappings:5swr.A&PDB-ENSP_mappings:5swt.A&PDB-ENSP_mappings:5sx8.A&PDB-ENSP_mappings:5sx9.A&PDB-ENSP_mappings:5sxa.A&PDB-ENSP_mappings:5sxb.A&PDB-ENSP_mappings:5sxc.A&PDB-ENSP_mappings:5sxd.A&PDB-ENSP_mappings:5sxe.A&PDB-ENSP_mappings:5sxf.A&PDB-ENSP_mappings:5sxi.A&PDB-ENSP_mappings:5sxj.A&PDB-ENSP_mappings:5sxk.A&PDB-ENSP_mappings:5ubr.A&PDB-ENSP_mappings:5uk8.A&PDB-ENSP_mappings:5ukj.A&PDB-ENSP_mappings:5ul1.A&PDB-ENSP_mappings:5xgh.A&PDB-ENSP_mappings:5xgi.A&PDB-ENSP_mappings:5xgj.A&PDB-ENSP_mappings:6gvf.A&PDB-ENSP_mappings:6gvg.A&PDB-ENSP_mappings:6gvh.A&PDB-ENSP_mappings:6gvi.A&PDB-ENSP_mappings:6nct.A&PDB-ENSP_mappings:6oac.A&PDB-ENSP_mappings:6pys.A&PDB-ENSP_mappings:7jiu.A&PDB-ENSP_mappings:7k6m.A&PDB-ENSP_mappings:7k6n.A&PDB-ENSP_mappings:7k6o.A&PDB-ENSP_mappings:7k71.A&PDB-ENSP_mappings:7l1b.C&PDB-ENSP_mappings:7l1c.C&PDB-ENSP_mappings:7l1d.C&PDB-ENSP_mappings:7mlk.A&PDB-ENSP_mappings:7myn.A&PDB-ENSP_mappings:7myo.A&PDB-ENSP_mappings:7pg5.A&PDB-ENSP_mappings:7pg6.A&PDB-ENSP_mappings:7r9v.A&PDB-ENSP_mappings:7r9y.A&PDB-ENSP_mappings:7rrg.C&PDB-ENSP_mappings:7tz7.A&PDB-ENSP_mappings:8am0.A&PDB-ENSP_mappings:8bfu.A&PDB-ENSP_mappings:8dcp.A&PDB-ENSP_mappings:8dcx.A&PDB-ENSP_mappings:8dd4.A&PDB-ENSP_mappings:8dd8.A&PDB-ENSP_mappings:8exl.A&PDB-ENSP_mappings:8exo.A&PDB-ENSP_mappings:8exu.A&PDB-ENSP_mappings:8exv.A&PDB-ENSP_mappings:8gua.A&PDB-ENSP_mappings:8gub.A&PDB-ENSP_mappings:8gud.A&PDB-ENSP_mappings:8ilr.A&PDB-ENSP_mappings:8ils.A&PDB-ENSP_mappings:8ilv.A&PDB-ENSP_mappings:8ow2.A&PDB-ENSP_mappings:8sbc.A&PDB-ENSP_mappings:8sbj.A&PDB-ENSP_mappings:8tdu.A&PDB-ENSP_mappings:8tdu.C&PDB-ENSP_mappings:8tgd.A&PDB-ENSP_mappings:8tgd.C&PDB-ENSP_mappings:8ts7.A&PDB-ENSP_mappings:8ts8.A&PDB-ENSP_mappings:8ts9.A&PDB-ENSP_mappings:8tsa.A&PDB-ENSP_mappings:8tsb.A&PDB-ENSP_mappings:8tsc.A&PDB-ENSP_mappings:8tsd.A&PDB-ENSP_mappings:8tu6.A&PDB-ENSP_mappings:8twy.A&PDB-ENSP_mappings:8v8h.A&PDB-ENSP_mappings:8v8h.C&PDB-ENSP_mappings:8v8i.A&PDB-ENSP_mappings:8v8i.C&PDB-ENSP_mappings:8v8j.A&PDB-ENSP_mappings:8v8j.C&PDB-ENSP_mappings:8v8u.A&PDB-ENSP_mappings:8v8u.C&PDB-ENSP_mappings:8v8v.A&PDB-ENSP_mappings:8v8v.C&PDB-ENSP_mappings:8w9a.A&PDB-ENSP_mappings:8w9b.A&AFDB-ENSP_mappings:AF-P42336-F1&PROSITE_profiles:PS50290&PANTHER:PTHR10048&SMART:SM00146&Superfamily:SSF56112&CDD:cd05175pathogenic/likely_pathogenic&pathogenic&likely_pathogenic0&1&1&1&11&1&1&1&125710561&26900293&20619739&25157968&26619011&35127508&26822237&30867801&15016963&15254419&15520168&15608678&15647370&15805248&16906227&17673550&18676830&18725974&19029981&19223544&19366826&19513541&19903786&20453058&21430269&22162582&22162589&22271473&23946963&22658544&21558396&22729222&26266975&26266985&27626068&34203389&33076847&25599672&31949278&33917394&34804623&33105631&33335011&28347348&36010895&28708103&35117297&35768433&31371346&28163917&34791601&33106175&34667073&36765720&28611940&29446767&34496175&23100325&37435187FAIL02-55PIK3CA1365228691MedGen:C0265950&Orphanet:211252&MedGen:C5681115&Orphanet:458837&.&.&.&MONDO:MONDO:0100283&MedGen:CN300503&Human_Phenotype_Ontology:HP:0025171&MONDO:MONDO:0016736&MedGen:C4331262&Orphanet:251975&.&.&.&Human_Phenotype_Ontology:HP:0004099&MONDO:MONDO:0007962&MedGen:C0265552&OMIM:155500&MONDO:MONDO:0013125&MedGen:C2751313&OMIM:613089&Orphanet:168984&MONDO:MONDO:0023644&MedGen:C0220641&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&MONDO:MONDO:1040002&MedGen:C4728213&Orphanet:530313&MONDO:MONDO:0011240&MedGen:C1865285&OMIM:602501&Orphanet:60040&MedGen:C3661900&MONDO:MONDO:0013038&MedGen:C2752042&OMIM:612918&Orphanet:140944&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&Human_Phenotype_Ontology:HP:0001402&Human_Phenotype_Ontology:HP:0002899&Human_Phenotype_Ontology:HP:0003007&Human_Phenotype_Ontology:HP:0006750&MONDO:MONDO:0007256&MedGen:C2239176&OMIM:114550&Orphanet:88673&Human_Phenotype_Ontology:HP:0031287&MONDO:MONDO:0008420&MedGen:C0022603&OMIM:182000&MedGen:C1868358&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&MONDO:MONDO:0002032&MedGen:C0699790&MONDO:MONDO:0004988&MedGen:C0858252&Human_Phenotype_Ontology:HP:0001632&Human_Phenotype_Ontology:HP:0002564&Human_Phenotype_Ontology:HP:0002565&Human_Phenotype_Ontology:HP:0030680&MedGen:C4049796&Human_Phenotype_Ontology:HP:0003002&MONDO:MONDO:0004989&MedGen:C0678222&.&.SCV001949970single_nucleotide_variantSO:0001483ClinGen:CA123326&OMIM:171834.0001&UniProtKB:P42336#VAR_026192PIK3CA:5290SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094537121913279Cervical_squamous_cell_carcinoma&Diffuse_midline_glioma&_H3_K27M-mutant&Diffuse_glioma&_H3_G34_mutant&Cavernous_lymphangioma&Diffuse_pediatric-type_high-grade_glioma&_H3-wildtype_and_IDH-wildtype&Rosette-forming_glioneuronal_tumor&Embryonal_rhabdomyosarcoma&Adenoid_cystic_carcinoma&Colorectal_cancer&Glioma&Nasopharyngeal_carcinoma&NeuroblastomaMONDO:MONDO:0006143&MedGen:C0279671&Orphanet:213767&MONDO:MONDO:0957196&MedGen:C4289688&MONDO:MONDO:0957197&MedGen:CN377580&MONDO:MONDO:0019328&MedGen:C0205828&Orphanet:79489&MONDO:MONDO:0858939&MedGen:C5669918&Human_Phenotype_Ontology:HP:0025171&MONDO:MONDO:0016736&MedGen:C4331262&Orphanet:251975&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0004971&MeSH:D003528&MedGen:C0010606&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500&Human_Phenotype_Ontology:HP:0009733&MONDO:MONDO:0021042&MeSH:D005910&MedGen:C0017638&Orphanet:182067&MONDO:MONDO:0015459&MedGen:C2931822&OMIM:607107&Orphanet:150&Human_Phenotype_Ontology:HP:0003006&Human_Phenotype_Ontology:HP:0006738&MONDO:MONDO:0005072&MeSH:D009447&MedGen:C0027819&Orphanet:635SCV007104431&SCV007104433&SCV007104434&SCV007104444&SCV007104452&SCV007104470&SCV007104495&SCV007104500&SCV0071045103:179234297-179234297PIK3CAp.H1047RTrueThe PIK3CA H1047R mutation is located in the kinase domain in exon 21 of the protein (PMID: 16341083,17376864, 22120714). This mutation has been found in various cancers, including breast, head and neck, lung, colorectal and endometrial cancers (PMID: 27126994, 25631445, 23787421, 25079552, 22960745, 22941189, 17376864, 23636398). Expression of this mutation in chicken embryonic fibroblasts, Ba/F3 cells and MCF10A breast cells and in a transgenic mouse model demonstrated that it is activating as measured by increased kinase activity, downstream pathway activation, cytokine- and factor-independent proliferation, colony growth in soft agar, invasion and in vivo glioblastoma tumor burden compared to wildtype PIK3CA (PMID: 17376864, 26627007, 16432179, 16322248, 31996845). Genetically engineered mouse models have shown that the PIK3CA H1047R mutation promotes tumor formation in breast, colon, ovarian and lung cancer and malignant mesothelioma (PMID: 22370636, 23940356, 22214849, 21822287, 21324922, 19029981, 31911549). Mutations at this position are predicted to constitutively activate the catalytic subunit of PI3K (p110) by exposing the catalytic loop towards the plasma membrane where its substrate, PIP2, is found (PMID: 17376864, 20593314). Patients with breast cancer harboring this mutation achieved partial response (n=2) or stable disease (n=1) following treatment with the PI3K inhibitor, alpelisib (PMID: 27126994). In a phase III trial of palbociclib/fulvestrant for ER+, HER2 advanced breast cancer that had previously progressed on endocrine therapy, patients with PIK3CA alterations, including the H1047R mutation, were found at a significantly higher percentage in end-of-treatment samples as compared to pre-treatment samples, suggesting that this mutation may play a role in resistance to fulvestrant (PMID: 30206110). Preclinical studies with mice expressing PIK3CA H1047R demonstrated sensitivity to treatment with RLY-2608 as measured by reduced tumor volume following treatment (Abstract: Varkaris et al. Abstract# CT017, AACR 2023. https://www.abstractsonline.com/pp8/#!/10828/presentation/10256).PIK3CA, the catalytic subunit of PI3-kinase, is frequently mutated in a diverse range of cancers including breast, endometrial and cervical cancers.16322248|30206110|19029981|22960745|31911549|16341083|22214849|16432179|26627007|21822287|27126994|25079552|22120714|21324922|31996845|23940356|25631445|20593314|22941189|22370636|23787421|23636398|17376864H1047R5290PIK3CAGRCh38.MUTATION.The PIK3CA H1047R mutation is known to be oncogenic.FalseLEVEL_Fda2The PIK3CA H1047R mutation is located in the kinase domain in exon 21 of the protein (PMID: 16341083,17376864, 22120714). This mutation has been found in various cancers, including breast, head and neck, lung, colorectal and endometrial cancers (PMID: 27126994, 25631445, 23787421, 25079552, 22960745, 22941189, 17376864, 23636398). Expression of this mutation in chicken embryonic fibroblasts, Ba/F3 cells and MCF10A breast cells and in a transgenic mouse model demonstrated that it is activating as measured by increased kinase activity, downstream pathway activation, cytokine- and factor-independent proliferation, colony growth in soft agar, invasion and in vivo glioblastoma tumor burden compared to wildtype PIK3CA (PMID: 17376864, 26627007, 16432179, 16322248, 31996845). Genetically engineered mouse models have shown that the PIK3CA H1047R mutation promotes tumor formation in breast, colon, ovarian and lung cancer and malignant mesothelioma (PMID: 22370636, 23940356, 22214849, 21822287, 21324922, 19029981, 31911549). Mutations at this position are predicted to constitutively activate the catalytic subunit of PI3K (p110) by exposing the catalytic loop towards the plasma membrane where its substrate, PIP2, is found (PMID: 17376864, 20593314). Patients with breast cancer harboring this mutation achieved partial response (n=2) or stable disease (n=1) following treatment with the PI3K inhibitor, alpelisib (PMID: 27126994). In a phase III trial of palbociclib/fulvestrant for ER+, HER2 advanced breast cancer that had previously progressed on endocrine therapy, patients with PIK3CA alterations, including the H1047R mutation, were found at a significantly higher percentage in end-of-treatment samples as compared to pre-treatment samples, suggesting that this mutation may play a role in resistance to fulvestrant (PMID: 30206110). Preclinical studies with mice expressing PIK3CA H1047R demonstrated sensitivity to treatment with RLY-2608 as measured by reduced tumor volume following treatment (Abstract: Varkaris et al. Abstract# CT017, AACR 2023. https://www.abstractsonline.com/pp8/#!/10828/presentation/10256).['16322248', '30206110', '19029981', '22960745', '31911549', '16341083', '22214849', '16432179', '26627007', '21822287', '27126994', '25079552', '22120714', '21324922', '31996845', '23940356', '25631445', '20593314', '22941189', '22370636', '23787421', '23636398', '17376864'][{'abstract': 'Varkaris et al. Abstract# CT017, AACR 2023.', 'link': 'https://www.abstractsonline.com/pp8/#!/10828/presentation/10256'}]Alpelisib + FulvestrantLEVEL_1LEVEL_Fda2['25877889', '31091374', '30543347']Alpelisib is a selective inhibitor of the alpha form of PI3K (PI3K) that is FDA-approved in combination with the selective estrogen receptor (ER) degrader fulvestrant for the treatment of postmenopausal patients with ER+ HER2- PIK3CA-mutated, advanced or metastatic breast cancer. FDA approval is based on data from the Phase III randomized, double-blind, placebo-controlled SOLAR-1 trial of alpelisib plus fulvestrant versus placebo plus fulvestrant in 572 patients with breast cancer in which the progression-free survival in patients with PIK3CA mutation (n=341) was eleven months (95% CI= 7.5-14.5) with alpelisib plus fulvestrant versus 5.7 months (95% CI= 3.7-7.4) with placebo plus fulvestrant (HR= 0.65, 95% CI= 0.5-0.85, p= 0.0013) compared to PIK3CA-wildtype patients in which the hazard ratio was 0.85 (95% CI= 0.58-1.25) (PMID: 31091374). Overall response in the PIK3CA-mutant population was 35.7 months (95% CI= 27.4-44.7, n=126) with alpelisib plus fulvestrant versus 16.2 months (95% CI= 10.4-23.5, n=136) with placebo plus fulvestrant (PMID: 31091374). Previous studies, including in vivo xenograft studies and a phase I trial, also demonstrated that treatment of ER+ PIK3CA-mutant breast cancer with the combination of fulvestrant and alpelisib results in greater tumor shrinkage than either drug alone, with fulvestrant inhibiting the induction of ER-dependent gene transcription resulting from PI3K inhibition with alpelisib (PMID: 25877889, 30543347).Breast CancerSOLIDBreastCapivasertib + FulvestrantLEVEL_1LEVEL_Fda2['37256976']Capivasertib is an orally available, ATP-competitive pan-AKT small molecule inhibitor that is FDA-approved with fulvestrant for adult patients with ER+/HER2- locally advanced or metastatic breast cancer with one or more PIK3CA/AKT1/PTEN-alterations, as detected by an FDA-approved test, following progression on at least one endocrine-based regimen in the metastatic setting or recurrence on or within twelve months of completing adjuvant therapy. Eligible PIK3CA/AKT1/PTEN-alterations (PIK3CA R88Q, N345K, C420R, E542K, E545A, E545D, E545Q, E545K, E545G, Q546E, Q546K, Q546R, Q546P, M1043V, M1043I, H1047Y, H1047R, H1047L and G1049R, AKT1 E17K, all PTEN oncogenic mutations) for treatment with capivasertib plus fulvestrant were detected by the FoundationOne CDx assay. FDA approval was based on the results from the Phase III CAPItello-291 (NCT04305496) trial of capivasertib plus fulvestrant versus placebo plus fulvestrant in 708 adult patients with ER+/HER2- locally advanced or metastatic breast cancer (n=289, patients with eligible PIK3CA/AKT1/PTEN alterations). In the Phase III CAPItello-291 (NCT04305496) trial, the capivasertib plus fulvestrant cohort with PIK3CA/AKT1/PTEN-altered tumors (n=155) demonstrated an objective response rate (ORR) of 26% (95% CI=19-34), with a 2.3% complete response (CR) rate, 23% partial response (PR) rate, and a median progression-free survival (PFS) of 7.3 months (95% CI=5.5-9.0)(PMID: 37256976). The placebo plus fulvestrant cohort with PIK3CA/AKT1/PTEN-altered tumors (n=134) demonstrated an ORR of 8% (95% CI=4-14), with an 8% PR rate and a median PFS of 3.1 months (95% CI=2.0-3.7) (HR=0.50 [95% CI=0.38-0.65], p<0.0001) (PMID: 37256976).Breast CancerSOLIDBreastInavolisib + Palbociclib + FulvestrantLEVEL_1LEVEL_Fda2['39476340']Inavolisib is an orally available, small molecule PI3K inhibitor that is FDA-approved in combination with palbociclib and fulvestrant for the treatment of adults with endocrine-resistant, PIK3CA-mutated, HR-positive, HER2-negative, locally advanced or metastatic breast cancer, as detected by an FDA-approved test following recurrence on or after completing adjuvant endocrine therapy. PIK3CA oncogenic mutations for treatment with inavolisib plus palbociclib and fulvestrant were detected by the FoundationOne Liquid CDx. FDA approval was based on the results of the Phase III INAVO120 (NCT04191499) trial of inavolisib plus palbociclib and fulvestrant versus palbociclib plus fulvestrant in 325 patients with PIK3CA-mutated, HR+/HER2- breast cancer. In the Phase III INAVO120 (NCT04191499) trial, the inavolisib cohort (n=161) demonstrated an overall response rate (ORR) of 58.4%, with seven complete responses (CR) and 87 partial responses (PR), a median progression-free survival (PFS) of 15.0 months (95% CI=11.3-20.5), median overall survival (OS) was not evaluable (95% CI=0.43-0.97) and a median duration of response (DOR) of 18.4 months (95% CI=10.4-22.2) (PMID: 39476340). In contrast, the palbociclib plus fulvestrant only cohort (n=164) demonstrated an ORR of 25.0%, with one CR and 40 PRs, a median PFS of 7.3 months (95% CI=5.6-9.3) (HR=0.43 [95% CI=0.32-0.59], p<0.0001), a median OS of 31.1 months (95% CI=22.3-NE) (HR=0.64 [95% CI=0.43-0.97], p=0.0338) and a median DOR of 9.6 months (95% CI=7.4-16.6) (PMID: 39476340).Breast CancerSOLIDBreastRLY-2608LEVEL_4LEVEL_Fda3['37916956']RLY-2608 is an orally available, small-molecule, allosteric PI3K inhibitor. There are promising laboratory and anecdotal clinical data to support use of RLY-2608 in patients with PIK3CA-mutated solid tumors. In the Phase I ReDiscover (NCT05216432) trial of RLY-2608, one patient with HER2-low breast cancer harboring PIK3CA H1047R and E453K was treated with RLY-2608 and one patient with HER2-negative breast cancer harboring PIK3CA E542K was treated with RLY-2608 plus fulvestrant and both patients demonstrated partial responses (PMID: 37916956). Biochemical assays have demonstrated that RLY-2608 inhibits PI3K activity in kinase and helical domain mutants with high isoform selectivity (Abstract: Pazolli et al. Abstract# P251, TARG 2021. https://aacrjournals.org/mct/article/20/12_Supplement/P251/676005/Abstract-P251-Discovery-and-characterization-of). In vivo xenograft models harboring PIK3CA E545K and H1047R mutations demonstrated sensitivity to RLY-2608 as measured by dose-dependent tumor regression and anti-tumor activity (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vitro studies with MCF10A cells expressing PIK3CA E545K or H1047R demonstrate sensitivity to RLY-2608 as measured by inhibition of cellular signaling and proliferation (PMID: 37916956).All Solid TumorsSOLIDRLY-2608 + FulvestrantLEVEL_4LEVEL_Fda3['37916956']RLY-2608 is an orally available, small-molecule, allosteric PI3K inhibitor, and fulvestrant is an FDA-approved estrogen receptor antagonist indicated for the treatment of patients with hormone receptor (HR)-positive, HER2-negative metastatic breast cancer. There are promising laboratory and anecdotal clinical data to support use of RLY-2608 plus fulvestrant in patients with PIK3CA-mutated breast cancer. In the Phase I ReDiscover (NCT05216432) trial of RLY-2608, one patient with HER2-low breast cancer harboring PIK3CA H1047R and E453K was treated with RLY-2608 and one patient with HER2-negative breast cancer harboring PIK3CA E542K was treated with RLY-2608 plus fulvestrant and both patients demonstrated partial responses (PMID: 37916956). In vitro studies with HR+ PI3K mutant cell lines demonstrated synergistic sensitivity to treatment with RLY-2608 in combination with fulvestrant (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vivo cell-derived xenograft models harboring the PIK3CA E545K mutation demonstrated sensitivity to RLY-2608 + fulvestrant treatment as measured by dose-dependent tumor regression (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vitro studies with MCF10A cells expressing PIK3CA E545K or H1047R demonstrate sensitivity to RLY-2608 as measured by inhibition of cellular signaling and proliferation (PMID: 37916956).Breast CancerSOLIDBreast16322248;30206110;19029981;22960745;31911549;16341083;22214849;16432179;26627007;21822287;27126994;25079552;22120714;21324922;31996845;23940356;25631445;20593314;22941189;22370636;23787421;23636398;17376864;Varkaris et al. Abstract# CT017, AACR 2023.(https://www.abstractsonline.com/pp8/#!/10828/presentation/10256)RLY-2608,RLY-2608+Fulvestrant25877889;31091374;30543347;37256976;39476340;37916956;Pazolli et al. Abstract# P5-16-10, SABCS 2021.(https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459);Pazolli et al. Abstract# P251, TARG 2021.(https://aacrjournals.org/mct/article/20/12_Supplement/P251/676005/Abstract-P251-Discovery-and-characterization-of)95Gmissense_variantPIK3CA5290GeneENST00000263967.3ENST00000263967.3:c.3140A>GNP_006209.2:p.His1047Arg107HIS1047ARG/RS121913279https://civicdb.org/links/variants/107PIK3CA_H1047R107NM_006218.3:c.3140A>G/NP_006209.2:p.His1047Arg/ENST00000263967.3:c.3140A>G/NC_000003.11:g.178952085A>GCA12332613652
TUMORp.Glu746_Ala750delENSP00000275493.2:p.Glu746_Ala750delchr755174772GAATTAAGAGAAGCATGPASSNM_005228inframe_deletionMODERATEEGFR19/28c.2236_2250delCOSV51765066&COSV51849442deletion4.7500e-01v7.0.LEVEL_Fda2✓ Hotspot07/07/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAfatinib,Amivantamab+Chemotherapy,Amivantamab+Lazertinib,Dacomitinib,Datopotamab Deruxtecan,Erlotinib,Gefitinib,Osimertinib,Osimertinib+Chemotherapy,Erlotinib+RamucirumabPatritumab DeruxtecanLEVEL_1LEVEL_158,370/10.3894736842105263GRCh38EGFRGAATTAAGAGAAGCATGAATTAAGAGAAGCATG55174772EGFR_del19.GT:AD:AF:DP0/1:58,37:0.39:95-ENSG00000146648TranscriptENST00000275493protein_coding2497-25112236-2250746-750ELREA/-GAATTAAGAGAAGCA/-1HGNCHGNC:3236YESMANE_SelectNM_005228.51P1CCDS5514.1ENSP00000275493P00533.293UPI000003E750P00533-1Ensembl1PDB-ENSP_mappings:1m14.A&PDB-ENSP_mappings:1m17.A&PDB-ENSP_mappings:1xkk.A&PDB-ENSP_mappings:2eb2.A&PDB-ENSP_mappings:2eb3.A&PDB-ENSP_mappings:2gs2.A&PDB-ENSP_mappings:2gs6.A&PDB-ENSP_mappings:2gs7.A&PDB-ENSP_mappings:2gs7.B&PDB-ENSP_mappings:2itn.A&PDB-ENSP_mappings:2ito.A&PDB-ENSP_mappings:2itp.A&PDB-ENSP_mappings:2itq.A&PDB-ENSP_mappings:2itt.A&PDB-ENSP_mappings:2itu.A&PDB-ENSP_mappings:2itv.A&PDB-ENSP_mappings:2itw.A&PDB-ENSP_mappings:2itx.A&PDB-ENSP_mappings:2ity.A&PDB-ENSP_mappings:2itz.A&PDB-ENSP_mappings:2j5e.A&PDB-ENSP_mappings:2j5f.A&PDB-ENSP_mappings:2j6m.A&PDB-ENSP_mappings:2jit.A&PDB-ENSP_mappings:2jit.B&PDB-ENSP_mappings:2jiu.A&PDB-ENSP_mappings:2jiu.B&PDB-ENSP_mappings:2jiv.A&PDB-ENSP_mappings:2jiv.B&PDB-ENSP_mappings:2rf9.A&PDB-ENSP_mappings:2rf9.B&PDB-ENSP_mappings:2rfd.A&PDB-ENSP_mappings:2rfd.B&PDB-ENSP_mappings:2rfe.A&PDB-ENSP_mappings:2rfe.B&PDB-ENSP_mappings:2rfe.C&PDB-ENSP_mappings:2rfe.D&PDB-ENSP_mappings:2rgp.A&PDB-ENSP_mappings:3bel.A&PDB-ENSP_mappings:3gop.A&PDB-ENSP_mappings:3gt8.A&PDB-ENSP_mappings:3gt8.B&PDB-ENSP_mappings:3gt8.C&PDB-ENSP_mappings:3gt8.D&PDB-ENSP_mappings:3ika.A&PDB-ENSP_mappings:3ika.B&PDB-ENSP_mappings:3lzb.A&PDB-ENSP_mappings:3lzb.B&PDB-ENSP_mappings:3lzb.C&PDB-ENSP_mappings:3lzb.D&PDB-ENSP_mappings:3lzb.E&PDB-ENSP_mappings:3lzb.F&PDB-ENSP_mappings:3lzb.G&PDB-ENSP_mappings:3lzb.H&PDB-ENSP_mappings:3poz.A&PDB-ENSP_mappings:3ug1.A&PDB-ENSP_mappings:3ug2.A&PDB-ENSP_mappings:3vjn.A&PDB-ENSP_mappings:3vjo.A&PDB-ENSP_mappings:3w2o.A&PDB-ENSP_mappings:3w2p.A&PDB-ENSP_mappings:3w2q.A&PDB-ENSP_mappings:3w2r.A&PDB-ENSP_mappings:3w2s.A&PDB-ENSP_mappings:3w32.A&PDB-ENSP_mappings:3w33.A&PDB-ENSP_mappings:4g5j.A&PDB-ENSP_mappings:4g5p.A&PDB-ENSP_mappings:4g5p.B&PDB-ENSP_mappings:4hjo.A&PDB-ENSP_mappings:4i1z.A&PDB-ENSP_mappings:4i20.A&PDB-ENSP_mappings:4i21.A&PDB-ENSP_mappings:4i21.B&PDB-ENSP_mappings:4i22.A&PDB-ENSP_mappings:4i23.A&PDB-ENSP_mappings:4i24.A&PDB-ENSP_mappings:4i24.B&PDB-ENSP_mappings:4jq7.A&PDB-ENSP_mappings:4jq8.A&PDB-ENSP_mappings:4jr3.A&PDB-ENSP_mappings:4jrv.A&PDB-ENSP_mappings:4li5.A&PDB-ENSP_mappings:4ll0.A&PDB-ENSP_mappings:4ll0.B&PDB-ENSP_mappings:4lqm.A&PDB-ENSP_mappings:4lrm.A&PDB-ENSP_mappings:4lrm.B&PDB-ENSP_mappings:4lrm.C&PDB-ENSP_mappings:4lrm.D&PDB-ENSP_mappings:4lrm.E&PDB-ENSP_mappings:4r3p.A&PDB-ENSP_mappings:4r3r.A&PDB-ENSP_mappings:4r5s.A&PDB-ENSP_mappings:4riw.B&PDB-ENSP_mappings:4riw.D&PDB-ENSP_mappings:4rix.B&PDB-ENSP_mappings:4rix.D&PDB-ENSP_mappings:4riy.B&PDB-ENSP_mappings:4riy.D&PDB-ENSP_mappings:4rj4.A&PDB-ENSP_mappings:4rj5.A&PDB-ENSP_mappings:4rj6.A&PDB-ENSP_mappings:4rj7.A&PDB-ENSP_mappings:4rj8.A&PDB-ENSP_mappings:4tks.A&PDB-ENSP_mappings:4wd5.A&PDB-ENSP_mappings:4wd5.B&PDB-ENSP_mappings:4wkq.A&PDB-ENSP_mappings:4wrg.A&PDB-ENSP_mappings:4zau.A&PDB-ENSP_mappings:4zjv.A&PDB-ENSP_mappings:4zjv.B&PDB-ENSP_mappings:4zse.A&PDB-ENSP_mappings:4zse.B&PDB-ENSP_mappings:4zse.C&PDB-ENSP_mappings:4zse.D&PDB-ENSP_mappings:5c8k.A&PDB-ENSP_mappings:5c8m.A&PDB-ENSP_mappings:5c8n.A&PDB-ENSP_mappings:5cal.A&PDB-ENSP_mappings:5can.A&PDB-ENSP_mappings:5cao.A&PDB-ENSP_mappings:5cap.A&PDB-ENSP_mappings:5caq.A&PDB-ENSP_mappings:5cas.A&PDB-ENSP_mappings:5cau.A&PDB-ENSP_mappings:5cav.A&PDB-ENSP_mappings:5cnn.A&PDB-ENSP_mappings:5cnn.B&PDB-ENSP_mappings:5cno.A&PDB-ENSP_mappings:5cno.B&PDB-ENSP_mappings:5cno.X&PDB-ENSP_mappings:5czh.A&PDB-ENSP_mappings:5czi.A&PDB-ENSP_mappings:5d41.A&PDB-ENSP_mappings:5d41.B&PDB-ENSP_mappings:5edp.A&PDB-ENSP_mappings:5edq.A&PDB-ENSP_mappings:5edr.A&PDB-ENSP_mappings:5em5.A&PDB-ENSP_mappings:5em6.A&PDB-ENSP_mappings:5em7.A&PDB-ENSP_mappings:5em8.A&PDB-ENSP_mappings:5fed.A&PDB-ENSP_mappings:5fee.A&PDB-ENSP_mappings:5feq.A&PDB-ENSP_mappings:5gmp.A&PDB-ENSP_mappings:5gnk.A&PDB-ENSP_mappings:5gty.A&PDB-ENSP_mappings:5gty.B&PDB-ENSP_mappings:5gty.C&PDB-ENSP_mappings:5gty.D&PDB-ENSP_mappings:5gty.E&PDB-ENSP_mappings:5gty.F&PDB-ENSP_mappings:5gty.G&PDB-ENSP_mappings:5gty.H&PDB-ENSP_mappings:5gtz.A&PDB-ENSP_mappings:5hcx.A&PDB-ENSP_mappings:5hcy.A&PDB-ENSP_mappings:5hcz.A&PDB-ENSP_mappings:5hg5.A&PDB-ENSP_mappings:5hg7.A&PDB-ENSP_mappings:5hg8.A&PDB-ENSP_mappings:5hg9.A&PDB-ENSP_mappings:5hib.A&PDB-ENSP_mappings:5hic.A&PDB-ENSP_mappings:5j9y.A&PDB-ENSP_mappings:5j9z.A&PDB-ENSP_mappings:5jeb.A&PDB-ENSP_mappings:5u8l.A&PDB-ENSP_mappings:5ug8.A&PDB-ENSP_mappings:5ug9.A&PDB-ENSP_mappings:5uga.A&PDB-ENSP_mappings:5ugb.A&PDB-ENSP_mappings:5ugc.A&PDB-ENSP_mappings:5uwd.A&PDB-ENSP_mappings:5x26.A&PDB-ENSP_mappings:5x27.A&PDB-ENSP_mappings:5x28.A&PDB-ENSP_mappings:5x2a.A&PDB-ENSP_mappings:5x2a.B&PDB-ENSP_mappings:5x2a.C&PDB-ENSP_mappings:5x2a.D&PDB-ENSP_mappings:5x2c.A&PDB-ENSP_mappings:5x2c.B&PDB-ENSP_mappings:5x2f.A&PDB-ENSP_mappings:5x2f.B&PDB-ENSP_mappings:5x2f.C&PDB-ENSP_mappings:5x2f.D&PDB-ENSP_mappings:5x2k.A&PDB-ENSP_mappings:5xdk.A&PDB-ENSP_mappings:5xdl.A&PDB-ENSP_mappings:5xgm.A&PDB-ENSP_mappings:5xgn.A&PDB-ENSP_mappings:5xgn.B&PDB-ENSP_mappings:5y25.A&PDB-ENSP_mappings:5y9t.A&PDB-ENSP_mappings:5yu9.A&PDB-ENSP_mappings:5yu9.B&PDB-ENSP_mappings:5yu9.C&PDB-ENSP_mappings:5yu9.D&PDB-ENSP_mappings:5zto.A&PDB-ENSP_mappings:5zwj.A&PDB-ENSP_mappings:6d8e.A&PDB-ENSP_mappings:6duk.A&PDB-ENSP_mappings:6duk.B&PDB-ENSP_mappings:6duk.C&PDB-ENSP_mappings:6duk.D&PDB-ENSP_mappings:6duk.E&PDB-ENSP_mappings:6duk.F&PDB-ENSP_mappings:6jrj.A&PDB-ENSP_mappings:6jrk.A&PDB-ENSP_mappings:6jrx.A&PDB-ENSP_mappings:6jwl.A&PDB-ENSP_mappings:6jx0.A&PDB-ENSP_mappings:6jx4.A&PDB-ENSP_mappings:6jxt.A&PDB-ENSP_mappings:6jz0.A&PDB-ENSP_mappings:6lub.A&PDB-ENSP_mappings:6lud.A&PDB-ENSP_mappings:6p1d.A&PDB-ENSP_mappings:6p1d.B&PDB-ENSP_mappings:6p1d.C&PDB-ENSP_mappings:6p1d.D&PDB-ENSP_mappings:6p1l.A&PDB-ENSP_mappings:6p1l.B&PDB-ENSP_mappings:6p1l.C&PDB-ENSP_mappings:6p1l.D&PDB-ENSP_mappings:6p8q.A&PDB-ENSP_mappings:6p8q.B&PDB-ENSP_mappings:6p8q.C&PDB-ENSP_mappings:6p8q.D&PDB-ENSP_mappings:6s89.A&PDB-ENSP_mappings:6s8a.A&PDB-ENSP_mappings:6s9b.A&PDB-ENSP_mappings:6s9c.A&PDB-ENSP_mappings:6s9d.A&PDB-ENSP_mappings:6tfu.A&PDB-ENSP_mappings:6tfu.B&PDB-ENSP_mappings:6tfv.A&PDB-ENSP_mappings:6tfv.B&PDB-ENSP_mappings:6tfw.A&PDB-ENSP_mappings:6tfw.B&PDB-ENSP_mappings:6tfy.A&PDB-ENSP_mappings:6tfy.B&PDB-ENSP_mappings:6tfz.A&PDB-ENSP_mappings:6tfz.B&PDB-ENSP_mappings:6tg0.A&PDB-ENSP_mappings:6tg0.B&PDB-ENSP_mappings:6tg1.A&PDB-ENSP_mappings:6tg1.B&PDB-ENSP_mappings:6v5n.A&PDB-ENSP_mappings:6v5n.B&PDB-ENSP_mappings:6v5n.C&PDB-ENSP_mappings:6v5n.D&PDB-ENSP_mappings:6v5p.A&PDB-ENSP_mappings:6v5p.B&PDB-ENSP_mappings:6v5p.C&PDB-ENSP_mappings:6v5p.D&PDB-ENSP_mappings:6v66.A&PDB-ENSP_mappings:6v66.B&PDB-ENSP_mappings:6v66.C&PDB-ENSP_mappings:6v66.D&PDB-ENSP_mappings:6v6k.A&PDB-ENSP_mappings:6v6k.B&PDB-ENSP_mappings:6v6k.C&PDB-ENSP_mappings:6v6k.D&PDB-ENSP_mappings:6v6k.E&PDB-ENSP_mappings:6v6k.F&PDB-ENSP_mappings:6v6k.G&PDB-ENSP_mappings:6v6k.H&PDB-ENSP_mappings:6v6o.A&PDB-ENSP_mappings:6v6o.B&PDB-ENSP_mappings:6v6o.C&PDB-ENSP_mappings:6v6o.D&PDB-ENSP_mappings:6v6o.E&PDB-ENSP_mappings:6v6o.F&PDB-ENSP_mappings:6v6o.G&PDB-ENSP_mappings:6v6o.H&PDB-ENSP_mappings:6vh4.A&PDB-ENSP_mappings:6vhn.A&PDB-ENSP_mappings:6vhp.A&PDB-ENSP_mappings:6wa2.A&PDB-ENSP_mappings:6wa2.B&PDB-ENSP_mappings:6wa2.C&PDB-ENSP_mappings:6wa2.D&PDB-ENSP_mappings:6wak.A&PDB-ENSP_mappings:6wak.B&PDB-ENSP_mappings:6wak.C&PDB-ENSP_mappings:6wak.D&PDB-ENSP_mappings:6wxn.A&PDB-ENSP_mappings:6wxn.B&PDB-ENSP_mappings:6wxn.C&PDB-ENSP_mappings:6wxn.D&PDB-ENSP_mappings:6xl4.A&PDB-ENSP_mappings:6xl4.B&PDB-ENSP_mappings:6xl4.C&PDB-ENSP_mappings:6xl4.D&PDB-ENSP_mappings:6z4b.A&PDB-ENSP_mappings:6z4b.B&PDB-ENSP_mappings:6z4d.A&PDB-ENSP_mappings:6z4d.B&PDB-ENSP_mappings:7a2a.A&PDB-ENSP_mappings:7a2a.B&PDB-ENSP_mappings:7a6i.A&PDB-ENSP_mappings:7a6j.A&PDB-ENSP_mappings:7a6j.B&PDB-ENSP_mappings:7a6k.A&PDB-ENSP_mappings:7a6k.B&PDB-ENSP_mappings:7a6k.C&PDB-ENSP_mappings:7a6k.D&PDB-ENSP_mappings:7aei.A&PDB-ENSP_mappings:7aem.A&PDB-ENSP_mappings:7b85.A&PDB-ENSP_mappings:7er2.A&PDB-ENSP_mappings:7jxi.A&PDB-ENSP_mappings:7jxi.B&PDB-ENSP_mappings:7jxi.C&PDB-ENSP_mappings:7jxi.D&PDB-ENSP_mappings:7jxk.A&PDB-ENSP_mappings:7jxk.B&PDB-ENSP_mappings:7jxk.C&PDB-ENSP_mappings:7jxk.D&PDB-ENSP_mappings:7jxk.E&PDB-ENSP_mappings:7jxk.F&PDB-ENSP_mappings:7jxl.A&PDB-ENSP_mappings:7jxl.B&PDB-ENSP_mappings:7jxl.C&PDB-ENSP_mappings:7jxl.D&PDB-ENSP_mappings:7jxm.A&PDB-ENSP_mappings:7jxm.B&PDB-ENSP_mappings:7jxm.C&PDB-ENSP_mappings:7jxm.D&PDB-ENSP_mappings:7jxp.A&PDB-ENSP_mappings:7jxp.B&PDB-ENSP_mappings:7jxp.C&PDB-ENSP_mappings:7jxp.D&PDB-ENSP_mappings:7jxp.E&PDB-ENSP_mappings:7jxp.F&PDB-ENSP_mappings:7jxq.A&PDB-ENSP_mappings:7jxq.B&PDB-ENSP_mappings:7jxq.C&PDB-ENSP_mappings:7jxq.D&PDB-ENSP_mappings:7jxw.A&PDB-ENSP_mappings:7jxw.B&PDB-ENSP_mappings:7jxw.C&PDB-ENSP_mappings:7jxw.D&PDB-ENSP_mappings:7k1h.A&PDB-ENSP_mappings:7k1h.B&PDB-ENSP_mappings:7k1h.C&PDB-ENSP_mappings:7k1h.D&PDB-ENSP_mappings:7k1h.E&PDB-ENSP_mappings:7k1h.F&PDB-ENSP_mappings:7k1i.A&PDB-ENSP_mappings:7kxz.A&PDB-ENSP_mappings:7ky0.A&PDB-ENSP_mappings:7ky0.B&PDB-ENSP_mappings:7ky0.C&PDB-ENSP_mappings:7ky0.D&PDB-ENSP_mappings:7lg8.A&PDB-ENSP_mappings:7lg8.B&PDB-ENSP_mappings:7lg8.C&PDB-ENSP_mappings:7lg8.D&PDB-ENSP_mappings:7lgs.A&PDB-ENSP_mappings:7lgs.B&PDB-ENSP_mappings:7lgs.C&PDB-ENSP_mappings:7lgs.D&PDB-ENSP_mappings:7ltx.A&PDB-ENSP_mappings:7ltx.B&PDB-ENSP_mappings:7ltx.C&PDB-ENSP_mappings:7ltx.D&PDB-ENSP_mappings:7oxb.A&PDB-ENSP_mappings:7si1.A&PDB-ENSP_mappings:7syd.A&PDB-ENSP_mappings:7syd.B&PDB-ENSP_mappings:7sye.A&PDB-ENSP_mappings:7sye.B&PDB-ENSP_mappings:7sz0.A&PDB-ENSP_mappings:7sz0.B&PDB-ENSP_mappings:7sz1.A&PDB-ENSP_mappings:7sz1.B&PDB-ENSP_mappings:7sz5.A&PDB-ENSP_mappings:7sz5.B&PDB-ENSP_mappings:7sz7.A&PDB-ENSP_mappings:7sz7.B&PDB-ENSP_mappings:7t4i.A&PDB-ENSP_mappings:7t4j.A&PDB-ENSP_mappings:7t4j.B&PDB-ENSP_mappings:7tvd.A&PDB-ENSP_mappings:7u98.A&PDB-ENSP_mappings:7u98.B&PDB-ENSP_mappings:7u98.C&PDB-ENSP_mappings:7u98.D&PDB-ENSP_mappings:7u99.A&PDB-ENSP_mappings:7u9a.A&PDB-ENSP_mappings:7ukv.A&PDB-ENSP_mappings:7ukw.A&PDB-ENSP_mappings:7ukw.B&PDB-ENSP_mappings:7ukw.C&PDB-ENSP_mappings:7ukw.D&PDB-ENSP_mappings:7vra.A&PDB-ENSP_mappings:7vre.A&PDB-ENSP_mappings:7zym.A&PDB-ENSP_mappings:7zyn.A&PDB-ENSP_mappings:7zyp.A&PDB-ENSP_mappings:7zyq.A&PDB-ENSP_mappings:7zyq.B&PDB-ENSP_mappings:8a27.A&PDB-ENSP_mappings:8a2a.A&PDB-ENSP_mappings:8a2b.A&PDB-ENSP_mappings:8a2d.A&PDB-ENSP_mappings:8d73.A&PDB-ENSP_mappings:8d73.B&PDB-ENSP_mappings:8d76.A&PDB-ENSP_mappings:8d76.B&PDB-ENSP_mappings:8dsw.A&PDB-ENSP_mappings:8eme.A&PDB-ENSP_mappings:8eme.B&PDB-ENSP_mappings:8f1h.A&PDB-ENSP_mappings:8f1w.A&PDB-ENSP_mappings:8f1w.B&PDB-ENSP_mappings:8f1w.C&PDB-ENSP_mappings:8f1w.D&PDB-ENSP_mappings:8f1x.A&PDB-ENSP_mappings:8f1y.A&PDB-ENSP_mappings:8f1z.A&PDB-ENSP_mappings:8fv3.A&PDB-ENSP_mappings:8fv3.B&PDB-ENSP_mappings:8fv3.C&PDB-ENSP_mappings:8fv3.D&PDB-ENSP_mappings:8fv4.A&PDB-ENSP_mappings:8fv4.B&PDB-ENSP_mappings:8fv4.C&PDB-ENSP_mappings:8fv4.D&PDB-ENSP_mappings:8g63.A&PDB-ENSP_mappings:8gb4.A&PDB-ENSP_mappings:8gb4.B&PDB-ENSP_mappings:8gb4.C&PDB-ENSP_mappings:8gb4.D&PDB-ENSP_mappings:8gk5.A&PDB-ENSP_mappings:8gk5.B&PDB-ENSP_mappings:8gk5.C&PDB-ENSP_mappings:8gk5.D&PDB-ENSP_mappings:8h7x.A&PDB-ENSP_mappings:8h7x.B&PDB-ENSP_mappings:8hv1.A&PDB-ENSP_mappings:8hv2.A&PDB-ENSP_mappings:8hv3.A&PDB-ENSP_mappings:8hv4.A&PDB-ENSP_mappings:8hv5.A&PDB-ENSP_mappings:8hv6.A&PDB-ENSP_mappings:8hv7.A&PDB-ENSP_mappings:8hv8.A&PDB-ENSP_mappings:8hv9.A&PDB-ENSP_mappings:8hva.A&PDB-ENSP_mappings:8hy7.A&PDB-ENSP_mappings:8kfq.A&PDB-ENSP_mappings:8pnz.A&PDB-ENSP_mappings:8po0.A&PDB-ENSP_mappings:8po1.A&PDB-ENSP_mappings:8po2.A&PDB-ENSP_mappings:8po2.B&PDB-ENSP_mappings:8po2.D&PDB-ENSP_mappings:8po3.A&PDB-ENSP_mappings:8po4.A&PDB-ENSP_mappings:8po4.B&PDB-ENSP_mappings:8sc7.A&PDB-ENSP_mappings:8tjl.A&PDB-ENSP_mappings:8to3.A&PDB-ENSP_mappings:8to3.B&PDB-ENSP_mappings:8to3.C&PDB-ENSP_mappings:8to3.D&PDB-ENSP_mappings:8to4.A&PDB-ENSP_mappings:8to4.B&PDB-ENSP_mappings:8to4.C&PDB-ENSP_mappings:8to4.D&PDB-ENSP_mappings:8wd4.A&SMART:SM00219&Superfamily:SSF56112&CDD:cd05108&PANTHER:PTHR24416&PROSITE_profiles:PS50011&Phobius:CYTOPLASMIC_DOMAIN&Pfam:PF07714&Gene3D:3.30.200.20&PIRSF:PIRSF000619&AFDB-ENSP_mappings:AF-P00533-F11&11&1FalseThe EGFR E746_A750del mutation is located in the tyrosine kinase domain in exon 19 of the protein. This mutation has been found in non-small cell lung cancer (NSCLC) (PMID: 18508816, 22483783, 16467085, 18325048, 15897572, 25179728, 18261621, 15710947). In-frame deletions of EGFR exon 19 result in constitutive activation of EGFR tyrosine kinase activity and confer sensitivity to EGFR tyrosine kinase inhibitors (TKIs) including gefitinib, erlotinib and afatinib in lung adenocarcinoma (PMID: 15118073, 15118125, 15329413). Cell line experiments demonstrate that this mutation is activating, transforming and sensitive to gefitinib (PMID: 16373402, 29141884). Across many clinical studies, patients with non-small cell lung cancer harboring the EGFR E746_A750del have had clinical benefit from treatment with gefitinib or erlotinib (PMID: 18508816, 22483783, 16467085, 18325048, 15897572, 25179728, 18261621, 15710947).EGFR, a receptor tyrosine kinase, is altered by amplification and/or mutation in lung and brain cancers among others.18508816|29141884|16467085|15329413|25179728|15710947|15118125|15897572|18325048|15118073|18261621|22483783|16373402E746_A750del1956EGFRGRCh38.MUTATION.The EGFR E746_A750del alteration is known to be oncogenic.FalseLEVEL_Fda2The EGFR E746_A750del mutation is located in the tyrosine kinase domain in exon 19 of the protein. This mutation has been found in non-small cell lung cancer (NSCLC) (PMID: 18508816, 22483783, 16467085, 18325048, 15897572, 25179728, 18261621, 15710947). In-frame deletions of EGFR exon 19 result in constitutive activation of EGFR tyrosine kinase activity and confer sensitivity to EGFR tyrosine kinase inhibitors (TKIs) including gefitinib, erlotinib and afatinib in lung adenocarcinoma (PMID: 15118073, 15118125, 15329413). Cell line experiments demonstrate that this mutation is activating, transforming and sensitive to gefitinib (PMID: 16373402, 29141884). Across many clinical studies, patients with non-small cell lung cancer harboring the EGFR E746_A750del have had clinical benefit from treatment with gefitinib or erlotinib (PMID: 18508816, 22483783, 16467085, 18325048, 15897572, 25179728, 18261621, 15710947).['18508816', '29141884', '16467085', '15329413', '25179728', '15710947', '15118125', '15897572', '18325048', '15118073', '18261621', '22483783', '16373402']AfatinibLEVEL_1LEVEL_Fda2['23816960', '22452895', '25589191']Afatinib, a second-generation, irreversible tyrosine kinase inhibitor of EGFR, HER2, and HER4, is FDA-approved as first-line therapy in patients with non-small cell lung cancer (NSCLC) whose tumors harbor EGFR exon 19 deletion or L858R, L861Q, G719, and/or S768I substitution mutations. FDA approval was based on the Phase II LUX-Lung 2 trial, which demonstrated an objective response rate of 61% in patients with EGFR-mutant lung cancer treated with afatinib (PMID: 22452895). In the Phase III LUX-Lung 3 trial, afatinib significantly improved progression-free survival (PFS) in patients with EGFR-mutant lung cancer compared to patients treated with chemotherapy comprised of cisplatin plus pemetrexed (13.6 months versus 6.9 months, HR=0.47, p=0.001) (PMID: 23816960). In a pooled analysis of the LUX-Lung 3 and 6 trials comparing overall survival in patients with EGFR mutation who were treated with afatinib versus those treated with chemotherapy, first-line treatment with afatinib significantly improved overall survival specifically in patients harboring exon 19 deletions compared to those treated with chemotherapy (31.7 versus 20.7 months, HR = 0.59, p = 0.0001) (PMID: 25589191).Non-Small Cell Lung CancerSOLIDLungAmivantamab + ChemotherapyLEVEL_1LEVEL_Fda2['37879444']Amivantamab is an intravenously infused, EGFR-MET bispecific monoclonal antibody that is FDA-approved for the treatment of adult patients in combination with carboplatin and pemetrexed for the treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with EGFR exon 19 deletions or exon 21 L858R substitution mutations, whose disease has progressed on or after treatment with an EGFR tyrosine kinase inhibitor. FDA approval is based on the results of the Phase III MARIPOSA-2 (NCT04988295) trial of amivantamab plus chemotherapy versus chemotherapy in 394 patients with NSCLC with EGFR L858R mutations or exon 19 deletions. __In the Phase III MARIPOSA-2 (NCT04988295) trial, the amivantamab plus chemotherapy cohort (n=131 [n=89, EGFR exon 19 deletions, n=42, EGFR L858R]) demonstrated an overall response rate (ORR) of 53% (95% CI=44-62), with a 0.8% complete response (CR) rate and 52% partial response (PR) rate (PMID: 37879444). In contrast, the chemotherapy cohort (n=263 [n=183, EGFR exon 19 deletions, n=79, EGFR L858R]) demonstrated an ORR of 29% (95% CI=23-35) (p<0.0001), with a 29% PR rate (PMID: 37879444). The amivantamab plus chemotherapy cohort demonstrated a median progression-free survival (PFS) of 6.3 months (95% CI=5.6-8.4) and a median duration of response (DOR) of 6.9 months (95% CI= 5.5NE) while the chemotherapy cohort demonstrated a median PFS of 4.2 months (95% CI=4.04.4) (HR=0.48 [95% CI=0.36-0.64], p<0.0001) and a median DOR of 5.6 months (95% CI=4.29.6) (PMID: 37879444).Non-Small Cell Lung CancerSOLIDLungAmivantamab + LazertinibLEVEL_1LEVEL_Fda2['38924756']Amivantamab, an intravenously infused, EGFR-MET bispecific monoclonal antibody, and lazertinib, a small molecule, third-generation EGFR tyrosine kinase inhibitor, are FDA-approved in combination for the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with EGFR exon 19 deletions or exon 21 L858R substitution mutations, as detected by an FDA-approved test. FDA approval was based on the results of the Phase III MARIPOSA (NCT04487080) trial of amivantamab plus lazertinib versus osimertinib monotherapy in 1074 patients with NSCLC with an EGFR exon 19 deletion or L858R mutation. In the Phase III MARIPOSA (NCT04487080) trial, the amivantamab plus lazertinib cohort (n=429) demonstrated an overall response rate (ORR) of 86% (95% CI=83-89), a median progression-free survival (PFS) of 23.7 months (95% CI=19.1-27.7), a median duration of response (DOR) of 25.8 months (95% CI=20.1-NE) and a 24-month overall survival (OS) rate of 74% (95% CI=69-78) while the osimertinib cohort (n=429) demonstrated an ORR of 85% (95% CI=81-88), a median PFS of 16.6 months (95% CI=14.818.5) (HR=0.70 [95% CI=0.58-0.85], p<0.001), a median DOR of 16.8 months (95% CI=14.8-18.5) and a 24-month OS rate of 69% (95% CI=64-74) (PMID: 38924756).Non-Small Cell Lung CancerSOLIDLungDacomitinibLEVEL_1LEVEL_Fda2['29864379', '28958502']Dacomitinib is a small molecule inhibitor of EGFR that is FDA-approved for the first-line treatment of patients with metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 19 deletion or exon 21 L858R substitution mutations as detected by an FDA-approved test. FDA approval was based on the Phase III ARCHER 1050 trial of dacomitinib versus gefitinib in 452 patients with advanced, EGFR-positive NSCLC in which the median progression-free survival (PFS) was 14.7 months for patients randomized to dacomitinib and 9.2 months for patients randomized to gefitinib (HR=0.59, 95% CI=0.47-0.74, p=0001) (PMID: 28958502). Overall survival was 34.1 months in the dacomitinib arm versus 26.8 months in the gefitinib arm (HR=0.760, 95% CI=0.582-0.993, P = .044) (PMID: 29864379).Non-Small Cell Lung CancerSOLIDLungDatopotamab DeruxtecanLEVEL_1LEVEL_Fda2['39761483', '39250535']Datopotamab deruxtecan (Dato-DXd) is an intravenously infused, TROP2-directed antibody drug conjugate that is FDA-approved for the treatment of patients with EGFR-mutated non-small cell lung cancer (NSCLC) who have received prior EGFR-directed therapy and platinum-based chemotherapy. FDA approval is based on the results of the Phase II TROPION-Lung05 (NCT04484142) and Phase III TROPION-Lung01 (NCT04656652) trials of Dato-DXd in patients with previously treated EGFR-mutated NSCLC._In the Phase II TROPION-Lung05 (NCT04484142) trial of Dato-DXd in patients with NSCLC harboring actionable alterations progressing on or after targeted therapy and platinum-based chemotherapy, patients with EGFR-mutated NSCLC (n=78 [exon 19 deletion: 41 (29.9%), exon 20 T790M: 26 (19.0%), exon 21 L858R: 25 (18.2%), exon 18 G719: 5 (3.6%), exon 21 L861Q: 3 (2.2%), exon 20 insertion: 2 (1.5%)]) demonstrated an overall response rate (ORR) of 43.6% (95% CI=32.4-55.3), with a 5.1% (n=4) complete response (CR) rate, 38.5% (n=30) partial response (PR) rate and 34.6% (n=27) stable disease (SD) rate, a disease control rate (DCR) of 82.1% (95% CI=71.7-89.8), a median duration of response (DOR) of 7.0 months (95% CI=4.2-10.2) and a median progression-free survival (PFS) of 5.8 months (95% CI=5.4-8.3) (PMID: 39761483)._In the Phase III TROPION-Lung01 (NCT04656652) trial of Dato-DXd versus docetaxel in patients with pretreated NSCLC, patients treated with Dato-DXd (n=299 [EGFR mutations: 39 (13.0%)]) demonstrated an ORR of 26.4% (95% CI= 21.5-31.8), with a 1.3% (n=4) CR rate, 25.1% (n=75) PR rate and 49.8% (n=149) SD rate, a DCR of 77.3% (95% CI=72.1-81.9), a median DOR of 7.1 months (95% CI=5.6-10.9), a median PFS of 4.4 months (95% CI=4.2-5.6) and a median overall survival (OS) of 12.9 months (95% CI=11.0-13.9) (PMID: 39250535). Patients treated with docetaxel (n=305 [EGFR mutations: 45 (14.8%)]) demonstrated an ORR of 12.8% (95% CI=9.3-17.1), with a 12.8% (n=39) PR rate and 50.2% (n=153) SD rate, a DCR of 64.9% (95% CI=59.3-70.3), a median DOR of 5.6 months (95% CI=5.4-8.1), a median PFS of 3.7 months (95% CI=2.9-4.2) (HR=0.75 [95% CI=0.62-0.91], p=.004) and a median OS of 11.8 months (95% CI=10.1-12.8) (HR=0.94 [95% CI=0.78-1.14], p=0.530) (PMID: 39250535).Non-Small Cell Lung CancerSOLIDLungErlotinibLEVEL_1LEVEL_Fda2['22285168', '27987585']Erlotinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is approved with or without ramucirumab for the treatment of non-small cell lung cancer (NSCLC) with EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. Results of the Phase III EURTAC trial demonstrated that patients with NSCLC receiving erlotinib showed significant improvement in progression-free survival (PFS) (9.7 vs. 5.2 months, HR=0.37, p=0.0001) compared to those receiving platinum-based doublet chemotherapy (PMID: 22285168). The partial response rate with erlotinib was 56%, compared to 13% with chemotherapy, and was associated with a reduced toxicity profile (PMID: 22285168). The safety and efficacy of erlotinib have not been established in patients harboring EGFR mutations other than exon 19 deletion and exon 21 (L858R) substitution, however, the phase III IUNO trial demonstrated no difference in PFS between patients with NSCLC lacking EGFR exon 19 deletion or EGFR L858R mutation who were given erlotinib versus placebo as maintenance therapy (PMID: 27987585).Non-Small Cell Lung CancerSOLIDLungGefitinibLEVEL_1LEVEL_Fda2['20022809', '19692680', '21670455', '22370314', '31682542', '20573926']Gefitinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is FDA-approved as first-line therapy in patients with non-small cell lung cancer (NSCLC) whose tumors harbor EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. FDA approval is based on multiple clinical trials that demonstrated the efficacy of gefitinib in EGFR-mutant NSCLC and includes IPASS (PMID: 19692680, 21670455), NEJ002 (PMID: 20573926), WJTOG3405 (PMID: 20022809) and First-SIGNAL (PMID: 22370314). Response rates in EGFR-mutant lung cancers in these studies ranged from 55% to 85%, with median progression-free survival (PFS) of 8 to 10.8 months (PMID: 19692680, 21670455, 20573926, 20022809, 22370314). In one study comparing gefitinib with standard chemotherapy in pulmonary adenocarcinoma, the response rate with gefitinib in patients with EGFR mutations (47%) was nearly double that of patients who were EGFR wildtype (24%) (PMID: 19692680). Additionally, in the biomarker analysis and final overall survival (OS) analysis of the Phase III IPASS study, though OS was not different between the gefitinib and carboplatin/paclitaxel groups, 64.3% of patients assigned to chemotherapy had crossed over to treatment with EGFR TKIs, PFS in this study was significantly longer with gefitinib than chemotherapy in patients with EGFR mutation (HR=0.48) (PMID: 21670455). In a Phase II trial, the addition of carboplatin plus pemetrexed to gefitinib increased progression-free survival (20.9 months vs 11.9 months, HR = 0.490, P < .001) in patients with EGFR-mutant NSCLC compared to gefitinib alone (PMID: 31682542).Non-Small Cell Lung CancerSOLIDLungOsimertinibLEVEL_1LEVEL_Fda2['38828946', '32955177', '29151359', '31751012']Osimertinib is an orally available, small molecule third-generation EGFR T790M tyrosine kinase inhibitor (TKI) that is FDA-approved for adjuvant therapy after tumor resection in adult patients with non-small cell lung cancer (NSCLC) whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, the treatment of adult patients with locally advanced, unresectable (stage III) NSCLC whose disease has not progressed during or following concurrent or sequential platinum-based chemoradiation therapy and whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations and the first-line treatment of adult patients with metastatic NSCLC whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, as detected by an FDA-approved test. EGFR exon 19 deletions and exon 21 L858R mutations for treatment with osimertinib were detected by the cobas EGFR Mutation Test v2, FoundationOne CDx, FoundationOne Liquid CDx or Guardant360 CDx. FDA approvals were based on the results of the Phase III ADAURA (NCT02511106) trial for adjuvant treatment, the Phase III LAURA (NCT03521154) trial for locally advanced, unresectable NSCLC treatment and the Phase III FLAURA (NCT02296125) trial for first-line monotherapy treatment. __In the Phase III ADAURA (NCT02511106) trial of osimertinib versus placebo in 682 patients with completely resected EGFR mutation-positive stage IB to IIIA NSCLC, 89% (95% CI=85-92) of patients in the osimertinib cohort (n=339 [55%, EGFR exon 19 deletion, 45%, EGFR L858R, 1%, EGFR T790M]) and 52% (95% CI=46-58) of patients in the placebo cohort (n=343 [55%, EGFR exon 19 deletion, 45%, EGFR L858R, 1%, EGFR T790M]) were alive and disease-free at 24 months (HR=0.20 [99.12% CI=0.14-0.30], p<0.001) (PMID: 32955177). __In the Phase III LAURA (NCT03521154) trial of osimertinib versus placebo in 216 patients with unresectable EGFR mutation-positive stage III NSCLC without progression during or after chemoradiotherapy, the osimertinib cohort (n=143 [n=74, EGFR exon 19 deletion, n=68, EGFR L858R]) demonstrated an objective response rate (ORR) of 57% (95% CI=49-66), with a 2% (n=3) complete response (CR) rate, 55% (n=79) partial response (PR) rate and 31% (n=45) stable disease (SD) rate, a median progression-free survival (PFS) of 39.1 months (95% CI=31.5-NC) and a median duration of response (DOR) of 36.9 months (95% CI=30.1-NC). In contrast, the placebo cohort (n=73 [n=43, EGFR exon 19 deletion, n=30, EGFR L858R]) demonstrated an ORR of 33% (95% CI=22-45) (OR=2.77 [95% CI=1.54-5.08]), with a 1% (n=1) CR rate, 32% (n=23) PR rate and 47% (n=34) SD rate, a median PFS of 5.6 months (95% CI=3.7-7.4) (HR=0.16 [95% CI=0.10-0.24], p<0.001) and a median DOR of 6.5 months (95% CI=3.6-8.3) (PMID: 38828946). __In the Phase III FLAURA (NCT02296125) trial of osimertinib versus standard EGFR TKI (gefitinib or erlotinib) in 556 patients with previously untreated, EGFR mutation-positive advanced NSCLC, the osimertinib cohort (n=279 [n=175, EGFR exon 19 deletion, n=104, EGFR L858R]) demonstrated an ORR of 80% (95% CI=75-85), with a 3% (n=7) CR rate, 77% (n=216) PR rate and 17% (n=47) SD rate, a median PFS of 18.9 months (95% CI=15.2-21.4), a median DOR of 17.2 months (95% CI=13.8-22.0) and a median overall survival (OS) could not be calculated (95% CI=NC-NC). In contrast, the standard EGFR TKI cohort (n=277 [n=174, EGFR exon 19 deletion, n=103, EGFR L858R]) demonstrated an ORR of 76% (95% CI=70-81), with a 1% (n=4) CR rate, 74% (n=206) PR rate and 17% (n=46) SD rate, a median PFS of 10.2 months (95% CI=9.6-11.1) (HR=0.46 [95% CI=0.37-0.57], p<0.001), a median DOR of 8.5 months (95% CI=7.3-9.8) and a median OS that could not be calculated (95% CI=NC-NC) (HR=0.63 [95% CI=0.45-0.88], p=0.007) (PMID: 29151359). In the final analysis of the OS in the Phase III FLAURA (NCT02296125) trial, the osimertinib cohort and standard EGFR TKI cohort demonstrated a median OS of 38.6 months (95% CI=34.5-41.8) and 31.8 months (95% CI=26.6-36.0), respectively (HR=0.80 [95.05% CI=0.64-1.00], p=0.046) (PMID: 31751012).Non-Small Cell Lung CancerSOLIDLungOsimertinib + ChemotherapyLEVEL_1LEVEL_Fda2['37937763']Osimertinib is an orally available, small molecule third-generation EGFR T790M tyrosine kinase inhibitor (TKI) that is FDA-approved in combination with pemetrexed and platinum-based chemotherapy, the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, as detected by an FDA-approved test. EGFR exon 19 deletions and exon 21 L858R mutations for treatment with osimertinib were detected by the cobas EGFR Mutation Test v2, FoundationOne CDx, FoundationOne Liquid CDx or Guardant360 CDx. __FDA approval is based on the results of the Phase III FLAURA2 (NCT04035486) trial of osimertinib plus chemotherapy (pemetrexed plus cisplatin or carboplatin) versus single-agent osimertinib in 557 patients with previously untreated, EGFR mutation-positive advanced NSCLC. In the Phase III FLAURA2 (NCT04035486) trial, the osimertinib plus chemotherapy cohort (n=279 [n=169, EGFR exon 19 deletion, n=106, EGFR L858R, n=3, both, n=1, unknown]) demonstrated a median progression-free survival (PFS) of 25.5 months (95% CI=24.7-NC), a median duration of response (DOR) of 24.0 months (95% CI=20.9-27.8) and an objective response rate (ORR) of 83% (95% CI=78-87), with an 83% partial response (PR) rate and <1% complete response (CR) rate. The osimertinib monotherapy cohort (n=278 [n=168, EGFR exon 19 deletion, n=106, EGFR L858R, n=3, both, n=2, unknown]) demonstrated a median PFS of 16.7 months (95% CI=14.1-21.3) (HR=0.62 [95% CI=0.490.79], p<0.001), a median DOR of 15.3 months (95% CI=12.7-9.4) and an ORR of 76% (95% CI=70-80), with a 75% PR rate and 1% CR rate (PMID: 37937763).Non-Small Cell Lung CancerSOLIDLungErlotinib + RamucirumabLEVEL_1LEVEL_Fda2['22285168', '27987585']Erlotinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is approved with or without ramucirumab for the treatment of non-small cell lung cancer (NSCLC) with EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. Results of the Phase III EURTAC trial demonstrated that patients with NSCLC receiving erlotinib showed significant improvement in progression-free survival (PFS) (9.7 vs. 5.2 months, HR=0.37, p=0.0001) compared to those receiving platinum-based doublet chemotherapy (PMID: 22285168). The partial response rate with erlotinib was 56%, compared to 13% with chemotherapy, and was associated with a reduced toxicity profile (PMID: 22285168). The safety and efficacy of erlotinib have not been established in patients harboring EGFR mutations other than exon 19 deletion and exon 21 (L858R) substitution, however, the phase III IUNO trial demonstrated no difference in PFS between patients with NSCLC lacking EGFR exon 19 deletion or EGFR L858R mutation who were given erlotinib versus placebo as maintenance therapy (PMID: 27987585).Non-Small Cell Lung CancerSOLIDLungPatritumab DeruxtecanLEVEL_3ALEVEL_Fda3['37689979', '38369013', '31661465', '34548309', '30057690', '34084213']Patritumab deruxtecan (HER3-DXd) is an antibody-drug conjugate consisting of a HER3 antibody attached to a topoisomerase I inhibitor payload via a tetrapeptide-based cleavable linker. HER3 is the preferred heterodimeric partner for EGFR (PMID: 34084213, 30057690). In a phase I dose-escalation/expansion study (NCT03260491) of HER3-DXd in 57 patients with locally advanced or metastatic EGFR-mutated non-small cell lung cancer (NSCLC) (n=33 with Exon 19 deletion), the objective response rate (ORR) was 39% (95% CI=26.052.4) and median progression-free survival (PFS) was 8.2 (95% CI=4.48.3) months (PMID: 34548309). In the phase II HERTHENA-Lung01 trial of HER3-DXd in 225 patients with previously treated EGFR-mutated NSCLC, the median PFS was 5.5 months (95% CI=5.1-5.9) and an objective response was observed in 67 patients (29.8%, 95% CI=23.9-36.2), with complete response observed in one patient (PMID: 37689979). In preclinical studies, in vitro and in vivo models containing HER3-expressing CM-3 cancer cells treated with U3-1402 (HER3-DXd) exhibited reduced cell viability and tumor volume, respectively (PMID: 31661465). In the Phase I U31402-A-U102 (NCT03260491) trial of HER3-DXd in 97 patients with EGFR-mutated NSCLC who had received prior EGFR tyrosine kinase inhibitor therapy and platinum-based chemotherapy (n=64, exon 19 deletion, n=29, L858R, n=4, G719A, n=2, L861Q, n=1, exon 19 insertion), the cohort demonstrated an ORR of 39.2% (n=38) (95% CI=29.4-49.6), with a 1% (n=1) confirmed response rate, 38.1% (n=37) partial response rate, 40.2% (n=39) stable disease rate and 12.4% (n=12) progressive disease rate, a median duration of response of 9.6 months (95% CI=6.9-15.4), a median PFS of 6.4 months (95% CI=4.9-8.3) and a median overall survival of 15.8 months (95% CI=10.8-21.5) (PMID: 38369013).Non-Small Cell Lung CancerSOLIDLung18508816;29141884;16467085;15329413;25179728;15710947;15118125;15897572;18325048;15118073;18261621;22483783;1637340223816960;22452895;25589191;37879444;38924756;29864379;28958502;39761483;39250535;22285168;27987585;20022809;19692680;21670455;22370314;31682542;20573926;38828946;32955177;29151359;31751012;37937763;37689979;38369013;31661465;34548309;30057690;3408421395
TUMORp.T790MENSP00000275493.2:p.Thr790Metchr755181378CTPASSNM_005228missense_variantMODERATEEGFR20/28c.2369C>Trs121434569&CM054664&COSV51765492SNVdeleterious_low_confidence(0)probably_damaging(1)6.156e-064.599e-057.237e-05gnomADg_AFR0.000.000.000.000.5294.7500e-01EGFR-related_disorder&Lung_cancer&Inflammatory_skin_and_bowel_disease&_neonatal&_2&Hereditary_cancer-predisposing_syndrome&not_provided&EGFR-related_lung_cancer&Non-small_cell_lung_carcinoma&Lung_adenocarcinoma&Tyrosine_kinase_inhibitor_response&gefitinib_response_-_Efficacy&erlotinib_response_-_EfficacyNC_000007.14:g.55181378C>Treviewed_by_expert_paneldrug_responseOncogeniccriteria_provided&_single_submitter3EGFRT790Mrs121434569✓ Hotspotv7.0.LEVEL_Fda2✓ Hotspot07/07/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicDatopotamab Deruxtecan,OsimertinibErlotinib,Gefitinib,AfatinibLEVEL_R1LEVEL_1LEVEL_R160,350/1T790M0.3684210526315789GRCh38EGFRCCT55181378EGFR_T790M.GT:AD:AF:DP0/1:60,35:0.37:95TENSG00000146648TranscriptENST00000275493protein_coding26302369790T/MaCg/aTg1HGNCHGNC:3236YESMANE_SelectNM_005228.51P1CCDS5514.1ENSP00000275493P00533.293UPI000003E750P00533-1Ensembl1PDB-ENSP_mappings:1m14.A&PDB-ENSP_mappings:1m17.A&PDB-ENSP_mappings:1xkk.A&PDB-ENSP_mappings:2eb2.A&PDB-ENSP_mappings:2eb3.A&PDB-ENSP_mappings:2gs2.A&PDB-ENSP_mappings:2gs6.A&PDB-ENSP_mappings:2gs7.A&PDB-ENSP_mappings:2gs7.B&PDB-ENSP_mappings:2itn.A&PDB-ENSP_mappings:2ito.A&PDB-ENSP_mappings:2itp.A&PDB-ENSP_mappings:2itq.A&PDB-ENSP_mappings:2itt.A&PDB-ENSP_mappings:2itu.A&PDB-ENSP_mappings:2itv.A&PDB-ENSP_mappings:2itw.A&PDB-ENSP_mappings:2itx.A&PDB-ENSP_mappings:2ity.A&PDB-ENSP_mappings:2itz.A&PDB-ENSP_mappings:2j5e.A&PDB-ENSP_mappings:2j5f.A&PDB-ENSP_mappings:2j6m.A&PDB-ENSP_mappings:2jit.A&PDB-ENSP_mappings:2jit.B&PDB-ENSP_mappings:2jiu.A&PDB-ENSP_mappings:2jiu.B&PDB-ENSP_mappings:2jiv.A&PDB-ENSP_mappings:2jiv.B&PDB-ENSP_mappings:2rf9.A&PDB-ENSP_mappings:2rf9.B&PDB-ENSP_mappings:2rfd.A&PDB-ENSP_mappings:2rfd.B&PDB-ENSP_mappings:2rfe.A&PDB-ENSP_mappings:2rfe.B&PDB-ENSP_mappings:2rfe.C&PDB-ENSP_mappings:2rfe.D&PDB-ENSP_mappings:2rgp.A&PDB-ENSP_mappings:3bel.A&PDB-ENSP_mappings:3gop.A&PDB-ENSP_mappings:3gt8.A&PDB-ENSP_mappings:3gt8.B&PDB-ENSP_mappings:3gt8.C&PDB-ENSP_mappings:3gt8.D&PDB-ENSP_mappings:3ika.A&PDB-ENSP_mappings:3ika.B&PDB-ENSP_mappings:3lzb.A&PDB-ENSP_mappings:3lzb.B&PDB-ENSP_mappings:3lzb.C&PDB-ENSP_mappings:3lzb.D&PDB-ENSP_mappings:3lzb.E&PDB-ENSP_mappings:3lzb.F&PDB-ENSP_mappings:3lzb.G&PDB-ENSP_mappings:3lzb.H&PDB-ENSP_mappings:3poz.A&PDB-ENSP_mappings:3ug1.A&PDB-ENSP_mappings:3ug2.A&PDB-ENSP_mappings:3vjn.A&PDB-ENSP_mappings:3vjo.A&PDB-ENSP_mappings:3w2o.A&PDB-ENSP_mappings:3w2p.A&PDB-ENSP_mappings:3w2q.A&PDB-ENSP_mappings:3w2r.A&PDB-ENSP_mappings:3w2s.A&PDB-ENSP_mappings:3w32.A&PDB-ENSP_mappings:3w33.A&PDB-ENSP_mappings:4g5j.A&PDB-ENSP_mappings:4g5p.A&PDB-ENSP_mappings:4g5p.B&PDB-ENSP_mappings:4hjo.A&PDB-ENSP_mappings:4i1z.A&PDB-ENSP_mappings:4i20.A&PDB-ENSP_mappings:4i21.A&PDB-ENSP_mappings:4i21.B&PDB-ENSP_mappings:4i22.A&PDB-ENSP_mappings:4i23.A&PDB-ENSP_mappings:4i24.A&PDB-ENSP_mappings:4i24.B&PDB-ENSP_mappings:4jq7.A&PDB-ENSP_mappings:4jq8.A&PDB-ENSP_mappings:4jr3.A&PDB-ENSP_mappings:4jrv.A&PDB-ENSP_mappings:4li5.A&PDB-ENSP_mappings:4ll0.A&PDB-ENSP_mappings:4ll0.B&PDB-ENSP_mappings:4lqm.A&PDB-ENSP_mappings:4lrm.A&PDB-ENSP_mappings:4lrm.B&PDB-ENSP_mappings:4lrm.C&PDB-ENSP_mappings:4lrm.D&PDB-ENSP_mappings:4lrm.E&PDB-ENSP_mappings:4r3p.A&PDB-ENSP_mappings:4r3r.A&PDB-ENSP_mappings:4r5s.A&PDB-ENSP_mappings:4riw.B&PDB-ENSP_mappings:4riw.D&PDB-ENSP_mappings:4rix.B&PDB-ENSP_mappings:4rix.D&PDB-ENSP_mappings:4riy.B&PDB-ENSP_mappings:4riy.D&PDB-ENSP_mappings:4rj4.A&PDB-ENSP_mappings:4rj5.A&PDB-ENSP_mappings:4rj6.A&PDB-ENSP_mappings:4rj7.A&PDB-ENSP_mappings:4rj8.A&PDB-ENSP_mappings:4tks.A&PDB-ENSP_mappings:4wd5.A&PDB-ENSP_mappings:4wd5.B&PDB-ENSP_mappings:4wkq.A&PDB-ENSP_mappings:4wrg.A&PDB-ENSP_mappings:4zau.A&PDB-ENSP_mappings:4zjv.A&PDB-ENSP_mappings:4zjv.B&PDB-ENSP_mappings:4zse.A&PDB-ENSP_mappings:4zse.B&PDB-ENSP_mappings:4zse.C&PDB-ENSP_mappings:4zse.D&PDB-ENSP_mappings:5c8k.A&PDB-ENSP_mappings:5c8m.A&PDB-ENSP_mappings:5c8n.A&PDB-ENSP_mappings:5cal.A&PDB-ENSP_mappings:5can.A&PDB-ENSP_mappings:5cao.A&PDB-ENSP_mappings:5cap.A&PDB-ENSP_mappings:5caq.A&PDB-ENSP_mappings:5cas.A&PDB-ENSP_mappings:5cau.A&PDB-ENSP_mappings:5cav.A&PDB-ENSP_mappings:5cnn.A&PDB-ENSP_mappings:5cnn.B&PDB-ENSP_mappings:5cno.A&PDB-ENSP_mappings:5cno.B&PDB-ENSP_mappings:5cno.X&PDB-ENSP_mappings:5czh.A&PDB-ENSP_mappings:5czi.A&PDB-ENSP_mappings:5d41.A&PDB-ENSP_mappings:5d41.B&PDB-ENSP_mappings:5edp.A&PDB-ENSP_mappings:5edq.A&PDB-ENSP_mappings:5edr.A&PDB-ENSP_mappings:5em5.A&PDB-ENSP_mappings:5em6.A&PDB-ENSP_mappings:5em7.A&PDB-ENSP_mappings:5em8.A&PDB-ENSP_mappings:5fed.A&PDB-ENSP_mappings:5fee.A&PDB-ENSP_mappings:5feq.A&PDB-ENSP_mappings:5gmp.A&PDB-ENSP_mappings:5gnk.A&PDB-ENSP_mappings:5gty.A&PDB-ENSP_mappings:5gty.B&PDB-ENSP_mappings:5gty.C&PDB-ENSP_mappings:5gty.D&PDB-ENSP_mappings:5gty.E&PDB-ENSP_mappings:5gty.F&PDB-ENSP_mappings:5gty.G&PDB-ENSP_mappings:5gty.H&PDB-ENSP_mappings:5gtz.A&PDB-ENSP_mappings:5hcx.A&PDB-ENSP_mappings:5hcy.A&PDB-ENSP_mappings:5hcz.A&PDB-ENSP_mappings:5hg5.A&PDB-ENSP_mappings:5hg7.A&PDB-ENSP_mappings:5hg8.A&PDB-ENSP_mappings:5hg9.A&PDB-ENSP_mappings:5hib.A&PDB-ENSP_mappings:5hic.A&PDB-ENSP_mappings:5j9y.A&PDB-ENSP_mappings:5j9z.A&PDB-ENSP_mappings:5jeb.A&PDB-ENSP_mappings:5u8l.A&PDB-ENSP_mappings:5ug8.A&PDB-ENSP_mappings:5ug9.A&PDB-ENSP_mappings:5uga.A&PDB-ENSP_mappings:5ugb.A&PDB-ENSP_mappings:5ugc.A&PDB-ENSP_mappings:5uwd.A&PDB-ENSP_mappings:5x26.A&PDB-ENSP_mappings:5x27.A&PDB-ENSP_mappings:5x28.A&PDB-ENSP_mappings:5x2a.A&PDB-ENSP_mappings:5x2a.B&PDB-ENSP_mappings:5x2a.C&PDB-ENSP_mappings:5x2a.D&PDB-ENSP_mappings:5x2c.A&PDB-ENSP_mappings:5x2c.B&PDB-ENSP_mappings:5x2f.A&PDB-ENSP_mappings:5x2f.B&PDB-ENSP_mappings:5x2f.C&PDB-ENSP_mappings:5x2f.D&PDB-ENSP_mappings:5x2k.A&PDB-ENSP_mappings:5xdk.A&PDB-ENSP_mappings:5xdl.A&PDB-ENSP_mappings:5xgm.A&PDB-ENSP_mappings:5xgn.A&PDB-ENSP_mappings:5xgn.B&PDB-ENSP_mappings:5y25.A&PDB-ENSP_mappings:5y9t.A&PDB-ENSP_mappings:5yu9.A&PDB-ENSP_mappings:5yu9.B&PDB-ENSP_mappings:5yu9.C&PDB-ENSP_mappings:5yu9.D&PDB-ENSP_mappings:5zto.A&PDB-ENSP_mappings:5zwj.A&PDB-ENSP_mappings:6d8e.A&PDB-ENSP_mappings:6duk.A&PDB-ENSP_mappings:6duk.B&PDB-ENSP_mappings:6duk.C&PDB-ENSP_mappings:6duk.D&PDB-ENSP_mappings:6duk.E&PDB-ENSP_mappings:6duk.F&PDB-ENSP_mappings:6jrj.A&PDB-ENSP_mappings:6jrk.A&PDB-ENSP_mappings:6jrx.A&PDB-ENSP_mappings:6jwl.A&PDB-ENSP_mappings:6jx0.A&PDB-ENSP_mappings:6jx4.A&PDB-ENSP_mappings:6jxt.A&PDB-ENSP_mappings:6jz0.A&PDB-ENSP_mappings:6lub.A&PDB-ENSP_mappings:6lud.A&PDB-ENSP_mappings:6p1d.A&PDB-ENSP_mappings:6p1d.B&PDB-ENSP_mappings:6p1d.C&PDB-ENSP_mappings:6p1d.D&PDB-ENSP_mappings:6p1l.A&PDB-ENSP_mappings:6p1l.B&PDB-ENSP_mappings:6p1l.C&PDB-ENSP_mappings:6p1l.D&PDB-ENSP_mappings:6p8q.A&PDB-ENSP_mappings:6p8q.B&PDB-ENSP_mappings:6p8q.C&PDB-ENSP_mappings:6p8q.D&PDB-ENSP_mappings:6s89.A&PDB-ENSP_mappings:6s8a.A&PDB-ENSP_mappings:6s9b.A&PDB-ENSP_mappings:6s9c.A&PDB-ENSP_mappings:6s9d.A&PDB-ENSP_mappings:6tfu.A&PDB-ENSP_mappings:6tfu.B&PDB-ENSP_mappings:6tfv.A&PDB-ENSP_mappings:6tfv.B&PDB-ENSP_mappings:6tfw.A&PDB-ENSP_mappings:6tfw.B&PDB-ENSP_mappings:6tfy.A&PDB-ENSP_mappings:6tfy.B&PDB-ENSP_mappings:6tfz.A&PDB-ENSP_mappings:6tfz.B&PDB-ENSP_mappings:6tg0.A&PDB-ENSP_mappings:6tg0.B&PDB-ENSP_mappings:6tg1.A&PDB-ENSP_mappings:6tg1.B&PDB-ENSP_mappings:6v5n.A&PDB-ENSP_mappings:6v5n.B&PDB-ENSP_mappings:6v5n.C&PDB-ENSP_mappings:6v5n.D&PDB-ENSP_mappings:6v5p.A&PDB-ENSP_mappings:6v5p.B&PDB-ENSP_mappings:6v5p.C&PDB-ENSP_mappings:6v5p.D&PDB-ENSP_mappings:6v66.A&PDB-ENSP_mappings:6v66.B&PDB-ENSP_mappings:6v66.C&PDB-ENSP_mappings:6v66.D&PDB-ENSP_mappings:6v6k.A&PDB-ENSP_mappings:6v6k.B&PDB-ENSP_mappings:6v6k.C&PDB-ENSP_mappings:6v6k.D&PDB-ENSP_mappings:6v6k.E&PDB-ENSP_mappings:6v6k.F&PDB-ENSP_mappings:6v6k.G&PDB-ENSP_mappings:6v6k.H&PDB-ENSP_mappings:6v6o.A&PDB-ENSP_mappings:6v6o.B&PDB-ENSP_mappings:6v6o.C&PDB-ENSP_mappings:6v6o.D&PDB-ENSP_mappings:6v6o.E&PDB-ENSP_mappings:6v6o.F&PDB-ENSP_mappings:6v6o.G&PDB-ENSP_mappings:6v6o.H&PDB-ENSP_mappings:6vh4.A&PDB-ENSP_mappings:6vhn.A&PDB-ENSP_mappings:6vhp.A&PDB-ENSP_mappings:6wa2.A&PDB-ENSP_mappings:6wa2.B&PDB-ENSP_mappings:6wa2.C&PDB-ENSP_mappings:6wa2.D&PDB-ENSP_mappings:6wak.A&PDB-ENSP_mappings:6wak.B&PDB-ENSP_mappings:6wak.C&PDB-ENSP_mappings:6wak.D&PDB-ENSP_mappings:6wxn.A&PDB-ENSP_mappings:6wxn.B&PDB-ENSP_mappings:6wxn.C&PDB-ENSP_mappings:6wxn.D&PDB-ENSP_mappings:6xl4.A&PDB-ENSP_mappings:6xl4.B&PDB-ENSP_mappings:6xl4.C&PDB-ENSP_mappings:6xl4.D&PDB-ENSP_mappings:6z4b.A&PDB-ENSP_mappings:6z4b.B&PDB-ENSP_mappings:6z4d.A&PDB-ENSP_mappings:6z4d.B&PDB-ENSP_mappings:7a2a.A&PDB-ENSP_mappings:7a2a.B&PDB-ENSP_mappings:7a6i.A&PDB-ENSP_mappings:7a6j.A&PDB-ENSP_mappings:7a6j.B&PDB-ENSP_mappings:7a6k.A&PDB-ENSP_mappings:7a6k.B&PDB-ENSP_mappings:7a6k.C&PDB-ENSP_mappings:7a6k.D&PDB-ENSP_mappings:7aei.A&PDB-ENSP_mappings:7aem.A&PDB-ENSP_mappings:7b85.A&PDB-ENSP_mappings:7er2.A&PDB-ENSP_mappings:7jxi.A&PDB-ENSP_mappings:7jxi.B&PDB-ENSP_mappings:7jxi.C&PDB-ENSP_mappings:7jxi.D&PDB-ENSP_mappings:7jxk.A&PDB-ENSP_mappings:7jxk.B&PDB-ENSP_mappings:7jxk.C&PDB-ENSP_mappings:7jxk.D&PDB-ENSP_mappings:7jxk.E&PDB-ENSP_mappings:7jxk.F&PDB-ENSP_mappings:7jxl.A&PDB-ENSP_mappings:7jxl.B&PDB-ENSP_mappings:7jxl.C&PDB-ENSP_mappings:7jxl.D&PDB-ENSP_mappings:7jxm.A&PDB-ENSP_mappings:7jxm.B&PDB-ENSP_mappings:7jxm.C&PDB-ENSP_mappings:7jxm.D&PDB-ENSP_mappings:7jxp.A&PDB-ENSP_mappings:7jxp.B&PDB-ENSP_mappings:7jxp.C&PDB-ENSP_mappings:7jxp.D&PDB-ENSP_mappings:7jxp.E&PDB-ENSP_mappings:7jxp.F&PDB-ENSP_mappings:7jxq.A&PDB-ENSP_mappings:7jxq.B&PDB-ENSP_mappings:7jxq.C&PDB-ENSP_mappings:7jxq.D&PDB-ENSP_mappings:7jxw.A&PDB-ENSP_mappings:7jxw.B&PDB-ENSP_mappings:7jxw.C&PDB-ENSP_mappings:7jxw.D&PDB-ENSP_mappings:7k1h.A&PDB-ENSP_mappings:7k1h.B&PDB-ENSP_mappings:7k1h.C&PDB-ENSP_mappings:7k1h.D&PDB-ENSP_mappings:7k1h.E&PDB-ENSP_mappings:7k1h.F&PDB-ENSP_mappings:7k1i.A&PDB-ENSP_mappings:7kxz.A&PDB-ENSP_mappings:7ky0.A&PDB-ENSP_mappings:7ky0.B&PDB-ENSP_mappings:7ky0.C&PDB-ENSP_mappings:7ky0.D&PDB-ENSP_mappings:7lg8.A&PDB-ENSP_mappings:7lg8.B&PDB-ENSP_mappings:7lg8.C&PDB-ENSP_mappings:7lg8.D&PDB-ENSP_mappings:7lgs.A&PDB-ENSP_mappings:7lgs.B&PDB-ENSP_mappings:7lgs.C&PDB-ENSP_mappings:7lgs.D&PDB-ENSP_mappings:7ltx.A&PDB-ENSP_mappings:7ltx.B&PDB-ENSP_mappings:7ltx.C&PDB-ENSP_mappings:7ltx.D&PDB-ENSP_mappings:7oxb.A&PDB-ENSP_mappings:7si1.A&PDB-ENSP_mappings:7syd.A&PDB-ENSP_mappings:7syd.B&PDB-ENSP_mappings:7sye.A&PDB-ENSP_mappings:7sye.B&PDB-ENSP_mappings:7sz0.A&PDB-ENSP_mappings:7sz0.B&PDB-ENSP_mappings:7sz1.A&PDB-ENSP_mappings:7sz1.B&PDB-ENSP_mappings:7sz5.A&PDB-ENSP_mappings:7sz5.B&PDB-ENSP_mappings:7sz7.A&PDB-ENSP_mappings:7sz7.B&PDB-ENSP_mappings:7t4i.A&PDB-ENSP_mappings:7t4j.A&PDB-ENSP_mappings:7t4j.B&PDB-ENSP_mappings:7tvd.A&PDB-ENSP_mappings:7u98.A&PDB-ENSP_mappings:7u98.B&PDB-ENSP_mappings:7u98.C&PDB-ENSP_mappings:7u98.D&PDB-ENSP_mappings:7u99.A&PDB-ENSP_mappings:7u9a.A&PDB-ENSP_mappings:7ukv.A&PDB-ENSP_mappings:7ukw.A&PDB-ENSP_mappings:7ukw.B&PDB-ENSP_mappings:7ukw.C&PDB-ENSP_mappings:7ukw.D&PDB-ENSP_mappings:7vra.A&PDB-ENSP_mappings:7vre.A&PDB-ENSP_mappings:7zym.A&PDB-ENSP_mappings:7zyn.A&PDB-ENSP_mappings:7zyp.A&PDB-ENSP_mappings:7zyq.A&PDB-ENSP_mappings:7zyq.B&PDB-ENSP_mappings:8a27.A&PDB-ENSP_mappings:8a2a.A&PDB-ENSP_mappings:8a2b.A&PDB-ENSP_mappings:8a2d.A&PDB-ENSP_mappings:8d73.A&PDB-ENSP_mappings:8d73.B&PDB-ENSP_mappings:8d76.A&PDB-ENSP_mappings:8d76.B&PDB-ENSP_mappings:8dsw.A&PDB-ENSP_mappings:8eme.A&PDB-ENSP_mappings:8eme.B&PDB-ENSP_mappings:8f1h.A&PDB-ENSP_mappings:8f1w.A&PDB-ENSP_mappings:8f1w.B&PDB-ENSP_mappings:8f1w.C&PDB-ENSP_mappings:8f1w.D&PDB-ENSP_mappings:8f1x.A&PDB-ENSP_mappings:8f1y.A&PDB-ENSP_mappings:8f1z.A&PDB-ENSP_mappings:8fv3.A&PDB-ENSP_mappings:8fv3.B&PDB-ENSP_mappings:8fv3.C&PDB-ENSP_mappings:8fv3.D&PDB-ENSP_mappings:8fv4.A&PDB-ENSP_mappings:8fv4.B&PDB-ENSP_mappings:8fv4.C&PDB-ENSP_mappings:8fv4.D&PDB-ENSP_mappings:8g63.A&PDB-ENSP_mappings:8gb4.A&PDB-ENSP_mappings:8gb4.B&PDB-ENSP_mappings:8gb4.C&PDB-ENSP_mappings:8gb4.D&PDB-ENSP_mappings:8gk5.A&PDB-ENSP_mappings:8gk5.B&PDB-ENSP_mappings:8gk5.C&PDB-ENSP_mappings:8gk5.D&PDB-ENSP_mappings:8h7x.A&PDB-ENSP_mappings:8h7x.B&PDB-ENSP_mappings:8hv1.A&PDB-ENSP_mappings:8hv2.A&PDB-ENSP_mappings:8hv3.A&PDB-ENSP_mappings:8hv4.A&PDB-ENSP_mappings:8hv5.A&PDB-ENSP_mappings:8hv6.A&PDB-ENSP_mappings:8hv7.A&PDB-ENSP_mappings:8hv8.A&PDB-ENSP_mappings:8hv9.A&PDB-ENSP_mappings:8hva.A&PDB-ENSP_mappings:8hy7.A&PDB-ENSP_mappings:8kfq.A&PDB-ENSP_mappings:8pnz.A&PDB-ENSP_mappings:8po0.A&PDB-ENSP_mappings:8po1.A&PDB-ENSP_mappings:8po2.A&PDB-ENSP_mappings:8po2.B&PDB-ENSP_mappings:8po2.D&PDB-ENSP_mappings:8po3.A&PDB-ENSP_mappings:8po4.A&PDB-ENSP_mappings:8po4.B&PDB-ENSP_mappings:8sc7.A&PDB-ENSP_mappings:8tjl.A&PDB-ENSP_mappings:8to3.A&PDB-ENSP_mappings:8to3.B&PDB-ENSP_mappings:8to3.C&PDB-ENSP_mappings:8to3.D&PDB-ENSP_mappings:8to4.A&PDB-ENSP_mappings:8to4.B&PDB-ENSP_mappings:8to4.C&PDB-ENSP_mappings:8to4.D&PDB-ENSP_mappings:8wd4.A&Transmembrane_helices:TMhelix&SMART:SM00219&Superfamily:SSF56112&CDD:cd05108&PANTHER:PTHR24416&PROSITE_profiles:PS50011&Phobius:CYTOPLASMIC_DOMAIN&Prints:PR00109&Pfam:PF07714&Gene3D:3.30.200.20&PIRSF:PIRSF000619&AFDB-ENSP_mappings:AF-P00533-F12.987e-052.236e-0500006.295e-06007.237e-050000005.879e-0500drug_response&pathogenic&pathogenic/likely_pathogenic&likely_pathogenic&protective0&1&11&1&122992668&25157968&28158543&21430269&20068085&15118073&15118125&15329413&23102728&15901872&22215752&11423618&15272417&15728811&15737014&16258541&17020982&17085664&17332364&17510392&18093943&18227510&18596266&18981003&18992959&19096324&19381876&19589612&20033049&20129249&21194487&21233402&21248300&21252721&21531810&21921847&22452896&22588155&23540867&23816963&24065731&24202392&24453288&24478319&24623981&24636847&24658966&24729716&24736066&24736080&24893891&25668228&25923549&25923550&26515464&26720284&27074804&25477325&36388934&36164570&37425402&38431735FAIL5-7-27EGFR166130.0000431652.&MONDO:MONDO:0008903&MedGen:C0242379&OMIM:211980&MONDO:MONDO:0014481&MedGen:C4015130&OMIM:616069&Orphanet:294023&MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MedGen:C3661900&MedGen:CN130014&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&Human_Phenotype_Ontology:HP:0030078&MONDO:MONDO:0005061&MeSH:D000077192&MedGen:C0152013&MedGen:CN225347&MedGen:CN322733&MedGen:CN322731SCV000268172&SCV002031219single_nucleotide_variantSO:0001483ClinGen:CA090928&ClinPGx_Clinical_Annotation:981475450&Genetic_Testing_Registry_(GTR):GTR000575663&OMIM:131550.0006&UniProtKB:P00533#VAR_026098EGFR:1956&EGFR-AS1:100507500SO:0001583&missense_variant&SO:0001619&non-coding_transcript_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV0050941351214345697:55181378-55181378EGFRp.T790MFalseThe EGFR exon 20 T790M mutation occurs in the EGFR tyrosine kinase domain and is considered a "gatekeeper" mutation. This mutation is found in non-small cell lung cancer (PMID: 15737014). Studies show that this mutation is oncogenic and increases the affinity of EGFR for ATP (PMID: 18227510). EGFR T790M generally occurs as an acquired secondary mutation upon prolonged exposure to first- and second-generation EGFR tyrosine kinase inhibitors (TKIs) such as erlotinib, gefinitib or afatinib, and is recognized by the NCCN to confer clinical resistance to these inhibitors (PMID: 15728811, 15737014, 18227510). The third-generation EGFR TKI, osimertinib, is associated with clinical benefit in patients with the EGFR T790M mutation and is FDA-approved for patients with EGFR T790M-mutant non-small cell lung cancer (PMID: 29151359). Preclinical models with EGFR exon 19 deletion and the T790M and L792H mutations show resistance to first-, second-, and third-generation EGFR inhibitors, and moderate sensitivity to PKC and ALK inhibitors (PMID: 34526717).EGFR, a receptor tyrosine kinase, is altered by amplification and/or mutation in lung and brain cancers among others.15737014|29151359|15728811|34526717|18227510T790M1956EGFRGRCh38.MUTATION.The EGFR T790M mutation is known to be oncogenic.FalseLEVEL_Fda2The EGFR exon 20 T790M mutation occurs in the EGFR tyrosine kinase domain and is considered a "gatekeeper" mutation. This mutation is found in non-small cell lung cancer (PMID: 15737014). Studies show that this mutation is oncogenic and increases the affinity of EGFR for ATP (PMID: 18227510). EGFR T790M generally occurs as an acquired secondary mutation upon prolonged exposure to first- and second-generation EGFR tyrosine kinase inhibitors (TKIs) such as erlotinib, gefinitib or afatinib, and is recognized by the NCCN to confer clinical resistance to these inhibitors (PMID: 15728811, 15737014, 18227510). The third-generation EGFR TKI, osimertinib, is associated with clinical benefit in patients with the EGFR T790M mutation and is FDA-approved for patients with EGFR T790M-mutant non-small cell lung cancer (PMID: 29151359). Preclinical models with EGFR exon 19 deletion and the T790M and L792H mutations show resistance to first-, second-, and third-generation EGFR inhibitors, and moderate sensitivity to PKC and ALK inhibitors (PMID: 34526717).['15737014', '29151359', '15728811', '34526717', '18227510']ErlotinibLEVEL_R1LEVEL_Fda2['24478319', '26051236', '23816963']Erlotinib, gefitinib and afatinib are first- and second-generation EGFR tyrosine kinase inhibitors (TKIs), respectively. Responses to first- and second-generation switch TKIs at the time of T790M-mediated acquired resistance is uncommon. Two patients with EGFR T790M mutant acquired resistance to erlotinib/gefitinib were treated with afatinib in LUX-Lung 4: both achieved stable disease, one for nine months and the other for one month (PMID: 23816963). Resistance to standard EGFR TKIs is typical in patients with de novo EGFR T790M mutations, although responses are uncommonly reported. In one series, only one of thirteen (8%, 95% CI=0-35%) patients with de novo EGFR T790M mutant lung cancers had an objective response to erlotinib (PMID: 24478319). In another series of four patients with de novo EGFR T790M mutant lung cancers, no responses were seen. Responses were seen in two of fourteen patients (14%) with de novo EGFR T790M treated with afatinib, with individual responses lasting four and twelve months, respectively (PMID: 26051236) (Abstract: Yang et al. Abstract# O03.05, IASLC 2013. http://library.iaslc.org/search-speaker?search_speaker=17991).Non-Small Cell Lung CancerSOLIDLungGefitinibLEVEL_R1LEVEL_Fda2['24478319', '26051236', '23816963']Erlotinib, gefitinib and afatinib are first- and second-generation EGFR tyrosine kinase inhibitors (TKIs), respectively. Responses to first- and second-generation switch TKIs at the time of T790M-mediated acquired resistance is uncommon. Two patients with EGFR T790M mutant acquired resistance to erlotinib/gefitinib were treated with afatinib in LUX-Lung 4: both achieved stable disease, one for nine months and the other for one month (PMID: 23816963). Resistance to standard EGFR TKIs is typical in patients with de novo EGFR T790M mutations, although responses are uncommonly reported. In one series, only one of thirteen (8%, 95% CI=0-35%) patients with de novo EGFR T790M mutant lung cancers had an objective response to erlotinib (PMID: 24478319). In another series of four patients with de novo EGFR T790M mutant lung cancers, no responses were seen. Responses were seen in two of fourteen patients (14%) with de novo EGFR T790M treated with afatinib, with individual responses lasting four and twelve months, respectively (PMID: 26051236) (Abstract: Yang et al. Abstract# O03.05, IASLC 2013. http://library.iaslc.org/search-speaker?search_speaker=17991).Non-Small Cell Lung CancerSOLIDLungAfatinibLEVEL_R1LEVEL_Fda2['24478319', '26051236', '23816963']Erlotinib, gefitinib and afatinib are first- and second-generation EGFR tyrosine kinase inhibitors (TKIs), respectively. Responses to first- and second-generation switch TKIs at the time of T790M-mediated acquired resistance is uncommon. Two patients with EGFR T790M mutant acquired resistance to erlotinib/gefitinib were treated with afatinib in LUX-Lung 4: both achieved stable disease, one for nine months and the other for one month (PMID: 23816963). Resistance to standard EGFR TKIs is typical in patients with de novo EGFR T790M mutations, although responses are uncommonly reported. In one series, only one of thirteen (8%, 95% CI=0-35%) patients with de novo EGFR T790M mutant lung cancers had an objective response to erlotinib (PMID: 24478319). In another series of four patients with de novo EGFR T790M mutant lung cancers, no responses were seen. Responses were seen in two of fourteen patients (14%) with de novo EGFR T790M treated with afatinib, with individual responses lasting four and twelve months, respectively (PMID: 26051236) (Abstract: Yang et al. Abstract# O03.05, IASLC 2013. http://library.iaslc.org/search-speaker?search_speaker=17991).Non-Small Cell Lung CancerSOLIDLungDatopotamab DeruxtecanLEVEL_1LEVEL_Fda2['39761483', '39250535']Datopotamab deruxtecan (Dato-DXd) is an intravenously infused, TROP2-directed antibody drug conjugate that is FDA-approved for the treatment of patients with EGFR-mutated non-small cell lung cancer (NSCLC) who have received prior EGFR-directed therapy and platinum-based chemotherapy. FDA approval is based on the results of the Phase II TROPION-Lung05 (NCT04484142) and Phase III TROPION-Lung01 (NCT04656652) trials of Dato-DXd in patients with previously treated EGFR-mutated NSCLC._In the Phase II TROPION-Lung05 (NCT04484142) trial of Dato-DXd in patients with NSCLC harboring actionable alterations progressing on or after targeted therapy and platinum-based chemotherapy, patients with EGFR-mutated NSCLC (n=78 [exon 19 deletion: 41 (29.9%), exon 20 T790M: 26 (19.0%), exon 21 L858R: 25 (18.2%), exon 18 G719: 5 (3.6%), exon 21 L861Q: 3 (2.2%), exon 20 insertion: 2 (1.5%)]) demonstrated an overall response rate (ORR) of 43.6% (95% CI=32.4-55.3), with a 5.1% (n=4) complete response (CR) rate, 38.5% (n=30) partial response (PR) rate and 34.6% (n=27) stable disease (SD) rate, a disease control rate (DCR) of 82.1% (95% CI=71.7-89.8), a median duration of response (DOR) of 7.0 months (95% CI=4.2-10.2) and a median progression-free survival (PFS) of 5.8 months (95% CI=5.4-8.3) (PMID: 39761483)._In the Phase III TROPION-Lung01 (NCT04656652) trial of Dato-DXd versus docetaxel in patients with pretreated NSCLC, patients treated with Dato-DXd (n=299 [EGFR mutations: 39 (13.0%)]) demonstrated an ORR of 26.4% (95% CI= 21.5-31.8), with a 1.3% (n=4) CR rate, 25.1% (n=75) PR rate and 49.8% (n=149) SD rate, a DCR of 77.3% (95% CI=72.1-81.9), a median DOR of 7.1 months (95% CI=5.6-10.9), a median PFS of 4.4 months (95% CI=4.2-5.6) and a median overall survival (OS) of 12.9 months (95% CI=11.0-13.9) (PMID: 39250535). Patients treated with docetaxel (n=305 [EGFR mutations: 45 (14.8%)]) demonstrated an ORR of 12.8% (95% CI=9.3-17.1), with a 12.8% (n=39) PR rate and 50.2% (n=153) SD rate, a DCR of 64.9% (95% CI=59.3-70.3), a median DOR of 5.6 months (95% CI=5.4-8.1), a median PFS of 3.7 months (95% CI=2.9-4.2) (HR=0.75 [95% CI=0.62-0.91], p=.004) and a median OS of 11.8 months (95% CI=10.1-12.8) (HR=0.94 [95% CI=0.78-1.14], p=0.530) (PMID: 39250535).Non-Small Cell Lung CancerSOLIDLungOsimertinibLEVEL_1LEVEL_Fda2['32861806', '27959700']Osimertinib is an orally available, small molecule third-generation EGFR T790M tyrosine kinase inhibitor (TKI) that is FDA-approved for the treatment of adult patients with metastatic EGFR T790M mutation-positive non-small cell lung cancer (NSCLC), as detected by an FDA-approved test, whose disease has progressed on or after EGFR TKI therapy. EGFR T790M mutations for treatment with osimertinib were detected by the cobas EGFR Mutation Test v2, FoundationOne CDx, FoundationOne Liquid CDx or Guardant360 CDx. FDA approval was based on the results of the Phase III AURA3 (NCT02151981) trial of osimertinib versus platinum-based doublet chemotherapy in 419 patients with EGFR T790M-positive advanced NSCLC, who had disease progression after first-line EGFR TKI therapy. In the Phase III AURA3 (NCT02151981) trial, the osimertinib cohort (n=279) demonstrated an objective response rate (ORR) of 71% (95% CI=65-76), with a 1% (n=4) complete response (CR) rate, 69% (n=193) partial response (PR) rate and 23% (n=63) stable disease (SD) rate, a median progression-free survival (PFS) of 10.1 months (95% CI=8.3-12.3), a median overall survival (OS) of 26.8 months (95% CI=23.5-31.5) and a median duration of response (DOR) of 9.7 months (95% CI=8.3-11.6). In contrast, the platinum-pemetrexed cohort (n=140) demonstrated an ORR of 31% (95% CI=24-40), with a 1% (n=2) CR rate, 30% (n=42) PR rate and 43% (n=60) SD rate, a median PFS of 4.4 months (95% CI=4.2-5.6) (HR=0.30 [95% CI=0.23-0.41], p<0.001), a median OS of 22.5 months (95% CI=20.2-28.8) (HR=0.87 [95% CI=0.67-1.12], p=0.277) and a median DOR of 4.2 (95% CI=3.0-5.9) (PMID: 27959700, 32861806).Non-Small Cell Lung CancerSOLIDLung15737014;29151359;15728811;34526717;1822751024478319;26051236;23816963;Yang et al. Abstract# O03.05, IASLC 2013.(http://library.iaslc.org/search-speaker?search_speaker=17991);39761483;39250535;32861806;2795970095Tmissense_variantEGFR1956GeneENST00000275493.2NM_005228.4:c.2369C>TNP_005219.2:p.Thr790Met34THR790MET/RS121434569https://civicdb.org/links/variants/34EGFR_T790M34ENST00000275493.2:c.2369C>T/NC_000007.13:g.55249071C>T/NM_005228.4:c.2369C>T/NP_005219.2:p.Thr790MetCA09092816613
TUMORp.L858RENSP00000275493.2:p.Leu858Argchr755191822TGPASSNM_005228missense_variantMODERATEEGFR21/28c.2573T>Grs121434568&COSV51765161&COSV51854030SNVdeleterious_low_confidence(0)probably_damaging(0.997)0.000.000.000.010.9614.7500e-01Hereditary_cancer-predisposing_syndrome&Lung_carcinoma&Nonsmall_cell_lung_cancer&_response_to_tyrosine_kinase_inhibitor_in&_somatic&Adenocarcinoma_of_lung&_response_to_tyrosine_kinase_inhibitor_in&_somatic&Lung_adenocarcinoma&Tyrosine_kinase_inhibitor_response&gefitinib_response_-_EfficacyNC_000007.14:g.55191822T>Greviewed_by_expert_paneldrug_responseOncogeniccriteria_provided&_single_submitter3criteria_provided&_multiple_submittersTier_I_-_StrongEGFRL858Rchr7:55191822-55191822v7.0.LEVEL_Fda2✓ Hotspot07/07/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAfatinib,Amivantamab+Chemotherapy,Amivantamab+Lazertinib,Dacomitinib,Datopotamab Deruxtecan,Erlotinib,Gefitinib,Osimertinib,Osimertinib+Chemotherapy,Erlotinib+RamucirumabPatritumab DeruxtecanLEVEL_1LEVEL_165,400/1L858R0.38095238095238093GRCh38EGFRTTG55191822EGFR_L858R.GT:AD:AF:DP0/1:65,40:0.38:105GENSG00000146648TranscriptENST00000275493protein_coding28342573858L/RcTg/cGg1HGNCHGNC:3236YESMANE_SelectNM_005228.51P1CCDS5514.1ENSP00000275493P00533.293UPI000003E750P00533-1Ensembl1PDB-ENSP_mappings:1m14.A&PDB-ENSP_mappings:1m17.A&PDB-ENSP_mappings:1xkk.A&PDB-ENSP_mappings:2eb2.A&PDB-ENSP_mappings:2eb3.A&PDB-ENSP_mappings:2gs2.A&PDB-ENSP_mappings:2gs6.A&PDB-ENSP_mappings:2gs7.A&PDB-ENSP_mappings:2gs7.B&PDB-ENSP_mappings:2itn.A&PDB-ENSP_mappings:2ito.A&PDB-ENSP_mappings:2itp.A&PDB-ENSP_mappings:2itq.A&PDB-ENSP_mappings:2itt.A&PDB-ENSP_mappings:2itu.A&PDB-ENSP_mappings:2itv.A&PDB-ENSP_mappings:2itw.A&PDB-ENSP_mappings:2itx.A&PDB-ENSP_mappings:2ity.A&PDB-ENSP_mappings:2itz.A&PDB-ENSP_mappings:2j5e.A&PDB-ENSP_mappings:2j5f.A&PDB-ENSP_mappings:2j6m.A&PDB-ENSP_mappings:2jit.A&PDB-ENSP_mappings:2jit.B&PDB-ENSP_mappings:2jiu.A&PDB-ENSP_mappings:2jiu.B&PDB-ENSP_mappings:2jiv.A&PDB-ENSP_mappings:2jiv.B&PDB-ENSP_mappings:2rf9.A&PDB-ENSP_mappings:2rf9.B&PDB-ENSP_mappings:2rfd.A&PDB-ENSP_mappings:2rfd.B&PDB-ENSP_mappings:2rfe.A&PDB-ENSP_mappings:2rfe.B&PDB-ENSP_mappings:2rfe.C&PDB-ENSP_mappings:2rfe.D&PDB-ENSP_mappings:2rgp.A&PDB-ENSP_mappings:3bel.A&PDB-ENSP_mappings:3gop.A&PDB-ENSP_mappings:3gt8.A&PDB-ENSP_mappings:3gt8.B&PDB-ENSP_mappings:3gt8.C&PDB-ENSP_mappings:3gt8.D&PDB-ENSP_mappings:3ika.A&PDB-ENSP_mappings:3ika.B&PDB-ENSP_mappings:3lzb.A&PDB-ENSP_mappings:3lzb.B&PDB-ENSP_mappings:3lzb.C&PDB-ENSP_mappings:3lzb.D&PDB-ENSP_mappings:3lzb.E&PDB-ENSP_mappings:3lzb.F&PDB-ENSP_mappings:3lzb.G&PDB-ENSP_mappings:3lzb.H&PDB-ENSP_mappings:3poz.A&PDB-ENSP_mappings:3ug1.A&PDB-ENSP_mappings:3ug2.A&PDB-ENSP_mappings:3vjn.A&PDB-ENSP_mappings:3vjo.A&PDB-ENSP_mappings:3w2o.A&PDB-ENSP_mappings:3w2p.A&PDB-ENSP_mappings:3w2q.A&PDB-ENSP_mappings:3w2r.A&PDB-ENSP_mappings:3w2s.A&PDB-ENSP_mappings:3w32.A&PDB-ENSP_mappings:3w33.A&PDB-ENSP_mappings:4g5j.A&PDB-ENSP_mappings:4g5p.A&PDB-ENSP_mappings:4g5p.B&PDB-ENSP_mappings:4hjo.A&PDB-ENSP_mappings:4i1z.A&PDB-ENSP_mappings:4i20.A&PDB-ENSP_mappings:4i21.A&PDB-ENSP_mappings:4i21.B&PDB-ENSP_mappings:4i22.A&PDB-ENSP_mappings:4i23.A&PDB-ENSP_mappings:4i24.A&PDB-ENSP_mappings:4i24.B&PDB-ENSP_mappings:4jq7.A&PDB-ENSP_mappings:4jq8.A&PDB-ENSP_mappings:4jr3.A&PDB-ENSP_mappings:4jrv.A&PDB-ENSP_mappings:4li5.A&PDB-ENSP_mappings:4ll0.A&PDB-ENSP_mappings:4ll0.B&PDB-ENSP_mappings:4lqm.A&PDB-ENSP_mappings:4lrm.A&PDB-ENSP_mappings:4lrm.B&PDB-ENSP_mappings:4lrm.C&PDB-ENSP_mappings:4lrm.D&PDB-ENSP_mappings:4lrm.E&PDB-ENSP_mappings:4r3p.A&PDB-ENSP_mappings:4r3r.A&PDB-ENSP_mappings:4r5s.A&PDB-ENSP_mappings:4riw.B&PDB-ENSP_mappings:4riw.D&PDB-ENSP_mappings:4rix.B&PDB-ENSP_mappings:4rix.D&PDB-ENSP_mappings:4riy.B&PDB-ENSP_mappings:4riy.D&PDB-ENSP_mappings:4rj4.A&PDB-ENSP_mappings:4rj5.A&PDB-ENSP_mappings:4rj6.A&PDB-ENSP_mappings:4rj7.A&PDB-ENSP_mappings:4rj8.A&PDB-ENSP_mappings:4tks.A&PDB-ENSP_mappings:4wd5.A&PDB-ENSP_mappings:4wd5.B&PDB-ENSP_mappings:4wkq.A&PDB-ENSP_mappings:4wrg.A&PDB-ENSP_mappings:4zau.A&PDB-ENSP_mappings:4zjv.A&PDB-ENSP_mappings:4zjv.B&PDB-ENSP_mappings:4zse.A&PDB-ENSP_mappings:4zse.B&PDB-ENSP_mappings:4zse.C&PDB-ENSP_mappings:4zse.D&PDB-ENSP_mappings:5c8k.A&PDB-ENSP_mappings:5c8m.A&PDB-ENSP_mappings:5c8n.A&PDB-ENSP_mappings:5cal.A&PDB-ENSP_mappings:5can.A&PDB-ENSP_mappings:5cao.A&PDB-ENSP_mappings:5cap.A&PDB-ENSP_mappings:5caq.A&PDB-ENSP_mappings:5cas.A&PDB-ENSP_mappings:5cau.A&PDB-ENSP_mappings:5cav.A&PDB-ENSP_mappings:5cnn.A&PDB-ENSP_mappings:5cnn.B&PDB-ENSP_mappings:5cno.A&PDB-ENSP_mappings:5cno.B&PDB-ENSP_mappings:5cno.X&PDB-ENSP_mappings:5czh.A&PDB-ENSP_mappings:5czi.A&PDB-ENSP_mappings:5d41.A&PDB-ENSP_mappings:5d41.B&PDB-ENSP_mappings:5edp.A&PDB-ENSP_mappings:5edq.A&PDB-ENSP_mappings:5edr.A&PDB-ENSP_mappings:5em5.A&PDB-ENSP_mappings:5em6.A&PDB-ENSP_mappings:5em7.A&PDB-ENSP_mappings:5em8.A&PDB-ENSP_mappings:5fed.A&PDB-ENSP_mappings:5fee.A&PDB-ENSP_mappings:5feq.A&PDB-ENSP_mappings:5gmp.A&PDB-ENSP_mappings:5gnk.A&PDB-ENSP_mappings:5gty.A&PDB-ENSP_mappings:5gty.B&PDB-ENSP_mappings:5gty.C&PDB-ENSP_mappings:5gty.D&PDB-ENSP_mappings:5gty.E&PDB-ENSP_mappings:5gty.F&PDB-ENSP_mappings:5gty.G&PDB-ENSP_mappings:5gty.H&PDB-ENSP_mappings:5gtz.A&PDB-ENSP_mappings:5hcx.A&PDB-ENSP_mappings:5hcy.A&PDB-ENSP_mappings:5hcz.A&PDB-ENSP_mappings:5hg5.A&PDB-ENSP_mappings:5hg7.A&PDB-ENSP_mappings:5hg8.A&PDB-ENSP_mappings:5hg9.A&PDB-ENSP_mappings:5hib.A&PDB-ENSP_mappings:5hic.A&PDB-ENSP_mappings:5j9y.A&PDB-ENSP_mappings:5j9z.A&PDB-ENSP_mappings:5jeb.A&PDB-ENSP_mappings:5u8l.A&PDB-ENSP_mappings:5ug8.A&PDB-ENSP_mappings:5ug9.A&PDB-ENSP_mappings:5uga.A&PDB-ENSP_mappings:5ugb.A&PDB-ENSP_mappings:5ugc.A&PDB-ENSP_mappings:5uwd.A&PDB-ENSP_mappings:5x26.A&PDB-ENSP_mappings:5x27.A&PDB-ENSP_mappings:5x28.A&PDB-ENSP_mappings:5x2a.A&PDB-ENSP_mappings:5x2a.B&PDB-ENSP_mappings:5x2a.C&PDB-ENSP_mappings:5x2a.D&PDB-ENSP_mappings:5x2c.A&PDB-ENSP_mappings:5x2c.B&PDB-ENSP_mappings:5x2f.A&PDB-ENSP_mappings:5x2f.B&PDB-ENSP_mappings:5x2f.C&PDB-ENSP_mappings:5x2f.D&PDB-ENSP_mappings:5x2k.A&PDB-ENSP_mappings:5xdk.A&PDB-ENSP_mappings:5xdl.A&PDB-ENSP_mappings:5xgm.A&PDB-ENSP_mappings:5xgn.A&PDB-ENSP_mappings:5xgn.B&PDB-ENSP_mappings:5y25.A&PDB-ENSP_mappings:5y9t.A&PDB-ENSP_mappings:5yu9.A&PDB-ENSP_mappings:5yu9.B&PDB-ENSP_mappings:5yu9.C&PDB-ENSP_mappings:5yu9.D&PDB-ENSP_mappings:5zto.A&PDB-ENSP_mappings:5zwj.A&PDB-ENSP_mappings:6d8e.A&PDB-ENSP_mappings:6duk.A&PDB-ENSP_mappings:6duk.B&PDB-ENSP_mappings:6duk.C&PDB-ENSP_mappings:6duk.D&PDB-ENSP_mappings:6duk.E&PDB-ENSP_mappings:6duk.F&PDB-ENSP_mappings:6jrj.A&PDB-ENSP_mappings:6jrk.A&PDB-ENSP_mappings:6jrx.A&PDB-ENSP_mappings:6jwl.A&PDB-ENSP_mappings:6jx0.A&PDB-ENSP_mappings:6jx4.A&PDB-ENSP_mappings:6jxt.A&PDB-ENSP_mappings:6jz0.A&PDB-ENSP_mappings:6lub.A&PDB-ENSP_mappings:6lud.A&PDB-ENSP_mappings:6p1d.A&PDB-ENSP_mappings:6p1d.B&PDB-ENSP_mappings:6p1d.C&PDB-ENSP_mappings:6p1d.D&PDB-ENSP_mappings:6p1l.A&PDB-ENSP_mappings:6p1l.B&PDB-ENSP_mappings:6p1l.C&PDB-ENSP_mappings:6p1l.D&PDB-ENSP_mappings:6p8q.A&PDB-ENSP_mappings:6p8q.B&PDB-ENSP_mappings:6p8q.C&PDB-ENSP_mappings:6p8q.D&PDB-ENSP_mappings:6s89.A&PDB-ENSP_mappings:6s8a.A&PDB-ENSP_mappings:6s9b.A&PDB-ENSP_mappings:6s9c.A&PDB-ENSP_mappings:6s9d.A&PDB-ENSP_mappings:6tfu.A&PDB-ENSP_mappings:6tfu.B&PDB-ENSP_mappings:6tfv.A&PDB-ENSP_mappings:6tfv.B&PDB-ENSP_mappings:6tfw.A&PDB-ENSP_mappings:6tfw.B&PDB-ENSP_mappings:6tfy.A&PDB-ENSP_mappings:6tfy.B&PDB-ENSP_mappings:6tfz.A&PDB-ENSP_mappings:6tfz.B&PDB-ENSP_mappings:6tg0.A&PDB-ENSP_mappings:6tg0.B&PDB-ENSP_mappings:6tg1.A&PDB-ENSP_mappings:6tg1.B&PDB-ENSP_mappings:6v5n.A&PDB-ENSP_mappings:6v5n.B&PDB-ENSP_mappings:6v5n.C&PDB-ENSP_mappings:6v5n.D&PDB-ENSP_mappings:6v5p.A&PDB-ENSP_mappings:6v5p.B&PDB-ENSP_mappings:6v5p.C&PDB-ENSP_mappings:6v5p.D&PDB-ENSP_mappings:6v66.A&PDB-ENSP_mappings:6v66.B&PDB-ENSP_mappings:6v66.C&PDB-ENSP_mappings:6v66.D&PDB-ENSP_mappings:6v6k.A&PDB-ENSP_mappings:6v6k.B&PDB-ENSP_mappings:6v6k.C&PDB-ENSP_mappings:6v6k.D&PDB-ENSP_mappings:6v6k.E&PDB-ENSP_mappings:6v6k.F&PDB-ENSP_mappings:6v6k.G&PDB-ENSP_mappings:6v6k.H&PDB-ENSP_mappings:6v6o.A&PDB-ENSP_mappings:6v6o.B&PDB-ENSP_mappings:6v6o.C&PDB-ENSP_mappings:6v6o.D&PDB-ENSP_mappings:6v6o.E&PDB-ENSP_mappings:6v6o.F&PDB-ENSP_mappings:6v6o.G&PDB-ENSP_mappings:6v6o.H&PDB-ENSP_mappings:6vh4.A&PDB-ENSP_mappings:6vhn.A&PDB-ENSP_mappings:6vhp.A&PDB-ENSP_mappings:6wa2.A&PDB-ENSP_mappings:6wa2.B&PDB-ENSP_mappings:6wa2.C&PDB-ENSP_mappings:6wa2.D&PDB-ENSP_mappings:6wak.A&PDB-ENSP_mappings:6wak.B&PDB-ENSP_mappings:6wak.C&PDB-ENSP_mappings:6wak.D&PDB-ENSP_mappings:6wxn.A&PDB-ENSP_mappings:6wxn.B&PDB-ENSP_mappings:6wxn.C&PDB-ENSP_mappings:6wxn.D&PDB-ENSP_mappings:6xl4.A&PDB-ENSP_mappings:6xl4.B&PDB-ENSP_mappings:6xl4.C&PDB-ENSP_mappings:6xl4.D&PDB-ENSP_mappings:6z4b.A&PDB-ENSP_mappings:6z4b.B&PDB-ENSP_mappings:6z4d.A&PDB-ENSP_mappings:6z4d.B&PDB-ENSP_mappings:7a2a.A&PDB-ENSP_mappings:7a2a.B&PDB-ENSP_mappings:7a6i.A&PDB-ENSP_mappings:7a6j.A&PDB-ENSP_mappings:7a6j.B&PDB-ENSP_mappings:7a6k.A&PDB-ENSP_mappings:7a6k.B&PDB-ENSP_mappings:7a6k.C&PDB-ENSP_mappings:7a6k.D&PDB-ENSP_mappings:7aei.A&PDB-ENSP_mappings:7aem.A&PDB-ENSP_mappings:7b85.A&PDB-ENSP_mappings:7er2.A&PDB-ENSP_mappings:7jxi.A&PDB-ENSP_mappings:7jxi.B&PDB-ENSP_mappings:7jxi.C&PDB-ENSP_mappings:7jxi.D&PDB-ENSP_mappings:7jxk.A&PDB-ENSP_mappings:7jxk.B&PDB-ENSP_mappings:7jxk.C&PDB-ENSP_mappings:7jxk.D&PDB-ENSP_mappings:7jxk.E&PDB-ENSP_mappings:7jxk.F&PDB-ENSP_mappings:7jxl.A&PDB-ENSP_mappings:7jxl.B&PDB-ENSP_mappings:7jxl.C&PDB-ENSP_mappings:7jxl.D&PDB-ENSP_mappings:7jxm.A&PDB-ENSP_mappings:7jxm.B&PDB-ENSP_mappings:7jxm.C&PDB-ENSP_mappings:7jxm.D&PDB-ENSP_mappings:7jxp.A&PDB-ENSP_mappings:7jxp.B&PDB-ENSP_mappings:7jxp.C&PDB-ENSP_mappings:7jxp.D&PDB-ENSP_mappings:7jxp.E&PDB-ENSP_mappings:7jxp.F&PDB-ENSP_mappings:7jxq.A&PDB-ENSP_mappings:7jxq.B&PDB-ENSP_mappings:7jxq.C&PDB-ENSP_mappings:7jxq.D&PDB-ENSP_mappings:7jxw.A&PDB-ENSP_mappings:7jxw.B&PDB-ENSP_mappings:7jxw.C&PDB-ENSP_mappings:7jxw.D&PDB-ENSP_mappings:7k1h.A&PDB-ENSP_mappings:7k1h.B&PDB-ENSP_mappings:7k1h.C&PDB-ENSP_mappings:7k1h.D&PDB-ENSP_mappings:7k1h.E&PDB-ENSP_mappings:7k1h.F&PDB-ENSP_mappings:7k1i.A&PDB-ENSP_mappings:7kxz.A&PDB-ENSP_mappings:7ky0.A&PDB-ENSP_mappings:7ky0.B&PDB-ENSP_mappings:7ky0.C&PDB-ENSP_mappings:7ky0.D&PDB-ENSP_mappings:7lg8.A&PDB-ENSP_mappings:7lg8.B&PDB-ENSP_mappings:7lg8.C&PDB-ENSP_mappings:7lg8.D&PDB-ENSP_mappings:7lgs.A&PDB-ENSP_mappings:7lgs.B&PDB-ENSP_mappings:7lgs.C&PDB-ENSP_mappings:7lgs.D&PDB-ENSP_mappings:7ltx.A&PDB-ENSP_mappings:7ltx.B&PDB-ENSP_mappings:7ltx.C&PDB-ENSP_mappings:7ltx.D&PDB-ENSP_mappings:7oxb.A&PDB-ENSP_mappings:7si1.A&PDB-ENSP_mappings:7syd.A&PDB-ENSP_mappings:7syd.B&PDB-ENSP_mappings:7sye.A&PDB-ENSP_mappings:7sye.B&PDB-ENSP_mappings:7sz0.A&PDB-ENSP_mappings:7sz0.B&PDB-ENSP_mappings:7sz1.A&PDB-ENSP_mappings:7sz1.B&PDB-ENSP_mappings:7sz5.A&PDB-ENSP_mappings:7sz5.B&PDB-ENSP_mappings:7sz7.A&PDB-ENSP_mappings:7sz7.B&PDB-ENSP_mappings:7t4i.A&PDB-ENSP_mappings:7t4j.A&PDB-ENSP_mappings:7t4j.B&PDB-ENSP_mappings:7tvd.A&PDB-ENSP_mappings:7u98.A&PDB-ENSP_mappings:7u98.B&PDB-ENSP_mappings:7u98.C&PDB-ENSP_mappings:7u98.D&PDB-ENSP_mappings:7u99.A&PDB-ENSP_mappings:7u9a.A&PDB-ENSP_mappings:7ukv.A&PDB-ENSP_mappings:7ukw.A&PDB-ENSP_mappings:7ukw.B&PDB-ENSP_mappings:7ukw.C&PDB-ENSP_mappings:7ukw.D&PDB-ENSP_mappings:7vra.A&PDB-ENSP_mappings:7vre.A&PDB-ENSP_mappings:7zym.A&PDB-ENSP_mappings:7zyn.A&PDB-ENSP_mappings:7zyp.A&PDB-ENSP_mappings:7zyq.A&PDB-ENSP_mappings:7zyq.B&PDB-ENSP_mappings:8a27.A&PDB-ENSP_mappings:8a2a.A&PDB-ENSP_mappings:8a2b.A&PDB-ENSP_mappings:8a2d.A&PDB-ENSP_mappings:8d73.A&PDB-ENSP_mappings:8d73.B&PDB-ENSP_mappings:8d76.A&PDB-ENSP_mappings:8d76.B&PDB-ENSP_mappings:8dsw.A&PDB-ENSP_mappings:8eme.A&PDB-ENSP_mappings:8eme.B&PDB-ENSP_mappings:8f1h.A&PDB-ENSP_mappings:8f1w.A&PDB-ENSP_mappings:8f1w.B&PDB-ENSP_mappings:8f1w.C&PDB-ENSP_mappings:8f1w.D&PDB-ENSP_mappings:8f1x.A&PDB-ENSP_mappings:8f1y.A&PDB-ENSP_mappings:8f1z.A&PDB-ENSP_mappings:8fv3.A&PDB-ENSP_mappings:8fv3.B&PDB-ENSP_mappings:8fv3.C&PDB-ENSP_mappings:8fv3.D&PDB-ENSP_mappings:8fv4.A&PDB-ENSP_mappings:8fv4.B&PDB-ENSP_mappings:8fv4.C&PDB-ENSP_mappings:8fv4.D&PDB-ENSP_mappings:8g63.A&PDB-ENSP_mappings:8gb4.A&PDB-ENSP_mappings:8gb4.B&PDB-ENSP_mappings:8gb4.C&PDB-ENSP_mappings:8gb4.D&PDB-ENSP_mappings:8gk5.A&PDB-ENSP_mappings:8gk5.B&PDB-ENSP_mappings:8gk5.C&PDB-ENSP_mappings:8gk5.D&PDB-ENSP_mappings:8h7x.A&PDB-ENSP_mappings:8h7x.B&PDB-ENSP_mappings:8hv1.A&PDB-ENSP_mappings:8hv2.A&PDB-ENSP_mappings:8hv3.A&PDB-ENSP_mappings:8hv4.A&PDB-ENSP_mappings:8hv5.A&PDB-ENSP_mappings:8hv6.A&PDB-ENSP_mappings:8hv7.A&PDB-ENSP_mappings:8hv8.A&PDB-ENSP_mappings:8hv9.A&PDB-ENSP_mappings:8hva.A&PDB-ENSP_mappings:8hy7.A&PDB-ENSP_mappings:8kfq.A&PDB-ENSP_mappings:8pnz.A&PDB-ENSP_mappings:8po0.A&PDB-ENSP_mappings:8po1.A&PDB-ENSP_mappings:8po2.A&PDB-ENSP_mappings:8po2.B&PDB-ENSP_mappings:8po2.D&PDB-ENSP_mappings:8po3.A&PDB-ENSP_mappings:8po4.A&PDB-ENSP_mappings:8po4.B&PDB-ENSP_mappings:8sc7.A&PDB-ENSP_mappings:8tjl.A&PDB-ENSP_mappings:8to3.A&PDB-ENSP_mappings:8to3.B&PDB-ENSP_mappings:8to3.C&PDB-ENSP_mappings:8to3.D&PDB-ENSP_mappings:8to4.A&PDB-ENSP_mappings:8to4.B&PDB-ENSP_mappings:8to4.C&PDB-ENSP_mappings:8to4.D&PDB-ENSP_mappings:8wd4.A&SMART:SM00219&Superfamily:SSF56112&CDD:cd05108&PANTHER:PTHR24416&PROSITE_profiles:PS50011&Phobius:CYTOPLASMIC_DOMAIN&Pfam:PF07714&Gene3D:1.10.510.10&PIRSF:PIRSF000619&AFDB-ENSP_mappings:AF-P00533-F1drug_response&pathogenic0&1&11&1&124944790&31019283&22992668&27618021&32295184&25157968&26619011&29525983&15118073&15118125&15329413&16115929&16204070&17192902&17285735&19922469&20479403&22753918&23102728&15897572&15901872&16043828&16203769&16204011&16865253&16956694&17047654&17106442&17317677&17387341&17429313&17473659&18303429&18349398&19096302&19455431&19692680&19692684&20022809&20038723&20573926&21670455&21783417&21900837&21969500&22215752&22370314&22452895&22740981&22760226&22982650&23816960&23948351&26490356&32175330&28347348&26053404&36388934&32962681&30149365&29721857&36629526&38008767FAIL-9-25-4114EGFR1660931648MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MONDO:MONDO:0005138&MedGen:C0684249&MedGen:C4016032&MedGen:C1851577&Human_Phenotype_Ontology:HP:0030078&MONDO:MONDO:0005061&MeSH:D000077192&MedGen:C0152013&MedGen:CN225347&MedGen:CN322733SCV000268169single_nucleotide_variantSO:0001483ClinGen:CA126713&ClinPGx_Clinical_Annotation:981420042&ClinPGx_Clinical_Annotation:981475838&ClinPGx_Clinical_Annotation:981475880&OMIM:131550.0002&UniProtKB:P00533#VAR_019298EGFR:1956SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005871752121434568Non-small_cell_lung_carcinomaHuman_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131SCV004565358&SCV004565359&SCV0058709097:55191822-551918221EGFRp.L858RTrueThe EGFR exon 21 L858R mutation occurs in the EGFR tyrosine kinase domain. Cell line experiments demonstrate that this mutation is activating, transforming, and sensitizing to EGFR tyrosine kinase inhibitors (TKI) (PMID: 15118073, 15118125). Preclinical models with the L858R mutation show high sensitivity to first-, second- and third-generation inhibitors, and to Ex20ins-active inhibitors (PMID: 34526717). Patients with lung cancers harboring the L858R mutation responded to EGFR TKIs with overall survival ranging from 3.5-17+ months after starting treatment (PMID: 15329413).EGFR, a receptor tyrosine kinase, is altered by amplification and/or mutation in lung and brain cancers among others.15329413|15118073|15118125|34526717L858R1956EGFRGRCh38.MUTATION.The EGFR L858R mutation is known to be oncogenic.FalseLEVEL_Fda2The EGFR exon 21 L858R mutation occurs in the EGFR tyrosine kinase domain. Cell line experiments demonstrate that this mutation is activating, transforming, and sensitizing to EGFR tyrosine kinase inhibitors (TKI) (PMID: 15118073, 15118125). Preclinical models with the L858R mutation show high sensitivity to first-, second- and third-generation inhibitors, and to Ex20ins-active inhibitors (PMID: 34526717). Patients with lung cancers harboring the L858R mutation responded to EGFR TKIs with overall survival ranging from 3.5-17+ months after starting treatment (PMID: 15329413).['15329413', '15118073', '15118125', '34526717']AfatinibLEVEL_1LEVEL_Fda2['23816960', '22452895', '25589191']Afatinib, a second-generation, irreversible tyrosine kinase inhibitor of EGFR, HER2, and HER4, is FDA-approved as first-line therapy in patients with non-small cell lung cancer (NSCLC) whose tumors harbor EGFR exon 19 deletion or L858R, L861Q, G719, and/or S768I substitution mutations. FDA approval was based on the Phase II LUX-Lung 2 trial, which demonstrated an objective response rate of 61% in patients with EGFR-mutant lung cancer treated with afatinib (PMID: 22452895). In the Phase III LUX-Lung 3 trial, afatinib significantly improved progression-free survival (PFS) in patients with EGFR-mutant lung cancer compared to patients treated with chemotherapy comprised of cisplatin plus pemetrexed (13.6 months versus 6.9 months, HR=0.47, p=0.001) (PMID: 23816960). In a pooled analysis of the LUX-Lung 3 and 6 trials comparing overall survival in patients with EGFR mutation who were treated with afatinib versus those treated with chemotherapy, first-line treatment with afatinib significantly improved overall survival specifically in patients harboring exon 19 deletions compared to those treated with chemotherapy (31.7 versus 20.7 months, HR = 0.59, p = 0.0001) (PMID: 25589191).Non-Small Cell Lung CancerSOLIDLungAmivantamab + ChemotherapyLEVEL_1LEVEL_Fda2['37879444']Amivantamab is an intravenously infused, EGFR-MET bispecific monoclonal antibody that is FDA-approved for the treatment of adult patients in combination with carboplatin and pemetrexed for the treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with EGFR exon 19 deletions or exon 21 L858R substitution mutations, whose disease has progressed on or after treatment with an EGFR tyrosine kinase inhibitor. FDA approval is based on the results of the Phase III MARIPOSA-2 (NCT04988295) trial of amivantamab plus chemotherapy versus chemotherapy in 394 patients with NSCLC with EGFR L858R mutations or exon 19 deletions. __In the Phase III MARIPOSA-2 (NCT04988295) trial, the amivantamab plus chemotherapy cohort (n=131 [n=89, EGFR exon 19 deletions, n=42, EGFR L858R]) demonstrated an overall response rate (ORR) of 53% (95% CI=44-62), with a 0.8% complete response (CR) rate and 52% partial response (PR) rate (PMID: 37879444). In contrast, the chemotherapy cohort (n=263 [n=183, EGFR exon 19 deletions, n=79, EGFR L858R]) demonstrated an ORR of 29% (95% CI=23-35) (p<0.0001), with a 29% PR rate (PMID: 37879444). The amivantamab plus chemotherapy cohort demonstrated a median progression-free survival (PFS) of 6.3 months (95% CI=5.6-8.4) and a median duration of response (DOR) of 6.9 months (95% CI= 5.5NE) while the chemotherapy cohort demonstrated a median PFS of 4.2 months (95% CI=4.04.4) (HR=0.48 [95% CI=0.36-0.64], p<0.0001) and a median DOR of 5.6 months (95% CI=4.29.6) (PMID: 37879444).Non-Small Cell Lung CancerSOLIDLungAmivantamab + LazertinibLEVEL_1LEVEL_Fda2['38924756']Amivantamab, an intravenously infused, EGFR-MET bispecific monoclonal antibody, and lazertinib, a small molecule, third-generation EGFR tyrosine kinase inhibitor, are FDA-approved in combination for the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with EGFR exon 19 deletions or exon 21 L858R substitution mutations, as detected by an FDA-approved test. FDA approval was based on the results of the Phase III MARIPOSA (NCT04487080) trial of amivantamab plus lazertinib versus osimertinib monotherapy in 1074 patients with NSCLC with an EGFR exon 19 deletion or L858R mutation. In the Phase III MARIPOSA (NCT04487080) trial, the amivantamab plus lazertinib cohort (n=429) demonstrated an overall response rate (ORR) of 86% (95% CI=83-89), a median progression-free survival (PFS) of 23.7 months (95% CI=19.1-27.7), a median duration of response (DOR) of 25.8 months (95% CI=20.1-NE) and a 24-month overall survival (OS) rate of 74% (95% CI=69-78) while the osimertinib cohort (n=429) demonstrated an ORR of 85% (95% CI=81-88), a median PFS of 16.6 months (95% CI=14.818.5) (HR=0.70 [95% CI=0.58-0.85], p<0.001), a median DOR of 16.8 months (95% CI=14.8-18.5) and a 24-month OS rate of 69% (95% CI=64-74) (PMID: 38924756).Non-Small Cell Lung CancerSOLIDLungDacomitinibLEVEL_1LEVEL_Fda2['29864379', '28958502']Dacomitinib is a small molecule inhibitor of EGFR that is FDA-approved for the first-line treatment of patients with metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 19 deletion or exon 21 L858R substitution mutations as detected by an FDA-approved test. FDA approval was based on the Phase III ARCHER 1050 trial of dacomitinib versus gefitinib in 452 patients with advanced, EGFR-positive NSCLC in which the median progression-free survival (PFS) was 14.7 months for patients randomized to dacomitinib and 9.2 months for patients randomized to gefitinib (HR=0.59, 95% CI=0.47-0.74, p=0001) (PMID: 28958502). Overall survival was 34.1 months in the dacomitinib arm versus 26.8 months in the gefitinib arm (HR=0.760, 95% CI=0.582-0.993, P = .044) (PMID: 29864379).Non-Small Cell Lung CancerSOLIDLungDatopotamab DeruxtecanLEVEL_1LEVEL_Fda2['39761483', '39250535']Datopotamab deruxtecan (Dato-DXd) is an intravenously infused, TROP2-directed antibody drug conjugate that is FDA-approved for the treatment of patients with EGFR-mutated non-small cell lung cancer (NSCLC) who have received prior EGFR-directed therapy and platinum-based chemotherapy. FDA approval is based on the results of the Phase II TROPION-Lung05 (NCT04484142) and Phase III TROPION-Lung01 (NCT04656652) trials of Dato-DXd in patients with previously treated EGFR-mutated NSCLC._In the Phase II TROPION-Lung05 (NCT04484142) trial of Dato-DXd in patients with NSCLC harboring actionable alterations progressing on or after targeted therapy and platinum-based chemotherapy, patients with EGFR-mutated NSCLC (n=78 [exon 19 deletion: 41 (29.9%), exon 20 T790M: 26 (19.0%), exon 21 L858R: 25 (18.2%), exon 18 G719: 5 (3.6%), exon 21 L861Q: 3 (2.2%), exon 20 insertion: 2 (1.5%)]) demonstrated an overall response rate (ORR) of 43.6% (95% CI=32.4-55.3), with a 5.1% (n=4) complete response (CR) rate, 38.5% (n=30) partial response (PR) rate and 34.6% (n=27) stable disease (SD) rate, a disease control rate (DCR) of 82.1% (95% CI=71.7-89.8), a median duration of response (DOR) of 7.0 months (95% CI=4.2-10.2) and a median progression-free survival (PFS) of 5.8 months (95% CI=5.4-8.3) (PMID: 39761483)._In the Phase III TROPION-Lung01 (NCT04656652) trial of Dato-DXd versus docetaxel in patients with pretreated NSCLC, patients treated with Dato-DXd (n=299 [EGFR mutations: 39 (13.0%)]) demonstrated an ORR of 26.4% (95% CI= 21.5-31.8), with a 1.3% (n=4) CR rate, 25.1% (n=75) PR rate and 49.8% (n=149) SD rate, a DCR of 77.3% (95% CI=72.1-81.9), a median DOR of 7.1 months (95% CI=5.6-10.9), a median PFS of 4.4 months (95% CI=4.2-5.6) and a median overall survival (OS) of 12.9 months (95% CI=11.0-13.9) (PMID: 39250535). Patients treated with docetaxel (n=305 [EGFR mutations: 45 (14.8%)]) demonstrated an ORR of 12.8% (95% CI=9.3-17.1), with a 12.8% (n=39) PR rate and 50.2% (n=153) SD rate, a DCR of 64.9% (95% CI=59.3-70.3), a median DOR of 5.6 months (95% CI=5.4-8.1), a median PFS of 3.7 months (95% CI=2.9-4.2) (HR=0.75 [95% CI=0.62-0.91], p=.004) and a median OS of 11.8 months (95% CI=10.1-12.8) (HR=0.94 [95% CI=0.78-1.14], p=0.530) (PMID: 39250535).Non-Small Cell Lung CancerSOLIDLungErlotinibLEVEL_1LEVEL_Fda2['22285168', '27987585']Erlotinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is approved with or without ramucirumab for the treatment of non-small cell lung cancer (NSCLC) with EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. Results of the Phase III EURTAC trial demonstrated that patients with NSCLC receiving erlotinib showed significant improvement in progression-free survival (PFS) (9.7 vs. 5.2 months, HR=0.37, p=0.0001) compared to those receiving platinum-based doublet chemotherapy (PMID: 22285168). The partial response rate with erlotinib was 56%, compared to 13% with chemotherapy, and was associated with a reduced toxicity profile (PMID: 22285168). The safety and efficacy of erlotinib have not been established in patients harboring EGFR mutations other than exon 19 deletion and exon 21 (L858R) substitution, however, the phase III IUNO trial demonstrated no difference in PFS between patients with NSCLC lacking EGFR exon 19 deletion or EGFR L858R mutation who were given erlotinib versus placebo as maintenance therapy (PMID: 27987585).Non-Small Cell Lung CancerSOLIDLungGefitinibLEVEL_1LEVEL_Fda2['20022809', '19692680', '21670455', '22370314', '31682542', '20573926']Gefitinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is FDA-approved as first-line therapy in patients with non-small cell lung cancer (NSCLC) whose tumors harbor EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. FDA approval is based on multiple clinical trials that demonstrated the efficacy of gefitinib in EGFR-mutant NSCLC and includes IPASS (PMID: 19692680, 21670455), NEJ002 (PMID: 20573926), WJTOG3405 (PMID: 20022809) and First-SIGNAL (PMID: 22370314). Response rates in EGFR-mutant lung cancers in these studies ranged from 55% to 85%, with median progression-free survival (PFS) of 8 to 10.8 months (PMID: 19692680, 21670455, 20573926, 20022809, 22370314). In one study comparing gefitinib with standard chemotherapy in pulmonary adenocarcinoma, the response rate with gefitinib in patients with EGFR mutations (47%) was nearly double that of patients who were EGFR wildtype (24%) (PMID: 19692680). Additionally, in the biomarker analysis and final overall survival (OS) analysis of the Phase III IPASS study, though OS was not different between the gefitinib and carboplatin/paclitaxel groups, 64.3% of patients assigned to chemotherapy had crossed over to treatment with EGFR TKIs, PFS in this study was significantly longer with gefitinib than chemotherapy in patients with EGFR mutation (HR=0.48) (PMID: 21670455). In a Phase II trial, the addition of carboplatin plus pemetrexed to gefitinib increased progression-free survival (20.9 months vs 11.9 months, HR = 0.490, P < .001) in patients with EGFR-mutant NSCLC compared to gefitinib alone (PMID: 31682542).Non-Small Cell Lung CancerSOLIDLungOsimertinibLEVEL_1LEVEL_Fda2['38828946', '32955177', '29151359', '31751012']Osimertinib is an orally available, small molecule third-generation EGFR T790M tyrosine kinase inhibitor (TKI) that is FDA-approved for adjuvant therapy after tumor resection in adult patients with non-small cell lung cancer (NSCLC) whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, the treatment of adult patients with locally advanced, unresectable (stage III) NSCLC whose disease has not progressed during or following concurrent or sequential platinum-based chemoradiation therapy and whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations and the first-line treatment of adult patients with metastatic NSCLC whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, as detected by an FDA-approved test. EGFR exon 19 deletions and exon 21 L858R mutations for treatment with osimertinib were detected by the cobas EGFR Mutation Test v2, FoundationOne CDx, FoundationOne Liquid CDx or Guardant360 CDx. FDA approvals were based on the results of the Phase III ADAURA (NCT02511106) trial for adjuvant treatment, the Phase III LAURA (NCT03521154) trial for locally advanced, unresectable NSCLC treatment and the Phase III FLAURA (NCT02296125) trial for first-line monotherapy treatment. __In the Phase III ADAURA (NCT02511106) trial of osimertinib versus placebo in 682 patients with completely resected EGFR mutation-positive stage IB to IIIA NSCLC, 89% (95% CI=85-92) of patients in the osimertinib cohort (n=339 [55%, EGFR exon 19 deletion, 45%, EGFR L858R, 1%, EGFR T790M]) and 52% (95% CI=46-58) of patients in the placebo cohort (n=343 [55%, EGFR exon 19 deletion, 45%, EGFR L858R, 1%, EGFR T790M]) were alive and disease-free at 24 months (HR=0.20 [99.12% CI=0.14-0.30], p<0.001) (PMID: 32955177). __In the Phase III LAURA (NCT03521154) trial of osimertinib versus placebo in 216 patients with unresectable EGFR mutation-positive stage III NSCLC without progression during or after chemoradiotherapy, the osimertinib cohort (n=143 [n=74, EGFR exon 19 deletion, n=68, EGFR L858R]) demonstrated an objective response rate (ORR) of 57% (95% CI=49-66), with a 2% (n=3) complete response (CR) rate, 55% (n=79) partial response (PR) rate and 31% (n=45) stable disease (SD) rate, a median progression-free survival (PFS) of 39.1 months (95% CI=31.5-NC) and a median duration of response (DOR) of 36.9 months (95% CI=30.1-NC). In contrast, the placebo cohort (n=73 [n=43, EGFR exon 19 deletion, n=30, EGFR L858R]) demonstrated an ORR of 33% (95% CI=22-45) (OR=2.77 [95% CI=1.54-5.08]), with a 1% (n=1) CR rate, 32% (n=23) PR rate and 47% (n=34) SD rate, a median PFS of 5.6 months (95% CI=3.7-7.4) (HR=0.16 [95% CI=0.10-0.24], p<0.001) and a median DOR of 6.5 months (95% CI=3.6-8.3) (PMID: 38828946). __In the Phase III FLAURA (NCT02296125) trial of osimertinib versus standard EGFR TKI (gefitinib or erlotinib) in 556 patients with previously untreated, EGFR mutation-positive advanced NSCLC, the osimertinib cohort (n=279 [n=175, EGFR exon 19 deletion, n=104, EGFR L858R]) demonstrated an ORR of 80% (95% CI=75-85), with a 3% (n=7) CR rate, 77% (n=216) PR rate and 17% (n=47) SD rate, a median PFS of 18.9 months (95% CI=15.2-21.4), a median DOR of 17.2 months (95% CI=13.8-22.0) and a median overall survival (OS) could not be calculated (95% CI=NC-NC). In contrast, the standard EGFR TKI cohort (n=277 [n=174, EGFR exon 19 deletion, n=103, EGFR L858R]) demonstrated an ORR of 76% (95% CI=70-81), with a 1% (n=4) CR rate, 74% (n=206) PR rate and 17% (n=46) SD rate, a median PFS of 10.2 months (95% CI=9.6-11.1) (HR=0.46 [95% CI=0.37-0.57], p<0.001), a median DOR of 8.5 months (95% CI=7.3-9.8) and a median OS that could not be calculated (95% CI=NC-NC) (HR=0.63 [95% CI=0.45-0.88], p=0.007) (PMID: 29151359). In the final analysis of the OS in the Phase III FLAURA (NCT02296125) trial, the osimertinib cohort and standard EGFR TKI cohort demonstrated a median OS of 38.6 months (95% CI=34.5-41.8) and 31.8 months (95% CI=26.6-36.0), respectively (HR=0.80 [95.05% CI=0.64-1.00], p=0.046) (PMID: 31751012).Non-Small Cell Lung CancerSOLIDLungOsimertinib + ChemotherapyLEVEL_1LEVEL_Fda2['37937763']Osimertinib is an orally available, small molecule third-generation EGFR T790M tyrosine kinase inhibitor (TKI) that is FDA-approved in combination with pemetrexed and platinum-based chemotherapy, the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, as detected by an FDA-approved test. EGFR exon 19 deletions and exon 21 L858R mutations for treatment with osimertinib were detected by the cobas EGFR Mutation Test v2, FoundationOne CDx, FoundationOne Liquid CDx or Guardant360 CDx. __FDA approval is based on the results of the Phase III FLAURA2 (NCT04035486) trial of osimertinib plus chemotherapy (pemetrexed plus cisplatin or carboplatin) versus single-agent osimertinib in 557 patients with previously untreated, EGFR mutation-positive advanced NSCLC. In the Phase III FLAURA2 (NCT04035486) trial, the osimertinib plus chemotherapy cohort (n=279 [n=169, EGFR exon 19 deletion, n=106, EGFR L858R, n=3, both, n=1, unknown]) demonstrated a median progression-free survival (PFS) of 25.5 months (95% CI=24.7-NC), a median duration of response (DOR) of 24.0 months (95% CI=20.9-27.8) and an objective response rate (ORR) of 83% (95% CI=78-87), with an 83% partial response (PR) rate and <1% complete response (CR) rate. The osimertinib monotherapy cohort (n=278 [n=168, EGFR exon 19 deletion, n=106, EGFR L858R, n=3, both, n=2, unknown]) demonstrated a median PFS of 16.7 months (95% CI=14.1-21.3) (HR=0.62 [95% CI=0.490.79], p<0.001), a median DOR of 15.3 months (95% CI=12.7-9.4) and an ORR of 76% (95% CI=70-80), with a 75% PR rate and 1% CR rate (PMID: 37937763).Non-Small Cell Lung CancerSOLIDLungErlotinib + RamucirumabLEVEL_1LEVEL_Fda2['22285168', '27987585']Erlotinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is approved with or without ramucirumab for the treatment of non-small cell lung cancer (NSCLC) with EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. Results of the Phase III EURTAC trial demonstrated that patients with NSCLC receiving erlotinib showed significant improvement in progression-free survival (PFS) (9.7 vs. 5.2 months, HR=0.37, p=0.0001) compared to those receiving platinum-based doublet chemotherapy (PMID: 22285168). The partial response rate with erlotinib was 56%, compared to 13% with chemotherapy, and was associated with a reduced toxicity profile (PMID: 22285168). The safety and efficacy of erlotinib have not been established in patients harboring EGFR mutations other than exon 19 deletion and exon 21 (L858R) substitution, however, the phase III IUNO trial demonstrated no difference in PFS between patients with NSCLC lacking EGFR exon 19 deletion or EGFR L858R mutation who were given erlotinib versus placebo as maintenance therapy (PMID: 27987585).Non-Small Cell Lung CancerSOLIDLungPatritumab DeruxtecanLEVEL_3ALEVEL_Fda3['37689979', '38369013', '31661465', '34548309', '30057690', '34084213']Patritumab deruxtecan (HER3-DXd) is an antibody-drug conjugate consisting of a HER3 antibody attached to a topoisomerase I inhibitor payload via a tetrapeptide-based cleavable linker. HER3 is the preferred heterodimeric partner for EGFR (PMID: 34084213, 30057690). In a phase I dose-escalation/expansion study (NCT03260491) of HER3-DXd in 57 patients with locally advanced or metastatic EGFR-mutated non-small cell lung cancer (NSCLC) (n=33 with Exon 19 deletion), the objective response rate (ORR) was 39% (95% CI=26.052.4) and median progression-free survival (PFS) was 8.2 (95% CI=4.48.3) months (PMID: 34548309). In the phase II HERTHENA-Lung01 trial of HER3-DXd in 225 patients with previously treated EGFR-mutated NSCLC, the median PFS was 5.5 months (95% CI=5.1-5.9) and an objective response was observed in 67 patients (29.8%, 95% CI=23.9-36.2), with complete response observed in one patient (PMID: 37689979). In preclinical studies, in vitro and in vivo models containing HER3-expressing CM-3 cancer cells treated with U3-1402 (HER3-DXd) exhibited reduced cell viability and tumor volume, respectively (PMID: 31661465). In the Phase I U31402-A-U102 (NCT03260491) trial of HER3-DXd in 97 patients with EGFR-mutated NSCLC who had received prior EGFR tyrosine kinase inhibitor therapy and platinum-based chemotherapy (n=64, exon 19 deletion, n=29, L858R, n=4, G719A, n=2, L861Q, n=1, exon 19 insertion), the cohort demonstrated an ORR of 39.2% (n=38) (95% CI=29.4-49.6), with a 1% (n=1) confirmed response rate, 38.1% (n=37) partial response rate, 40.2% (n=39) stable disease rate and 12.4% (n=12) progressive disease rate, a median duration of response of 9.6 months (95% CI=6.9-15.4), a median PFS of 6.4 months (95% CI=4.9-8.3) and a median overall survival of 15.8 months (95% CI=10.8-21.5) (PMID: 38369013).Non-Small Cell Lung CancerSOLIDLung15329413;15118073;15118125;3452671723816960;22452895;25589191;37879444;38924756;29864379;28958502;39761483;39250535;22285168;27987585;20022809;19692680;21670455;22370314;31682542;20573926;38828946;32955177;29151359;31751012;37937763;37689979;38369013;31661465;34548309;30057690;34084213105Gmissense_variantEGFR1956GeneENST00000275493.2ENST00000275493.2:c.2573T>GNP_005219.2:p.Leu858Arg33LEU858ARG/RS121434568/L813R/LEU813ARGhttps://civicdb.org/links/variants/33EGFR_L858R33NC_000007.13:g.55259515T>G/NM_005228.4:c.2573T>G/ENST00000275493.2:c.2573T>G/NP_005219.2:p.Leu858ArgCA12671316609/376282/376280
TUMORchr7116672196N<DUP>PASSNM_000245start_lost&feature_elongation&start_retained_variant&coding_sequence_variant&5_prime_UTR_variant&3_prime_UTR_variant&intron_variantHIGHMET1-21/211-20/20nanduplicationv7.0.LEVEL_Fda2False11/08/2024LEVEL_2125841DUPTrueTrueTrueGain-of-functionOncogenicCapmatinib,Crizotinib,TepotinibTelisotuzumab VedotinLEVEL_2LEVEL_R20/1GRCh38METNN<DUP>116672196MantaDUP:MET_AMP.GT:PR:SR0/1:30,22:12,9duplicationENSG00000105976TranscriptENST00000397752protein_coding2-64821HGNCHGNC:7029YESMANE_SelectNM_000245.41P3CCDS43636.1ENSP00000380860P08581.277UPI000020F975P08581-1Ensembl10,10,1116798037FalseMET amplification results from the gain of the MET gene on chromosome 7q31 and is found in various cancers, including melanoma, lung and renal cancers (PMID: 28481359). Often, this amplification leads to overexpression of the MET protein, which has been demonstrated to contribute to tumorigenesis by increasing downstream pathway activation, proliferation, invasiveness, and angiogenesis (PMID: 16461907, 18077425, 17463250, 19117057, 22869872,17667909). MET amplification has also been shown to contribute to resistance to tyrosine kinase inhibitors, including gefitinib and erlotinib and more recently osimertinib, as shown by sustained pathway activation and proliferation in the presence of drug (PMID: 18093943, 17463250, 30073261). In vitro proliferation assays of cell lines with MET amplifications show sensitivity to the MET-specific kinase inhibitor, PHA-665752 (PMID: 17463250, 16461907).MET, a receptor tyrosine kinase, is recurrently altered by mutation or amplification in various cancer types.30073261|16461907|19117057|17667909|22869872|18077425|18093943|28481359|17463250Amplification4233METGRCh38.CNA.MET amplification is known to be oncogenic.FalseLEVEL_Fda2MET amplification results from the gain of the MET gene on chromosome 7q31 and is found in various cancers, including melanoma, lung and renal cancers (PMID: 28481359). Often, this amplification leads to overexpression of the MET protein, which has been demonstrated to contribute to tumorigenesis by increasing downstream pathway activation, proliferation, invasiveness, and angiogenesis (PMID: 16461907, 18077425, 17463250, 19117057, 22869872,17667909). MET amplification has also been shown to contribute to resistance to tyrosine kinase inhibitors, including gefitinib and erlotinib and more recently osimertinib, as shown by sustained pathway activation and proliferation in the presence of drug (PMID: 18093943, 17463250, 30073261). In vitro proliferation assays of cell lines with MET amplifications show sensitivity to the MET-specific kinase inhibitor, PHA-665752 (PMID: 17463250, 16461907).['30073261', '16461907', '19117057', '17667909', '22869872', '18077425', '18093943', '28481359', '17463250']CapmatinibLEVEL_2LEVEL_Fda2['32877583']Capmatinib is a small molecule inhibitor of MET that is FDA-approved for adult patients with metastatic non-small cell lung cancer (NSCLC) whose tumors have a mutation that leads to MET exon 14 skipping. The NCCN lists capmatinib as a category 2A recommendation for patients with NSCLC harboring high-level MET amplification. In a phase II trial of capmatinib in patients with MET amplified or MET exon 14 skipping non-small cell lung cancer, the overall response rate in fifteen treatment-naive patients with MET amplification was 40% (95% CI= 16 - 68), while the overall response rate in 69 previously treated patients with MET amplification was 29% (95% CI= 19 - 41) (PMID: 32877583).Non-Small Cell Lung CancerSOLIDLungCrizotinibLEVEL_2LEVEL_Fda3['25971939', '26729443', '31416808', '21623265', '33676017']Crizotinib, an inhibitor of ALK, ROS1 and MET tyrosine kinases, is FDA-approved for the treatment of patients with metastatic non-small cell lung cancer (NSCLC) whose tumors are ROS1-positive and is a category 2A NCCN recommendation for patients with NSCLC harboring MET amplification or exon 14 skipping mutations. NCCN recommendation is based on evidence showing activity of crizotinib in patients with NSCLC with MET amplification or exon 14 skipping mutations (PMID: 21623265). In a study of twelve evaluable patients with c-MET-amplified NSCLC, four patients had partial responses (33%) with a median duration of response of 35 weeks (Abstract: Camidge et al. Abstract# 8001, ASCO 2014. http://meetinglibrary.asco.org/content/132030-144). In another study of four patients with NSCLC harboring MET exon 14 skipping mutations, three patients who were treated with crizotinib had a partial response to therapy (PMID: 25971939). A retrospective analysis also identified a patient with lung cancer harboring amplification of a mutant MET allele who had a major partial response to crizotinib (PMID: 26729443). In an open-label, multicenter phase I trial (NCT00585195) of crizotinib in 38 patients with MET-amplified NSCLC, the overall response rate was 28.9% (11/38, 95% CI= 15.445.9), with two (5.3%) patients achieving a complete response, nine patients (23.7%) achieving a partial response, eleven (28.9%) having stable disease, and eight (21.1%) having progressive disease, and the overall median PFS was 5.1 months (95% CI= 1.97.0) (PMID: 33676017). In a phase II prospective, multicenter two-arm trial (METROS, NCT02499614) evaluating the efficacy of crizotinib in 52 patients with pretreated, MET-deregulated (cohort B) NSCLC, the objective response rate was 27%, median progression-free survival was 4.4 months (95% CI= 3.05.8), and overall survival was 5.4 months (95% CI= 4.26.5)(PMID: 31416808).Non-Small Cell Lung CancerSOLIDLungTepotinibLEVEL_2LEVEL_Fda2Tepotinib is a small molecule inhibitor of the MET tyrosine kinase that is FDA-approved for adult patients with metastatic non-small cell lung cancer (NSCLC) harboring MET exon 14 skipping alterations. The NCCN lists tepotinib as a category 2A recommendation for patients with NSCLC harboring high-level MET amplification. In the phase II VISION trial of tepotinib in patients with MET-amplified NSCLC, ten of 24 patients had a response to tepotinib for an overall response rate of 24% (95% CI= 22 - 63) (Abstract: Le et al. Abstract# 9021, ASCO 2021. https://ascopubs.org/doi/abs/10.1200/JCO.2021.39.15_suppl.9021).Non-Small Cell Lung CancerSOLIDLungTelisotuzumab VedotinLEVEL_3ALEVEL_Fda3Telisotuzumab vedotin is an antibody-drug conjugate that targets the MET receptor. In the Phase II LUMINOSITY trial of telisotuzumab vedotin in 52 patients with nonsquamous, EGFR-wildtype non-small cell lung cancer (NSCLC), nineteen of 52 patients had a confirmed response, with an overall response rate of 36.5% (95% CI= 23.6, 51.0). In the MET-high group (n = 23), the overall response rate was 52.2% (95% CI= 30.6, 73.2), and in the MET-low group (n = 29), the overall response rate was 24.1 (95% CI= 10.3, 43.5) (Abstract: Camidge et al. Abstract# 9016, ASCO 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.16_suppl.9016).Non-Small Cell Lung CancerSOLIDLungErlotinibLEVEL_R2LEVEL_Fda3['30073261', '30676858', '18093943', '17463250']Erlotinib and gefitinib are first-generation small-molecule EGFR tyrosine kinase inhibitors. Multiple patients with non-small cell lung cancer harboring MET amplification in conjunction with EGFR mutation progressed on erlotinib or gefitinib (PMID: 18093943, 17463250). In two studies of patients with EGFR-mutated lung cancer that progressed on gefitinib, the presence of MET amplification was acquired in post-progression specimens in four and three samples, respectively (PMID: 17463250, 18093943). The effect of MET on drug sensitivity was confirmed in vitro in EGFR-mutated cell lines, and further analysis indicated that MET drives resistance through ERBB3-mediated activation of the PI3K pathway (PMID: 17463250, 18093943). Larger studies have demonstrated that MET amplification affects response to EGFR TKIs, including osimertinib (PMID: 30676858, 30073261)(Abstract: Michels et al. JCO PO, 2018. https://ascopubs.org/doi/full/10.1200/PO.18.00210). Notably, the presence of MET amplification in untreated lung cancer has also been observed (PMID: 18093943, 30676858).Non-Small Cell Lung CancerSOLIDLungGefitinibLEVEL_R2LEVEL_Fda3['30073261', '30676858', '18093943', '17463250']Erlotinib and gefitinib are first-generation small-molecule EGFR tyrosine kinase inhibitors. Multiple patients with non-small cell lung cancer harboring MET amplification in conjunction with EGFR mutation progressed on erlotinib or gefitinib (PMID: 18093943, 17463250). In two studies of patients with EGFR-mutated lung cancer that progressed on gefitinib, the presence of MET amplification was acquired in post-progression specimens in four and three samples, respectively (PMID: 17463250, 18093943). The effect of MET on drug sensitivity was confirmed in vitro in EGFR-mutated cell lines, and further analysis indicated that MET drives resistance through ERBB3-mediated activation of the PI3K pathway (PMID: 17463250, 18093943). Larger studies have demonstrated that MET amplification affects response to EGFR TKIs, including osimertinib (PMID: 30676858, 30073261)(Abstract: Michels et al. JCO PO, 2018. https://ascopubs.org/doi/full/10.1200/PO.18.00210). Notably, the presence of MET amplification in untreated lung cancer has also been observed (PMID: 18093943, 30676858).Non-Small Cell Lung CancerSOLIDLungOsimertinibLEVEL_R2LEVEL_Fda3['30073261', '30676858', '18093943', '17463250']Erlotinib and gefitinib are first-generation small-molecule EGFR tyrosine kinase inhibitors. Multiple patients with non-small cell lung cancer harboring MET amplification in conjunction with EGFR mutation progressed on erlotinib or gefitinib (PMID: 18093943, 17463250). In two studies of patients with EGFR-mutated lung cancer that progressed on gefitinib, the presence of MET amplification was acquired in post-progression specimens in four and three samples, respectively (PMID: 17463250, 18093943). The effect of MET on drug sensitivity was confirmed in vitro in EGFR-mutated cell lines, and further analysis indicated that MET drives resistance through ERBB3-mediated activation of the PI3K pathway (PMID: 17463250, 18093943). Larger studies have demonstrated that MET amplification affects response to EGFR TKIs, including osimertinib (PMID: 30676858, 30073261)(Abstract: Michels et al. JCO PO, 2018. https://ascopubs.org/doi/full/10.1200/PO.18.00210). Notably, the presence of MET amplification in untreated lung cancer has also been observed (PMID: 18093943, 30676858).Non-Small Cell Lung CancerSOLIDLung30073261;16461907;19117057;17667909;22869872;18077425;18093943;28481359;17463250Erlotinib,Gefitinib,Osimertinib30,2212,9
TUMORp.V600EENSP00000493543.1:p.Val600Gluchr7140753336ATPASSNM_004333missense_variantMODERATEBRAF15/18c.1799T>Ars113488022&CM112509&COSV56056643&COSV56065204&COSV56080151SNVdeleterious_low_confidence(0)probably_damaging(0.935)1.369e-061.16e-05gnomADe_SAS0.000.000.000.002.4500e-01Vascular_malformation&Lymphangioma&Malignant_neoplastic_disease&Cardiovascular_phenotype&Cystic_epithelial_invagination_containing_papillae_lined_by_columnar_epithelium&Melanoma&Cardio-facio-cutaneous_syndrome&Nephroblastoma&not_provided&RASopathy&Multiple_myeloma&Papillary_thyroid_carcinoma&Cerebral_arteriovenous_malformation&Nongerminomatous_germ_cell_tumor&Non-small_cell_lung_carcinoma&Astrocytoma&_low-grade&_somatic&Carcinoma_of_colonNC_000007.14:g.140753336A>Tcriteria_provided&_conflicting_classificationsConflicting_classifications_of_pathogenicityOncogeniccriteria_provided&_single_submitter3criteria_provided&_multiple_submittersTier_I_-_StrongBRAFV600Echr7:140753336-140753336v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot02/05/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicDabrafenib,Dabrafenib+Trametinib,Encorafenib+Binimetinib,Encorafenib+Cetuximab,Encorafenib+Cetuximab+FOLFOX Regimen,Tovorafenib,Trametinib,Vemurafenib,Vemurafenib+Atezolizumab+Cobimetinib,Vemurafenib+CobimetinibEncorafenib+Panitumumab,Selumetinib,Vemurafenib,Vemurafenib+Cobimetinib,DabrafenibVemurafenib,DabrafenibLEVEL_1LEVEL_1LEVEL_Dx255,450/1V600E0.45GRCh38BRAFAAT140753336BRAF_V600E.GT:AD:AF:DP0/1:55,45:0.45:100TENSG00000157764TranscriptENST00000646891protein_coding20251799600V/EgTg/gAg-1HGNCHGNC:1097YESMANE_SelectNM_004333.6P4CCDS5863.1ENSP00000493543P15056.261UPI000013DF26Ensembl1PDB-ENSP_mappings:1uwh.A&PDB-ENSP_mappings:1uwh.B&PDB-ENSP_mappings:1uwj.A&PDB-ENSP_mappings:1uwj.B&PDB-ENSP_mappings:2fb8.A&PDB-ENSP_mappings:2fb8.B&PDB-ENSP_mappings:3c4c.A&PDB-ENSP_mappings:3c4c.B&PDB-ENSP_mappings:3d4q.A&PDB-ENSP_mappings:3d4q.B&PDB-ENSP_mappings:3idp.A&PDB-ENSP_mappings:3idp.B&PDB-ENSP_mappings:3ii5.A&PDB-ENSP_mappings:3ii5.B&PDB-ENSP_mappings:3og7.A&PDB-ENSP_mappings:3og7.B&PDB-ENSP_mappings:3ppj.A&PDB-ENSP_mappings:3ppj.B&PDB-ENSP_mappings:3ppk.A&PDB-ENSP_mappings:3ppk.B&PDB-ENSP_mappings:3prf.A&PDB-ENSP_mappings:3prf.B&PDB-ENSP_mappings:3pri.A&PDB-ENSP_mappings:3pri.B&PDB-ENSP_mappings:3psb.A&PDB-ENSP_mappings:3psb.B&PDB-ENSP_mappings:3psd.A&PDB-ENSP_mappings:3psd.B&PDB-ENSP_mappings:3q4c.A&PDB-ENSP_mappings:3q4c.B&PDB-ENSP_mappings:3q96.A&PDB-ENSP_mappings:3q96.B&PDB-ENSP_mappings:3skc.A&PDB-ENSP_mappings:3skc.B&PDB-ENSP_mappings:3tv4.A&PDB-ENSP_mappings:3tv4.B&PDB-ENSP_mappings:3tv6.A&PDB-ENSP_mappings:3tv6.B&PDB-ENSP_mappings:4cqe.A&PDB-ENSP_mappings:4cqe.B&PDB-ENSP_mappings:4dbn.A&PDB-ENSP_mappings:4dbn.B&PDB-ENSP_mappings:4e26.A&PDB-ENSP_mappings:4e26.B&PDB-ENSP_mappings:4e4x.A&PDB-ENSP_mappings:4e4x.B&PDB-ENSP_mappings:4ehe.A&PDB-ENSP_mappings:4ehe.B&PDB-ENSP_mappings:4ehg.A&PDB-ENSP_mappings:4ehg.B&PDB-ENSP_mappings:4fc0.A&PDB-ENSP_mappings:4fc0.B&PDB-ENSP_mappings:4fk3.A&PDB-ENSP_mappings:4fk3.B&PDB-ENSP_mappings:4g9c.A&PDB-ENSP_mappings:4g9c.B&PDB-ENSP_mappings:4g9r.A&PDB-ENSP_mappings:4g9r.B&PDB-ENSP_mappings:4h58.A&PDB-ENSP_mappings:4h58.B&PDB-ENSP_mappings:4h58.C&PDB-ENSP_mappings:4jvg.A&PDB-ENSP_mappings:4jvg.B&PDB-ENSP_mappings:4jvg.C&PDB-ENSP_mappings:4jvg.D&PDB-ENSP_mappings:4ksp.A&PDB-ENSP_mappings:4ksp.B&PDB-ENSP_mappings:4ksq.A&PDB-ENSP_mappings:4ksq.B&PDB-ENSP_mappings:4mbj.A&PDB-ENSP_mappings:4mbj.B&PDB-ENSP_mappings:4mne.B&PDB-ENSP_mappings:4mne.C&PDB-ENSP_mappings:4mne.F&PDB-ENSP_mappings:4mne.G&PDB-ENSP_mappings:4mnf.A&PDB-ENSP_mappings:4mnf.B&PDB-ENSP_mappings:4pp7.A&PDB-ENSP_mappings:4pp7.B&PDB-ENSP_mappings:4r5y.A&PDB-ENSP_mappings:4r5y.B&PDB-ENSP_mappings:4rzv.A&PDB-ENSP_mappings:4rzv.B&PDB-ENSP_mappings:4rzw.A&PDB-ENSP_mappings:4rzw.B&PDB-ENSP_mappings:4wo5.A&PDB-ENSP_mappings:4wo5.B&PDB-ENSP_mappings:4xv1.A&PDB-ENSP_mappings:4xv1.B&PDB-ENSP_mappings:4xv2.A&PDB-ENSP_mappings:4xv2.B&PDB-ENSP_mappings:4xv3.A&PDB-ENSP_mappings:4xv3.B&PDB-ENSP_mappings:4xv9.A&PDB-ENSP_mappings:4yht.A&PDB-ENSP_mappings:4yht.B&PDB-ENSP_mappings:5c9c.A&PDB-ENSP_mappings:5c9c.B&PDB-ENSP_mappings:5csw.A&PDB-ENSP_mappings:5csw.B&PDB-ENSP_mappings:5csx.A&PDB-ENSP_mappings:5ct7.A&PDB-ENSP_mappings:5ct7.B&PDB-ENSP_mappings:5fd2.A&PDB-ENSP_mappings:5fd2.B&PDB-ENSP_mappings:5hi2.A&PDB-ENSP_mappings:5hid.A&PDB-ENSP_mappings:5hid.B&PDB-ENSP_mappings:5hie.A&PDB-ENSP_mappings:5hie.B&PDB-ENSP_mappings:5hie.C&PDB-ENSP_mappings:5hie.D&PDB-ENSP_mappings:5ita.A&PDB-ENSP_mappings:5ita.B&PDB-ENSP_mappings:5jrq.A&PDB-ENSP_mappings:5jrq.B&PDB-ENSP_mappings:5jsm.A&PDB-ENSP_mappings:5jsm.B&PDB-ENSP_mappings:5jsm.C&PDB-ENSP_mappings:5jsm.D&PDB-ENSP_mappings:5jt2.A&PDB-ENSP_mappings:5jt2.B&PDB-ENSP_mappings:5jt2.C&PDB-ENSP_mappings:5jt2.D&PDB-ENSP_mappings:5val.A&PDB-ENSP_mappings:5val.B&PDB-ENSP_mappings:5vam.A&PDB-ENSP_mappings:5vam.B&PDB-ENSP_mappings:6b8u.A&PDB-ENSP_mappings:6b8u.B&PDB-ENSP_mappings:6cad.A&PDB-ENSP_mappings:6cad.B&PDB-ENSP_mappings:6n0p.A&PDB-ENSP_mappings:6n0p.B&PDB-ENSP_mappings:6n0q.A&PDB-ENSP_mappings:6n0q.B&PDB-ENSP_mappings:6nsq.A&PDB-ENSP_mappings:6nsq.B&PDB-ENSP_mappings:6nyb.A&PDB-ENSP_mappings:6p3d.A&PDB-ENSP_mappings:6p7g.A&PDB-ENSP_mappings:6p7g.B&PDB-ENSP_mappings:6p7g.C&PDB-ENSP_mappings:6p7g.D&PDB-ENSP_mappings:6pp9.A&PDB-ENSP_mappings:6q0j.A&PDB-ENSP_mappings:6q0j.B&PDB-ENSP_mappings:6q0k.A&PDB-ENSP_mappings:6q0k.B&PDB-ENSP_mappings:6q0t.A&PDB-ENSP_mappings:6q0t.B&PDB-ENSP_mappings:6u2g.B&PDB-ENSP_mappings:6u2h.C&PDB-ENSP_mappings:6u2h.D&PDB-ENSP_mappings:6uan.B&PDB-ENSP_mappings:6uan.C&PDB-ENSP_mappings:6uuo.A&PDB-ENSP_mappings:6uuo.B&PDB-ENSP_mappings:6v2u.A&PDB-ENSP_mappings:6v2u.B&PDB-ENSP_mappings:6v2w.A&PDB-ENSP_mappings:6v34.A&PDB-ENSP_mappings:6v34.B&PDB-ENSP_mappings:6xag.C&PDB-ENSP_mappings:6xag.D&PDB-ENSP_mappings:6xfp.A&PDB-ENSP_mappings:6xlo.A&PDB-ENSP_mappings:6xlo.B&PDB-ENSP_mappings:7k0v.A&PDB-ENSP_mappings:7k0v.B&PDB-ENSP_mappings:7k0v.C&PDB-ENSP_mappings:7k0v.D&PDB-ENSP_mappings:7m0t.A&PDB-ENSP_mappings:7m0u.A&PDB-ENSP_mappings:7m0v.A&PDB-ENSP_mappings:7m0w.A&PDB-ENSP_mappings:7m0x.A&PDB-ENSP_mappings:7m0y.A&PDB-ENSP_mappings:7m0z.A&PDB-ENSP_mappings:7mfd.A&PDB-ENSP_mappings:7mfe.A&PDB-ENSP_mappings:7mff.A&PDB-ENSP_mappings:7mff.B&PDB-ENSP_mappings:7p3v.A&PDB-ENSP_mappings:7p3v.B&PDB-ENSP_mappings:7shv.A&PDB-ENSP_mappings:7shv.B&PDB-ENSP_mappings:7zr0.K&PDB-ENSP_mappings:7zr5.K&PDB-ENSP_mappings:7zr6.K&PDB-ENSP_mappings:8c7x.A&PDB-ENSP_mappings:8c7x.B&PDB-ENSP_mappings:8c7y.A&PDB-ENSP_mappings:8c7y.B&PDB-ENSP_mappings:8dgs.A&PDB-ENSP_mappings:8dgt.A&PDB-ENSP_mappings:8f7o.A&PDB-ENSP_mappings:8f7o.B&PDB-ENSP_mappings:8f7p.A&PDB-ENSP_mappings:8f7p.B&PDB-ENSP_mappings:8qqg.A&PDB-ENSP_mappings:8qqg.B&PDB-ENSP_mappings:8qqg.C&PDB-ENSP_mappings:9axx.B&PDB-ENSP_mappings:9axx.D&PDB-ENSP_mappings:9axy.A&PDB-ENSP_mappings:9bfb.A&Pfam:PF07714&Gene3D:1.10.510.10&PANTHER:PTHR44329&Superfamily:SSF56112&PROSITE_profiles:PS50011&CDD:cd14062&SMART:SM00220&AFDB-ENSP_mappings:AF-P15056-F10000009e-0701.16e-05pathogenic&not_provided&likely_pathogenic0&1&1&1&11&1&1&1&123757202&30089490&26900293&12460918&20619739&21107323&22773810&23614898&25032700&25157968&26619011&24144365&31752122&12960123&12068308&12460919&14679157&15035987&19001320&19010912&19018267&19238210&19404918&19537845&19561230&20350999&20413299&20630094&20735442&20818844&21129611&21156289&21163703&21426297&21483012&21639808&21683865&21975775&22038996&22048237&22180495&22281684&22351686&22356324&22389471&22448344&22536370&22586120&22608338&22649091&22663011&22735384&22743296&22805292&22972589&22997239&23020132&23031422&23251002&23325582&23470635&23524406&23549875&23812671&23833300&23845441&23918947&24107445&24163374&24388723&24576830&24583796&24586605&24594804&25024077&25370471&25989278&26678033&12198537&21107320&33076847&32184228&26090869&32843432&32238401&26310374&28607096&35311178&31371350&30770838&26513174&28556791&32933095&24512911&32770181&36733350&28708103&28282860&35904569&35820816&30797065&26909593&34667063&36866106&36686473&29043205&35582142&24670642&15001635&15356022&23302800&15342696&12670889&1244737FAIL622-1432BRAF139610.0000229000MONDO:MONDO:0024291&MedGen:C0158570&Human_Phenotype_Ontology:HP:0100764&MONDO:MONDO:0002013&MedGen:C0024221&Orphanet:2415&MONDO:MONDO:0004992&MedGen:C0006826&MedGen:CN230736&.&Human_Phenotype_Ontology:HP:0002861&Human_Phenotype_Ontology:HP:0002887&Human_Phenotype_Ontology:HP:0006777&Human_Phenotype_Ontology:HP:0007474&MONDO:MONDO:0005105&MeSH:D008545&MedGen:C0025202&MONDO:MONDO:0015280&MedGen:C1275081&OMIM:PS115150&Orphanet:1340&Human_Phenotype_Ontology:HP:0000115&Human_Phenotype_Ontology:HP:0002667&MONDO:MONDO:0006058&MeSH:D009396&MedGen:C0027708&Orphanet:654&MedGen:C3661900&MONDO:MONDO:0021060&MedGen:C5555857&Orphanet:536391&Human_Phenotype_Ontology:HP:0006775&MONDO:MONDO:0009693&MeSH:D009101&MedGen:C0026764&OMIM:254500&Orphanet:29073&Orphanet:85443&Human_Phenotype_Ontology:HP:0002895&MONDO:MONDO:0005075&MeSH:D000077273&MedGen:C0238463&Orphanet:146&Human_Phenotype_Ontology:HP:0002408&MONDO:MONDO:0007154&MedGen:C0917804&OMIM:108010&Orphanet:46724&MONDO:MONDO:0021656&MedGen:C1266158&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&MedGen:C2674727&MONDO:MONDO:0002032&MedGen:C0699790Pathogenic(3)&Likely_pathogenic(1)&Uncertain_significance(1)SCV000112810&SCV001450230&SCV004176942&SCV005022010&SCV005812663single_nucleotide_variantSO:0001483ClinGen:CA123643&Genetic_Testing_Registry_(GTR):GTR000522729&Genetic_Testing_Registry_(GTR):GTR000575664&Genetic_Testing_Registry_(GTR):GTR000575672&Genetic_Testing_Registry_(GTR):GTR000575677&Genetic_Testing_Registry_(GTR):GTR000613631&OMIM:164757.0001&UniProtKB:P15056#VAR_018629BRAF:673SO:0001583&missense_variantNeoplasm&Thyroid_gland_undifferentiated_(anaplastic)_carcinomaHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651&Human_Phenotype_Ontology:HP:0011779&MONDO:MONDO:0006468&MeSH:D065646&MedGen:C0238461&Orphanet:142SCV005094141113488022Diffuse_low-grade_glioma&_MAPK_pathwayaltered&Benign_metanephric_tumor&Dysembryoplastic_neuroepithelial_tumor&Malignant_peripheral_nerve_sheath_tumor&IDH-wildtype_glioblastoma&Diffuse_leptomeningeal_glioneuronal_tumor&Nodular_ganglioneuroblastoma&Polymorphous_low_grade_neuroepithelial_tumor_of_the_young&Epithelioid_Glioblastoma&Diffuse_midline_glioma&_H3_K27M-mutant&Melanoma&Ganglioglioma&Malignant_glioma&Spindle_cell_sarcoma&Embryonal_rhabdomyosarcoma&Pleomorphic_xanthoastrocytoma&Colorectal_cancer&Neuroblastoma&Papillary_thyroid_carcinoma&Alveolar_rhabdomyosarcoma&Pilocytic_astrocytomaMONDO:MONDO:0859614&MedGen:CN372173&MONDO:MONDO:0018738&MedGen:C5681098&Orphanet:464359&Human_Phenotype_Ontology:HP:0033703&MONDO:MONDO:0005505&MedGen:C1266177&Orphanet:251946&MONDO:MONDO:0017827&MedGen:C0751690&Orphanet:3148&MONDO:MONDO:0850335&MedGen:CN372125&MONDO:MONDO:0858956&MedGen:C4329735&MONDO:MONDO:0003325&MedGen:C1517445&MONDO:MONDO:0858959&MedGen:C5556330&MedGen:C4289580&MONDO:MONDO:0957196&MedGen:C4289688&Human_Phenotype_Ontology:HP:0002861&Human_Phenotype_Ontology:HP:0002887&Human_Phenotype_Ontology:HP:0006777&Human_Phenotype_Ontology:HP:0007474&MONDO:MONDO:0005105&MeSH:D008545&MedGen:C0025202&Human_Phenotype_Ontology:HP:0033664&MONDO:MONDO:0016733&MedGen:C0206716&Orphanet:251949&MONDO:MONDO:0100342&MedGen:C0555198&MONDO:MONDO:0002927&MedGen:C0205945&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&Human_Phenotype_Ontology:HP:0033682&MONDO:MONDO:0016690&MedGen:C0334586&Orphanet:251607&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500&Human_Phenotype_Ontology:HP:0003006&Human_Phenotype_Ontology:HP:0006738&MONDO:MONDO:0005072&MeSH:D009447&MedGen:C0027819&Orphanet:635&Human_Phenotype_Ontology:HP:0002895&MONDO:MONDO:0005075&MeSH:D000077273&MedGen:C0238463&Orphanet:146&Human_Phenotype_Ontology:HP:0006779&MONDO:MONDO:0009994&MedGen:C0206655&OMIM:268220&Orphanet:780&Orphanet:99756&Human_Phenotype_Ontology:HP:0033680&MONDO:MONDO:0016691&MedGen:C0334583&Orphanet:251612SCV004565360&SCV004565362&SCV005870910&SCV006312223&SCV007105098&SCV007105110&SCV007105118&SCV007105121&SCV007105125&SCV007105131&SCV007105133&SCV007105134&SCV007105140&SCV007105544&SCV007105546&SCV007105547&SCV0071055497:140753336-1407533361BRAFp.V600ETrueThe class I activating exon 15 BRAF V600E mutation is located in the kinase domain of the BRAF protein and is highly recurrent in melanoma, lung and thyroid cancer, among others (PMID: 28783719, 26091043, 25079552, 23833300, 25417114, 28783719, 12068308). This mutation has been comprehensively biologically characterized and has been shown to activate the downstream MAPK pathway independent of RAS (PMID: 15035987, 12068308, 19251651, 26343582), to render BRAF constitutively activated in monomeric form (PMID: 20179705), and to retain sensitivity to RAF monomer inhibitors such as vemurafenib and dabrafenib (PMID:26343582, 28783719, 20179705, 30351999).BRAF, an intracellular kinase, is frequently mutated in melanoma, thyroid and lung cancers among others.25417114|20179705|23833300|26091043|26343582|12068308|30351999|25079552|28783719|19251651|15035987V600E673BRAFGRCh38.MUTATION.The BRAF V600E mutation is known to be oncogenic.FalseLEVEL_Fda2The class I activating exon 15 BRAF V600E mutation is located in the kinase domain of the BRAF protein and is highly recurrent in melanoma, lung and thyroid cancer, among others (PMID: 28783719, 26091043, 25079552, 23833300, 25417114, 28783719, 12068308). This mutation has been comprehensively biologically characterized and has been shown to activate the downstream MAPK pathway independent of RAS (PMID: 15035987, 12068308, 19251651, 26343582), to render BRAF constitutively activated in monomeric form (PMID: 20179705), and to retain sensitivity to RAF monomer inhibitors such as vemurafenib and dabrafenib (PMID:26343582, 28783719, 20179705, 30351999).['25417114', '20179705', '23833300', '26091043', '26343582', '12068308', '30351999', '25079552', '28783719', '19251651', '15035987']LEVEL_Dx2['20519626', '30157397', '24938183', '26637772']This assertion is supported by (PMID: 24938183, 20519626, 30157397, 26637772).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidLEVEL_Dx2['23347903', '25480661', '22072557', '21910720', '22210875', '25120816', '22028477', '21663470', '26071465', '22531170']This assertion is supported by (PMID: 21663470, 25480661, 22072557, 22028477, 21910720, 22531170, 22210875, 23347903, 25120816, 26071465).Hairy Cell LeukemiaMature B-Cell NeoplasmsLIQUIDLymphoidLEVEL_Dx3['25422482', '26637772']This assertion is supported by (PMID: 25422482, 26637772).Erdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidLEVEL_Dx3['22237106']This assertion is supported by (PMID: 22237106).Early T-Cell Precursor Lymphoblastic LeukemiaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidDabrafenibLEVEL_1LEVEL_Fda2['22608338', '23051966', '22735384']Dabrafenib is an orally bioavailable RAF inhibitor that is FDA-approved for use in patients with BRAF V600E- and V600K-mutant metastatic melanoma. FDA approval is based on the randomized Phase III trial in which dabrafenib (150 mg orally twice daily) was compared with dacarbazine (1000 mg/m2 intravenously every three weeks) in 250 patients with BRAF V600E-mutated metastatic melanoma. Dabrafenib was associated with improved progression-free survival (median 5.1 months vs. 2.7 months with dacarbazine, hazard ratio = 0.30, p<0.0001) (PMID: 22735384). Dabrafenib may also be effective against brain metastases, as demonstrated by a Phase II trial in which approximately 40% of previously untreated and 30% of previously treated patients experienced an overall intracranial response and a separate trial in which nine out of ten patients had a reduction in the size of their brain metastases (PMID: 23051966, 22608338).MelanomaMelanomaSOLIDSkinDabrafenib + TrametinibLEVEL_1LEVEL_Fda2[{'id': 21, 'code': '', 'color': 'SaddleBrown', 'name': '', 'mainType': {'id': None, 'name': 'Colorectal Cancer', 'tumorForm': 'SOLID'}, 'tissue': 'Bowel', 'children': {}, 'parent': None, 'level': 0, 'tumorForm': 'SOLID'}]['32758030', '27283860', '23020132', '32818466', '25399551', '34838156']Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved in combination for the treatment of patients with solid tumors other than colorectal harboring BRAF V600E mutation. FDA approval was based on data from 131 adult patients with solid tumors treated with dabrafenib and trametinib in the BRF117019 and NCI-MATCH trials and 36 pediatric patients treated with dabrafenib and trametinib in the CTMT212X2101 study. Of the 131 adult patients treated with dabrafenib and trametinib, the overall response rate was 41% (54/131, 95% CI = 33-50) and of the 36 pediatric patients treated with dabrafenib and trametinib (low-grade glioma, n=34, high-grade glioma, n=2), the overall response rate was 25% (95% CI = 12-24) (PMID: 32818466, 34838156, 32758030)(Abstract: Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318/). In the randomized, Phase II study of dabrafenib and trametinib in 110 patients with BRAF V600mutant pediatric low-grade glioma (dabrafenib + trametinib treatment, n=37, carboplatin + vincristine treatment, n=37), the overall response rate was 47% (95% CI= 35%-59%) with dabrafenib and trametinib and 11% (95% CI= 3%-25%) with carboplatin and vincristine, and the progression-free survival was 20.1 months (95% CI= 12.8 mo-not estimable) with dabrafenib and trametinib and 7.4 months (95% CI= 3.6-11.8 mo) with carboplatin and vincristine (Abstract: Bouffet et al. Abstract# LBA2002, ASCO 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.17_suppl.LBA2002). FDA approval was supported by results in COMBI-d, COMBI-v and BRF113928 studies in melanoma and lung cancer (PMID: 23020132, 25399551, 27283860).All Solid TumorsSOLIDDabrafenib + TrametinibLEVEL_1LEVEL_Fda2['29072975']Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved alone or in combination for the treatment of patients with locally advanced or metastatic anaplastic thyroid cancer (ATC) with BRAF V600E mutation and with no satisfactory locoregional treatment options. FDA approval was based on results of the Phase II study of dabrafenib combined with trametinib in patients with BRAF V600E-positive ATC in which the overall response rate in sixteen evaluable patients was 69% (11/16, 95% CI= 41%-89%)(PMID: 29072975).Anaplastic Thyroid CancerThyroid CancerSOLIDThyroidDabrafenib + TrametinibLEVEL_1LEVEL_Fda2['32758030', '37059834', '27283860', '23020132', '32818466', '25399551', '34838156']Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved in combination for the treatment of patients with solid tumors other than colorectal harboring BRAF V600E mutation. FDA approval was based on data from 131 adult patients with solid tumors treated with dabrafenib and trametinib in the BRF117019 and NCI-MATCH trials and 36 pediatric patients treated with dabrafenib and trametinib in the CTMT212X2101 study. Of the 131 adult patients treated with dabrafenib and trametinib, the overall response rate was 41% (54/131, 95% CI = 33-50) and of the 36 pediatric patients treated with dabrafenib and trametinib (low-grade glioma, n=34, high-grade glioma, n=2), the overall response rate was 25% (95% CI = 12-24) (PMID: 32818466, 34838156, 32758030)(Abstract: Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318/). Approval was supported by results in COMBI-d, COMBI-v and BRF113928 studies in melanoma and lung cancer (PMID: 23020132, 25399551, 27283860). In the Phase II ROAR basket trial of dabrafenib + trametinib in patients with BRAF V600E-mutated rare cancers (biliary tract cancer, n=43), the overall response rate was 53%, the median progression-free survival was nine months (95% CI = 5.5, 9.4) and the median overall survival was 13.5 months (95% CI = 10.4, 17.6) (PMID: 37059834). Of the 43 patients with biliary tract cancer, 53% of patients (23/43) had a partial response and 37% (16/43) had stable disease (PMID: 37059834). Additionally, in subprotocol H of the NCI-MATCH basket trial of dabrafenib + trametinib in patients with BRAF V600E-mutant solid tumors (n=4 patients with intrahepatic cholangiocarcinoma), the overall response rate was 100%, with 4/4 patients achieving a partial response (PMID: 32758030).Biliary TractBiliary Tract CancerSOLIDBiliary TractDabrafenib + TrametinibLEVEL_1LEVEL_Fda2['32758030', '37059834', '27283860', '23020132', '32818466', '25399551', '34838156']Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved in combination for the treatment of patients with solid tumors other than colorectal harboring BRAF V600E mutation. FDA approval was based on data from 131 adult patients with solid tumors treated with dabrafenib and trametinib in the BRF117019 and NCI-MATCH trials and 36 pediatric patients treated with dabrafenib and trametinib in the CTMT212X2101 study. Of the 131 adult patients treated with dabrafenib and trametinib, the overall response rate was 41% (54/131, 95% CI = 33-50) and of the 36 pediatric patients treated with dabrafenib and trametinib (low-grade glioma, n=34, high-grade glioma, n=2), the overall response rate was 25% (95% CI = 12-24) (PMID: 32818466, 34838156, 32758030)(Abstract: Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318/). Approval was supported by results in COMBI-d, COMBI-v and BRF113928 studies in melanoma and lung cancer (PMID: 23020132, 25399551, 27283860). In the Phase II ROAR basket trial of dabrafenib + trametinib in patients with BRAF V600E-mutated rare cancers (biliary tract cancer, n=43), the overall response rate was 53%, the median progression-free survival was nine months (95% CI = 5.5, 9.4) and the median overall survival was 13.5 months (95% CI = 10.4, 17.6) (PMID: 37059834). Of the 43 patients with biliary tract cancer, 53% of patients (23/43) had a partial response and 37% (16/43) had stable disease (PMID: 37059834). Additionally, in subprotocol H of the NCI-MATCH basket trial of dabrafenib + trametinib in patients with BRAF V600E-mutant solid tumors (n=4 patients with intrahepatic cholangiocarcinoma), the overall response rate was 100%, with 4/4 patients achieving a partial response (PMID: 32758030).Hepatobiliary CancerSOLIDMIXEDDabrafenib + TrametinibLEVEL_1LEVEL_Fda2['37733309']Dabrafenib, a small molecule RAF inhibitor, and trametinib, a small molecule MEK1/2 inhibitor, are FDA-approved in combination for the treatment of pediatric patients 1 year of age and older with low-grade glioma (LGG) with a BRAF V600E mutation who require systemic therapy. FDA approval is based on the results of the Phase II Study CDRB436G2201 (NCT02684058) of dabrafenib plus trametinib versus carboplatin plus vincristine in 110 patients with BRAF V600-mutant LGG, as assessed by local or central laboratory tests. In the Phase II Study CDRB436G2201 (NCT02684058), the dabrafenib plus trametinib cohort (n=73 [n=70, V600E, n=3, other]) demonstrated an overall response rate (ORR) of 47% (95% CI=35-59), with a 3% (n=2) complete response (CR) rate, a 44% (n=32) partial response (PR) rate and a 41% (n=30) stable disease (SD) rate, and a median duration of response (DOR) of 20.3 months (95% CI=12.0-NE) while the chemotherapy cohort (n=37 [n=35, V600E, n=1, other, n=1, nonmutant]) demonstrated an ORR of 11% (95% CI=3-25) (OR=7.19 [95% CI=2.30-22.40], RR=4.31 [95% CI=1.70-11.20], p<0.001), with a 3% (n=1) CR rate, an 8% (n=3) PR rate and a 41% (n=15) SD rate, and a median DOR that was not estimable (95% CI=6.6-NE) (PMID: 37733309).Low-Grade Glioma, NOSGliomaSOLIDCNS/BrainDabrafenib + TrametinibLEVEL_1LEVEL_Fda2['31171876', '28891408', '31171878', '31171879', '25265492', '25287827', '29361468', '28991513', '23020132', '25399551']Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved alone or in combination for the treatment of patients with metastatic melanoma harboring a V600E or V600K BRAF mutation. FDA approval of dabrafenib in combination with trametinib was based on results from an open-label Phase III study of combination therapy versus dabrafenib monotherapy in 247 patients with metastatic melanoma who were naive to treatment with BRAF inhibitors. Combined dabrafenib and trametinib, administered in full monotherapy doses, improved the response rate in patients with BRAF V600-mutant metastatic melanoma versus dabrafenib monotherapy (67% vs.51%, p<0.002). However, median progression-free survival improved by only 2 weeks (9.3 months vs 8.8 months, HR = 0.75) compared with dabrafenib monotherapy (PMID: 23020132). Combination therapy is associated with less cutaneous toxicity than monotherapy, but systemic toxicity may be increased (PMID: 25287827, 25399551). Follow-up trials have demonstrated that all clinical measures inclusive of overall and median progression-free survival as well as objective response rates, median duration of response and number of patients with complete response favored patients treated with combination dabrafenib and trametinib, administered in full monotherapy doses, compared to either dabrafenib or vemurafenib monotherapy, including patients who previously progressed on BRAF inhibitor monotherapy (PMID: 25287827, 25399551, 25265492). Additionally, patients with melanoma treated with dabrafenib and trametinib in both the neoadjuvant and adjuvant settings have improved survival over patients given standard of care (PMID: 29361468, 28991513, 28891408). Promising clinical data has also suggested that addition of an immunotherapy agent to combination RAF and MEK inhibitor treatment may improve rate of overall response and duration of response in melanoma patients (PMID: 31171876, 31171879, 31171878).MelanomaMelanomaSOLIDSkinDabrafenib + TrametinibLEVEL_1LEVEL_Fda2['28919011', '27283860']Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved alone or in combination for the treatment of patients with metastatic non-small cell lung cancer (NSCLC) with BRAF V600E mutation. FDA approval was based on a Phase II, multicenter, non-randomized, open-label study of dabrafenib in combination with trametinib in patients with chemotherapy-pretreated, metastatic, stage IV BRAF(V600E)-mutant non-small cell lung cancer, in which 36 of 57 patients (63%) achieved overall tumor response, with two patients experiencing durable complete responses and 34 patients having durable partial responses (PMID: 27283860). In the third arm of that study, which included patients with untreated, metastatic, stage IV BRAF(V600E)-mutant non-small cell lung cancer, 23 of 26 patients (64%, 95% CI 46-79) had an overall response, with two patients (6%) having durable complete response and 21 (58%) having partial response (PMID: 28919011).Non-Small Cell Lung CancerSOLIDLungEncorafenib + BinimetinibLEVEL_1LEVEL_Fda2['29573941', '35862871']The combination of encorafenib, an inhibitor of V600E- or V600K-mutant BRAF, and binimetinib, an inhibitor of MEK1/2, is FDA-approved in combination for patients with unresectable or metastatic melanoma with a BRAF V600E or V600K mutation. FDA approval was based on the results of the Phase III COLUMBUS trial of combined encorafenib plus binimetinib versus single-agent vemurafenib in 577 patients with BRAF V600E- or V600K-mutant metastatic melanoma in which the median progression-free survival was 14.9 months (95% CI = 11.0-18.5) in the encorafenib plus binimetinib group versus 7.3 months (95% CI = 5.6-8.2) in the single agent vemurafenib group (HR= 0.54, 95% CI = 0.41-0.71, p<00001) (PMID: 29573941). In the five-year update of the Phase III COLUMBUS trial, the progression-free survival and overall survival were 23% and 35% respectively in the encorafenib plus binimetinib group (n=192) versus 10% and 21% respectively in the single agent vemurafenib group (n=191), and the median duration of response and disease control rate were 18.6 months and 92.2% in the encorafenib plus binimetinib group versus 12.3 months and 81.2% in the single-agent vemurafenib group (PMID: 35862871).MelanomaMelanomaSOLIDSkinEncorafenib + BinimetinibLEVEL_1LEVEL_Fda2['37270692']Encorafenib, a small molecule inhibitor of RAF kinases, and binimetinib, a small molecule inhibitor of MEK1/2 kinases, are FDA-approved in combination for the treatment of patients with BRAF V600E mutant non-small cell lung cancer (NSCLC). FDA approval was based on the Phase II, open-label, multicenter, single-arm PHAROS study of encorafenib in combination with binimetinib in treatment-nave (n=59) and previously treated (n=39) patients with BRAF V600E-mutant metastatic NSCLC (PMID: 37270692). In the Phase II PHAROS study, the objective response rate and duration of response for treatment-nave patients were 72% (95% CI=62, 85) and 44 months (95% CI=23.1, NE), with 15% experiencing a complete response and 59% experiencing a partial response, compared to 46% (95% CI=30, 63) and 18 months (95% CI=7.4, NE) in previously treated patients, with 10% experiencing a complete response and 36% experiencing a partial response (PMID: 37270692).Non-Small Cell Lung CancerSOLIDLungEncorafenib + CetuximabLEVEL_1LEVEL_Fda2['31566309']Encorafenib, a small molecule RAF-targeted inhibitor, and cetuximab, an anti-EGFR antibody, are FDA-approved in combination for the treatment of adult patients with metastatic CRC with a BRAF V600E mutation, as detected by an FDA-approved test, after prior therapy. BRAF V600E mutations for treatment with encorafenib plus cetuximab were detected by the FoundationOne Liquid CDx, the MI Cancer Seek assay or the therascreen BRAF V600E RGQ PCR Kit. FDA approval was based on results of the Phase III BEACON (NCT02928224) study of encorafenib plus cetuximab (n=220) versus triplet treatment (including a MEK1/2 inhibitor) versus chemotherapy (n=221) in 665 patients with BRAF V600E-mutant colorectal cancer. __In the Phase III BEACON (NCT02928224) trial, the overall response rate (complete or partial response) was 20% (95% CI=13-29) in the doublet arm versus 2% (95% CI=<1%-7%) in the chemotherapy arm (n=221), with median overall survival of 8.4 months in the doublet arm (95% CI= 7.5-11.0) and 5.4 months in the chemotherapy arm (95% CI= 4.8-6.6) (PMID: 31566309).Colorectal CancerSOLIDBowelEncorafenib + Cetuximab + FOLFOX RegimenLEVEL_1LEVEL_Fda2['39863775', '40444708']Encorafenib, a small molecule RAF-targeted inhibitor, and cetuximab, an anti-EGFR antibody, are FDA-approved in combination with FOLFOX6 for the treatment of patients with metastatic colorectal cancer (mCRC) with a BRAF V600E mutation, as detected by an FDA-approved test. BRAF V600E mutations were detected by the therascreen BRAF V600E RGQ PCR Kit. FDA approval was based on the results of the Phase III BREAKWATER (NCT04607421) trial of encorafenib plus cetuximab versus encorafenib plus cetuximab with FOLFOX6 versus standard-of-care in 479 patients with BRAF V600E-mutant mCRC.__In the Phase III BREAKWATER (NCT04607421) trial, the cohort treated with encorafenib plus cetuximab with FOLFOX6 (n=110) demonstrated an overall response rate (ORR) of 60.9% (95% CI=51.6-69.5), with a 2.7% (n=3) complete response (CR) rate, 58.2% (n=64) partial response (PR) rate and 28.2% (n=31) stable disease (SD) rate. The median duration of response (DOR) for this cohort was 13.9 months (95% CI=8.5-NE), with a median progression free survival (mPFS) of 12.8 months (95%CI=11.2-15.9), and a median overall survival (mOS) of 30.3 months (95% CI= 21.7-NE)(PMID: 39863775, 40444708). The cohort that received standard-of-care (n=110) demonstrated an ORR of 40.0% (95% CI=31.3-49.3) (odds ratio=2.443 [95% CI=1.403-4.253, 99.8% CI=1.019-5.855], p=0.0008), with a 1.8% (n=2) CR rate, 38.2% (n=42) PR rate and 30.9% (n=34) SD rate. For this cohort, the median DOR was 11.1 months (95% CI=6.7-12.7), with a mPFS of 7.1 months (95% CI= 6.8-8.5) (hazard ratio [HR] 0.53 [95% CI= 0.41-0.68], p-value <0.0001), and a mOS of 15.1 months (95% CI= 13.7-17.7) (HR 0.49 [95% CI= 0.38-0.63), p-value <0.0001) (PMID: 39863775, 40444708). __The Phase III BREAKWATER (NCT04607421) trial also included Cohort 3 (n=147) which compared encorafenib plus cetuximab with FOLFIRI versus FOLFIRI with or without bevicuzumab for patients with BRAF V600E-mutant mCRC. The encorafenib plus cetuximab with FOLFIRI arm (n=73) demonstrated an ORR of 64.4% (95% CI=53-74), a median DOR that was not evaluable (95%CI= NE-NE) with 57.4% of patients with a DOR of 6 months, and a mOS that was also not evaluable (95% CI=NE-NE). The FOLFIRI with or without bevicuzumab arm (n=74) demonstrated an ORR of 39.2% (95% CI=29-51)(odds ratio 2.76 [95%CI=1.42-5.35] p-value = 0.0011), a median DOR that was not evaluable (95%CI=7.0-NE) with 34.5% of patients with a DOR of 6 months, and a mOS that was also not evaluable (95%CI=NE-NE)(HR 0.49 [95%CI=0.24-1.03])(Abstract: Kopetz S., et al. Abstract#13. ASCO 2026. https://ascopubs.org/doi/10.1200/JCO.2026.44.2_suppl.13).Colorectal CancerSOLIDBowelTovorafenibLEVEL_1LEVEL_Fda2['37978284']Tovorafenib is an orally available, pan-RAF small molecule inhibitor that is FDA-approved for the treatment of pediatric patients six months of age and older with relapsed or refractory pediatric low-grade glioma (LGG) harboring a BRAF fusion or rearrangement, or BRAF V600 mutation. FDA approval was based on the results of the Phase II FIREFLY-1 (NCT04775485) trial of tovorafenib in 76 patients (median age=8 years old [range=2-21]) with relapsed or refractory pediatric LGG harboring an activating BRAF alteration based on local laboratory testing. In the Phase II FIREFLY-1 (NCT04775485) trial, the overall RAPNO-LGG cohort demonstrated an objective response rate (ORR) of 51% (95% CI=40-63), with a 37% (n=28) partial response rate and 14% (n=11) minor response rate, a median duration of response (DOR) of 13.8 months (95% CI=11.3-NE) in 39 patients and a median progression-free survival of 13.8 months (95% CI=8.3-16.9) (PMID: 37978284). The BRAF V600E mutation subcohort (n=12) demonstrated an ORR of 50% (95% CI=21-79) and a median DOR that was not evaluable (95% CI=8.4-NE) (PMID: 37978284).Low-Grade Glioma, NOSGliomaSOLIDCNS/BrainTrametinibLEVEL_1LEVEL_Fda2['29361468', '25399551', '22663011', '25265492']Trametinib is an oral small molecule inhibitor of MEK1/2 that is FDA-approved alone or with dabrafenib for the treatment of patients with metastatic melanoma harboring a V600E or V600K BRAF mutation. In an open-label, randomized Phase III trial, patients with BRAF V600E/K-mutated unresectable, metastatic melanoma received oral trametinib (2 mg once daily) or an intravenous regimen of either dacarbazine (1000 mg/m2) or paclitaxel (175 mg/m2) every three weeks. Trametinib demonstrated improved progression-free survival (HR for disease progression or death = 0.45) and six-month overall survival (81% vs. 67%, death HR = 0.54, p=0.01) (PMID: 22663011). However, like other MEK inhibitors, the benefit of trametinib is limited by adverse reactions, most notably grade three or four rash and diarrhea (PMID: 22663011). Trametinib is not typically used as monotherapy for patients with BRAF V600K melanoma given its lower response rate compared to BRAF inhibitors and combined BRAF and MEK inhibitors. Patients previously treated with a RAF inhibitor appear to be less likely than untreated patients to respond to trametinib treatment (PMID: 22663011), and FDA guidelines state that trametinib as a monotherapy is not indicated for these patients. Dabrafenib and trametinib are FDA-approved as a combination therapy, which has superior clinical outcomes compared to dabrafenib or trametinib monotherapy (PMID: 25399551, 25265492). Additionally, patients with melanoma treated with dabrafenib and trametinib in both the neoadjuvant and adjuvant settings had improved survival over patients given standard of care (PMID: 29361468).MelanomaMelanomaSOLIDSkinVemurafenibLEVEL_1LEVEL_Fda2['26287849', '29188284']Vemurafenib is an orally available, small molecule RAF-targeted inhibitor that is FDA-approved for the treatment of patients with Erdheim-Chester disease (ECD) with BRAF V600 mutation. FDA approval was based on the results of the Phase II VE-BASKET (NCT01524978) trial of vemurafenib in 26 patients with BRAF V600-mutant non-melanoma cancers (n=22, ECD, n=4, Langerhans cell histiocytosis [LCH])._In the Phase II VE-BASKET (NCT01524978) trial, the ECD cohort demonstrated an overall response rate of 54.5% (12/22) (95% CI=32.2-75.6), with one patient (4.5%) achieving complete response and eleven patients (50%) achieving partial response, and the median progression-free survival and overall survival were not reached (PMID: 29188284, 26287849).Erdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidVemurafenibLEVEL_1LEVEL_Fda2['28961848', '24508103', '25399551']Vemurafenib is an orally available kinse inhibitor of V600-mutant BRAF that is FDA-approved for treatment of patients with unresectable or metastatic melanoma with the BRAF V600E mutation. Vemurafenib has been shown to have nearly equivalent activity against melanomas with BRAF V600E and V600K mutations (PMID: 24508103). In a randomized Phase III trial comparing vemurafenib (960 mg orally twice daily) with dacarbazine (1000 mg/m2 i.v. every 3 weeks) for treatment-naive, metastatic, BRAF V600E-mutant melanoma, vemurafenib was associated with better overall survival (median survival 13.6 months vs. 9.7 months, hazard ratio 0.70, p=.0008) and longer median progression-free survival (6.9 months vs. 1.6 months) (PMID: 24508103). Final overall survival data from the BRIM-3 study showed that the survival advantage of vemurafenib over dacarbazine persisted through the 4-year landmark, with survival rates for vemurafenib and dacarbazine at the 4-year landmark being 17.0% and 15.6%, respectively (PMID: 28961848). However, a trial evaluating clinical outcomes in patients with melanoma treated with either combination therapy of dabrafenib and trametinib compared to those treated with vemurafenib monotherapy demonstrated improved survival outcomes in the combination-therapy group compared to the vemurafenib group (PMID: 25399551).MelanomaMelanomaSOLIDSkinVemurafenib + Atezolizumab + CobimetinibLEVEL_1LEVEL_Fda2['32534646']The combination of vemurafenib, an inhibitor of V600-mutant BRAF, and cobimetinib, an inhibitor of MEK1/2, with atezolizumab, an immunotherapeutic PD-L1 antibody, is FDA-approved for patients with BRAF V600 mutation-positive unresectable or metastatic melanoma. FDA approval was based on the results of the Phase III double-blind, randomized, placebo-controlled IMspire150 trial of Atezolizumab + Cobimetinib + Vemurafenib versus Placebo + Cobimetinib + Vemurafenib in 514 patients with BRAF V600-mutant melanoma in which the median progression-free survival was 15.1 mos (95% CI=11.4,18.4) in the triplet arm versus 10.6 mos (95% CI=9.3,12.7) in the doublet + placebo arm (HR=0.78, 95% CI= 0.63, 0.97, p=0.0249) (PMID: 32534646).MelanomaMelanomaSOLIDSkinVemurafenib + CobimetinibLEVEL_1LEVEL_Fda2['27480103', '31732523', '25265494']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for the treatment of patients with BRAF V600-mutant metastatic or unresectable locally advanced melanoma. FDA approval was based on results from the randomized Phase III coBRIM trial of combined vemurafenib and cobimetinib versus vemurafenib and placebo in 495 patients with metastatic BRAF V600-mutant melanoma that demonstrated superior clinical benefit measures in the combination versus the control arm. Specifically, median progression-free survival was 9.9 months in the combination arm versus 6.2 months in the control arm (HR = 0.51), with a complete response rate of 10% versus 4%, respectively, and interim nine-month overall survival of 81% versus 73%, respectively (PMID: 25265494). Follow-up analysis of the coBRIM trial showed two-year overall survival was 48.3% in the combination group versus 38.0% in the monotherapy group (PMID: 27480103), and five-year followup of the BRIM7 study showed a median overall survival of 31.8 months and a five-year survival rate of 39.2% (PMID: 31732523).MelanomaMelanomaSOLIDSkinEncorafenib + PanitumumabLEVEL_2LEVEL_Fda2['29431699', '31566309']Encorafenib, a small molecule inhibitor of RAF kinase, and panitumumab, an antibody that targets EGFR, are NCCN-compendium listed in combination as level 2A therapy for patients with BRAF V600E-positive colorectal cancer. In the Phase III BEACON study of encorafenib + cetuximab, another EGFR antibody, versus triplet treatment (including a MEK1/2 inhibitor) versus chemotherapy in 665 patients with BRAF V600E-mutant colorectal cancer, the overall response rate (complete or partial response) was 20% (95% CI= 13-29) in the doublet arm (n=220) versus 2% (95% CI= <1%-7%) in the chemotherapy arm (n=221), with median overall survival of 8.4 months in the doublet arm (95% CI= 7.5-11.0) and 5.4 months in the control arm (95% CI= 4.8-6.6) (PMID: 31566309). Panitumumab has also been used in doublet and triplet combination therapy, with a response rate in one study of 26% (PMID: 29431699).Colorectal CancerSOLIDBowelSelumetinibLEVEL_2LEVEL_Fda2['31151904']Selumetinib is a small molecule tyrosine kinase inhibitor of MEK1/2. In stratum one of the phase II PBTC study of selumetinib in 25 patients with pilocytic astrocytoma harboring a KIAA1549BRAF fusion or BRAF V600E mutation, seven of eighteen patients with a KIAA1549BRAF fusion had a partial response to treatment (PMID: 31151904). Additionally, the two year progression-free survival rate for the BRAF study population (n=25) was 70% (95% CI = 4785) (PMID: 31151904).Pilocytic AstrocytomaGliomaSOLIDCNS/BrainVemurafenibLEVEL_2LEVEL_Fda2['26352686']Vemurafenib is an orally available kinse inhibitor of V600-mutant BRAF that is FDA-approved for treatment of patients with various BRAF V600-harboring tumors, including melanoma and Edheim-Chester Disease (ECD). Vemurafenib is listed as a 2A therapeutic in the NCCN guidelines for Hairy Cell Leukemia (HCL) based on data from two Phase II trials. In one study of vemurafenib in patients with BRAF V600E-mutant HCL (n=24), the overall response rate was 100%, with 42% of patients (10 of 24) having complete responses, with a response duration of 11.7 months and one year progression free and overall survival rates of 73% and 91%, repectively (PMID: 26352686). In another study of vemurafenib in patients with BRAF V600E-mutant HCL (n=26), the overall response rate was 96%, with 35% of patients (9 of 26) having complete responses (PMID: 26352686).Hairy Cell LeukemiaMature B-Cell NeoplasmsLIQUIDLymphoidVemurafenibLEVEL_2LEVEL_Fda3['32985015', '29188284', '30154124']Vemurafenib is an orally available, small molecule RAF-targeted inhibitor that is FDA-approved for the treatment of patients with Erdheim-Chester disease (ECD) with BRAF V600 mutation. Vemurafenib and dabrafenib are listed as monotherapies in the NCCN Histiocytic Neoplasms Guidelines (V3.2024) under the section "Principles of Systemic Therapy" as recommended treatment regimens for patients with Langerhans cell histiocytosis (LCH) harboring BRAF V600E mutations. NCCN recommendation was based on the results of the Phase II VE-BASKET (NCT01524978) and case reports._In the Phase II VE-BASKET (NCT01524978) trial, all four patients of the LCH cohort achieved partial response (PMID: 29188284). In the case series evaluating the use of BRAF inhibitors in six adult patients with BRAF V600Emutant LCH, patients treated with vemurafenib monotherapy (n=3) achieved one complete response (CR), one partial response (PR) and one stable disease (SD) response while patients treated with dabrafenib monotherapy (n=3) achieved one CR and two PRs (PMID: 32985015). In a separate case report, a patient with BRAF V600E-mutant LCH was treated with dabrafenib plus trametinib and demonstrated a sustained metabolic response (PMID: 30154124).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidVemurafenib + CobimetinibLEVEL_2LEVEL_Fda3[{'id': 857, 'code': 'DMG', 'color': 'Gray', 'name': 'Diffuse Midline Glioma, H3 K27-Altered', 'mainType': {'id': None, 'name': 'Gliomas, Glioneuronal Tumors, and Neuronal Tumors', 'tumorForm': 'SOLID'}, 'tissue': 'CNS/Brain', 'children': {}, 'parent': 'PDIFHG', 'level': 4, 'tumorForm': 'SOLID'}, {'id': 534, 'code': 'GNOS', 'color': 'Gray', 'name': 'Glioma, NOS', 'mainType': {'id': None, 'name': 'Glioma', 'tumorForm': 'SOLID'}, 'tissue': 'CNS/Brain', 'children': {}, 'parent': 'DIFG', 'level': 3, 'tumorForm': 'SOLID'}]['24725538', '29039591', '30462564', '34232949', '29621181', '30351999', '26287849', '33117675']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for patients with BRAF V600E-positive melanoma, non-small cell lung cancer, and anaplastic thyroid cancer, and is NCCN-listed for patients with low-grade glioma, anaplastic glioma, and glioblastoma. Patients with various glioma subtypes harboring BRAF V600E mutations have shown responses to RAF and MEK inhibition. Three out of five patients with anaplastic astrocytoma had a response (one partial response, two stable disease) to vemurafenib monotherapy (PMID: 30351999). One patient with high-grade glioma (NOS) had stable disease in response to vemurafenib monotherapy (PMID:30351999). Four out of eight patients with glioma (NOS) had a response (one partial response, three stable disease, two progressive disease, two not evaluable) to vemurafenib monotherapy (PMID: 26287849). One patient with anaplastic oligoastrocytoma had stable disease in response to vemurafenib monotherapy (PMID: 30462564). Four of seven patients with glioblastoma multiforme had a response (one complete response, three stable disease, one progressive disease, two not evaluable) to vemurafenib monotherapy (PMID: 30351999, 24725538). Four patients with glioblastoma (including epithelioid glioblastoma) had a response (one near-complete response, three stable disease) to either dabrafenib monotherapy (n=2) or vemurafenib monotherapy (n=2) (PMID: 29621181, 29039591, 33117675, 34232949).Diffuse GliomaGliomaSOLIDCNS/BrainVemurafenib + CobimetinibLEVEL_2LEVEL_Fda3['25524464', '29039591', '31985841', '25092772', '31502039', '27398937', '29380516', '28984141', '24821190', '30351999', '26579623', '26287849']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for patients with melanoma, non-small cell lung cancer, and anaplastic thyroid cancer, and is NCCN-listed for patients with low-grade glioma, anaplastic glioma, and glioblastoma. Patients with various glioma subtypes harboring BRAF V600E mutations have shown responses to RAF and MEK inhibition. Six patients with ganglioglioma had a partial response to either vemurafenib monotherapy (n=2), vemurafenib + cobimetinib (n=1), or dabrafenib monotherapy (n=3)(PMID: 25524464, 31985841, 26579623, 31502039). Twelve out of thirteen patients with pleomorphic xanthoastrocytoma had a response (one complete response, one near-complete response, six partial response, four stable disease) to either dabrafenib + trametinib (n=2) or vemurafenib monotherapy (n=11) (PMID: 28984141, 26287849, 30351999). Three patients with anaplastic pleomorphic xanthoastrocytoma had a response (one complete response, one near-complete response, one partial response) to either vemurafenib monotherapy (n=1) or dabrafenib monotherapy (n=2)(PMID: 25092772, 29039591). One patient with low-grade glioma, NOS had a partial response to dabrafenib monotherapy (PMID: 27398937). Two patients with pilocytic astrocytoma had a response (one partial response, one stable disease) to vemurafenib monotherapy (PMID: 30351999). Three of four patients with anaplastic ganglioglioma had a response (one partial response, one "significant response", one stable disease, one not evaluable) to either dabrafenib + trametinib (n=1) or vemurafenib monotherapy (n=3)(PMID: 29380516, 30351999). One patient with pilomyxoid astrocytoma had a partial response to vemurafenib monotherapy (PMID: 24821190).Encapsulated GliomaGliomaSOLIDCNS/BrainVemurafenib + CobimetinibLEVEL_2LEVEL_Fda3['30120137', '29380516', '28984141']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for patients with melanoma, non-small cell lung cancer, and anaplastic thyroid cancer, and is NCCN-compendium listed as recommended treatment of central nervous system cancers such as pilocytic astrocytoma, pleomorphic xanthoastrocytoma (PXA) and ganglioglioma. In a case series of two patients with BRAF V600E-mutant PXA, combination treatment of dabrafenib with trametinib led to partial responses by RANO criteria in both patients (PMID: 28984141). In a case report of a sixteen-year-old female with BRAF V600E-mutant anaplastic ganglioglioma, dabrafenib and trametinib in combination led to a significant response that was maintained at least six months after treatment initiation (PMID: 29380516). In a separate case report of a 28-year-old man with BRAF V600E-mutant anaplastic ganglioglioma, combination treatment of vemurafenib and cobimetinib led to a complete response after three months, with no evidence of recurrence after sixteen months of treatment (PMID: 30120137).Pleomorphic XanthoastrocytomaGliomaSOLIDCNS/BrainVemurafenib + CobimetinibLEVEL_2LEVEL_Fda3['30120137', '29380516', '28984141']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for patients with melanoma, non-small cell lung cancer, and anaplastic thyroid cancer, and is NCCN-compendium listed as recommended treatment of central nervous system cancers such as pilocytic astrocytoma, pleomorphic xanthoastrocytoma (PXA) and ganglioglioma. In a case series of two patients with BRAF V600E-mutant PXA, combination treatment of dabrafenib with trametinib led to partial responses by RANO criteria in both patients (PMID: 28984141). In a case report of a sixteen-year-old female with BRAF V600E-mutant anaplastic ganglioglioma, dabrafenib and trametinib in combination led to a significant response that was maintained at least six months after treatment initiation (PMID: 29380516). In a separate case report of a 28-year-old man with BRAF V600E-mutant anaplastic ganglioglioma, combination treatment of vemurafenib and cobimetinib led to a complete response after three months, with no evidence of recurrence after sixteen months of treatment (PMID: 30120137).GangliogliomaGliomaSOLIDCNS/BrainVemurafenib + CobimetinibLEVEL_2LEVEL_Fda3['30120137', '29380516', '28984141']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for patients with melanoma, non-small cell lung cancer, and anaplastic thyroid cancer, and is NCCN-compendium listed as recommended treatment of central nervous system cancers such as pilocytic astrocytoma, pleomorphic xanthoastrocytoma (PXA) and ganglioglioma. In a case series of two patients with BRAF V600E-mutant PXA, combination treatment of dabrafenib with trametinib led to partial responses by RANO criteria in both patients (PMID: 28984141). In a case report of a sixteen-year-old female with BRAF V600E-mutant anaplastic ganglioglioma, dabrafenib and trametinib in combination led to a significant response that was maintained at least six months after treatment initiation (PMID: 29380516). In a separate case report of a 28-year-old man with BRAF V600E-mutant anaplastic ganglioglioma, combination treatment of vemurafenib and cobimetinib led to a complete response after three months, with no evidence of recurrence after sixteen months of treatment (PMID: 30120137).Pilocytic AstrocytomaGliomaSOLIDCNS/BrainDabrafenibLEVEL_2LEVEL_Fda3['32985015', '29188284', '30154124']Vemurafenib is an orally available, small molecule RAF-targeted inhibitor that is FDA-approved for the treatment of patients with Erdheim-Chester disease (ECD) with BRAF V600 mutation. Vemurafenib and dabrafenib are listed as monotherapies in the NCCN Histiocytic Neoplasms Guidelines (V3.2024) under the section "Principles of Systemic Therapy" as recommended treatment regimens for patients with Langerhans cell histiocytosis (LCH) harboring BRAF V600E mutations. NCCN recommendation was based on the results of the Phase II VE-BASKET (NCT01524978) and case reports._In the Phase II VE-BASKET (NCT01524978) trial, all four patients of the LCH cohort achieved partial response (PMID: 29188284). In the case series evaluating the use of BRAF inhibitors in six adult patients with BRAF V600Emutant LCH, patients treated with vemurafenib monotherapy (n=3) achieved one complete response (CR), one partial response (PR) and one stable disease (SD) response while patients treated with dabrafenib monotherapy (n=3) achieved one CR and two PRs (PMID: 32985015). In a separate case report, a patient with BRAF V600E-mutant LCH was treated with dabrafenib plus trametinib and demonstrated a sustained metabolic response (PMID: 30154124).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidVemurafenibLEVEL_3ALEVEL_Fda3['31376203', '31213430', '25209580']Vemurafenib is an orally available, small molecule RAF-targeted inhibitor that is FDA-approved for the treatment of patients with Erdheim-Chester disease (ECD) with BRAF V600 mutation. Vemurafenib and dabrafenib are listed as monotherapies in the NCCN Histiocytic Neoplasms Guidelines (V3.2024) under the section "Principles of Systemic Therapy" as recommended treatment regimens for patients with ECD and Langerhans cell histiocytosis (LCH) harboring BRAF V600E mutations. There is promising clinical data to support the use of vemurafenib and dabrafenib as monotherapies in patients with non-ECD and non-LCH BRAF V600-mutant histiocytic neoplasms._In a case study, a patient with heterozygous BRAF V600E-mutant histiocytic sarcoma was treated with vemurafenib and maintained both clinical and radiologic tumor responses for three months until disease progression (PMID: 25209580). In a second case study, a patient with BRAF V600E-mutant histiocytic sarcoma was treated with vemurafenib plus chemotherapy, antibiotics and steroids and remained in complete remission eighteen months after treatment initiation (PMID: 31376203). In a third case study, a pediatric patient with BRAF V600E-mutant mixed systemic Rosai-Dorfman-Destombes disease and LCH reported sustained clinical and radiographic responses after treatment with dabrafenib prior to disease relapse at thirteen months (PMID: 31213430).HistiocytosisLIQUIDMyeloidDabrafenibLEVEL_3ALEVEL_Fda3['31376203', '31213430', '25209580']Vemurafenib is an orally available, small molecule RAF-targeted inhibitor that is FDA-approved for the treatment of patients with Erdheim-Chester disease (ECD) with BRAF V600 mutation. Vemurafenib and dabrafenib are listed as monotherapies in the NCCN Histiocytic Neoplasms Guidelines (V3.2024) under the section "Principles of Systemic Therapy" as recommended treatment regimens for patients with ECD and Langerhans cell histiocytosis (LCH) harboring BRAF V600E mutations. There is promising clinical data to support the use of vemurafenib and dabrafenib as monotherapies in patients with non-ECD and non-LCH BRAF V600-mutant histiocytic neoplasms._In a case study, a patient with heterozygous BRAF V600E-mutant histiocytic sarcoma was treated with vemurafenib and maintained both clinical and radiologic tumor responses for three months until disease progression (PMID: 25209580). In a second case study, a patient with BRAF V600E-mutant histiocytic sarcoma was treated with vemurafenib plus chemotherapy, antibiotics and steroids and remained in complete remission eighteen months after treatment initiation (PMID: 31376203). In a third case study, a pediatric patient with BRAF V600E-mutant mixed systemic Rosai-Dorfman-Destombes disease and LCH reported sustained clinical and radiographic responses after treatment with dabrafenib prior to disease relapse at thirteen months (PMID: 31213430).HistiocytosisLIQUIDMyeloid25417114;20179705;23833300;26091043;26343582;12068308;30351999;25079552;28783719;19251651;1503598722608338;23051966;22735384;32758030;27283860;23020132;32818466;25399551;34838156;Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020.(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318);Bouffet et al. Abstract# LBA2002, ASCO 2022.(https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.17_suppl.LBA2002);29072975;37059834;37733309;31171876;28891408;31171878;31171879;25265492;25287827;29361468;28991513;28919011;29573941;35862871;37270692;31566309;39863775;40444708;Kopetz S., et al. Abstract#13. ASCO 2026.(https://ascopubs.org/doi/10.1200/JCO.2026.44.2_suppl.13);37978284;22663011;26287849;29188284;28961848;24508103;32534646;27480103;31732523;25265494;29431699;31151904;26352686;32985015;30154124;24725538;29039591;30462564;34232949;29621181;30351999;33117675;25524464;31985841;25092772;31502039;27398937;29380516;28984141;24821190;26579623;30120137;31376203;31213430;25209580LCH,HCLECD,ETPLL20519626;30157397;24938183;26637772;23347903;25480661;22072557;21910720;22210875;25120816;22028477;21663470;26071465;22531170;25422482;22237106100Tmissense_variantBRAF673GeneENST00000288602.6ENST00000288602.6:c.1799T>ANP_004324.2:p.Val600Glu12RS113488022/VAL600GLU/V640E/VAL640GLUhttps://civicdb.org/links/variants/12BRAF_V600E12NM_004333.4:c.1799T>A/NP_004324.2:p.Val600Glu/NC_000007.13:g.140453136A>T/ENST00000288602.6:c.1799T>ACA12364313961/376069
TUMORchr921967753N<DEL>PASSNM_000077stop_lost&feature_truncation&coding_sequence_variant&5_prime_UTR_variant&3_prime_UTR_variant&intron_variantHIGHCDKN2A1-3/31-2/2nandeletionv7.0LEVEL_Dx2LEVEL_Fda3False04/15/2025LEVEL_4-42059DELTrueTrueTrueLoss-of-functionOncogenicLEVEL_4.0/1GRCh38CDKN2ANN<DEL>21967753MantaDEL:CDKN2A_DEL.GT:PR:SR0/1:28,19:11,8deletionENSG00000147889TranscriptENST00000304494protein_coding?-976-1HGNCHGNC:1787YESMANE_SelectNM_000077.51P2CCDS6510.1ENSP00000307101P42771.244K7PML8.75UPI0000047FDAP42771-1Ensembl10,10,122009812FalseDeletion of CDKN2A results in loss of the p16/INK4A and p14/ARF proteins. CDKN2A deletion has been found in head and neck squamous cell carcinoma, glioma, bladder carcinoma, leukemia and melanoma and is often associated with poorer clinical outcomes (PMID: 15495191, 26516359, 10999737). Deletion of CDKN2A in mouse models of malignant mesothelioma resulted in accelerated tumorigenesis compared to wildtype (PMID: 21526190). In addition, knockdown of CDKN2A in an HRAS G12V mouse model resulted in the induction of high-grade endometrial stromal sarcoma (PMID: 28982163).CDKN2A, which encodes both a cyclin-dependent kinase inhibitor and an MDM2 inhibitor, is altered by mutation and deletion in various cancers.21526190|28982163|26516359|15495191|10999737Deletion1029CDKN2AGRCh38.CNA.CDKN2A deletion is known to be oncogenic.FalseLEVEL_Fda3Deletion of CDKN2A results in loss of the p16/INK4A and p14/ARF proteins. CDKN2A deletion has been found in head and neck squamous cell carcinoma, glioma, bladder carcinoma, leukemia and melanoma and is often associated with poorer clinical outcomes (PMID: 15495191, 26516359, 10999737). Deletion of CDKN2A in mouse models of malignant mesothelioma resulted in accelerated tumorigenesis compared to wildtype (PMID: 21526190). In addition, knockdown of CDKN2A in an HRAS G12V mouse model resulted in the induction of high-grade endometrial stromal sarcoma (PMID: 28982163).['21526190', '28982163', '26516359', '15495191', '10999737']LEVEL_Dx2['23521501']This assertion is supported by (PMID: 23521501).AML with BCR-ABL1LeukemiaLIQUIDMyeloidLEVEL_Dx2['18838613']This assertion is supported by (PMID: 18838613).B-Lymphoblastic Leukemia/LymphomaB-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidLEVEL_Dx2['18838613', '16079112']This assertion is supported by (PMID: 18838613, 16079112).T-Lymphoblastic Leukemia/LymphomaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidPalbociclibLEVEL_4LEVEL_Fda3['19874578', '24495407', '25941111', '29232554', '39413339', '28283584']Palbociclib, ribociclib, and abemaciclib are selective small molecule inhibitors of CDK4 and CDK6 (PMID: 25941111). There are laboratory and anecdotal clinical data to support use of palbociclib, ribociclib, and abemaciclib monotherapies in patients with CDKN2A-mutated solid tumors. _In a retrospective study of patients with uterine leiomyosarcoma, a patient harboring a CDKN2A mutation experienced stable disease and significant symptom reduction upon treatment with palbociclib (PMID: 28283584). In the Phase II TAPUR (NCT02693535) trial of palbociclib in 28 patients with head and neck cancer harboring CDKN2A mutations, the objective response rate was 4% (95% CI=<1-18) and the disease control rate was 40% (one-sided 90% CI=27-100) (PMID: 39413339)._In vitro studies of cancer cell lines with CDKN2A loss demonstrated that they are sensitive to CDK4/6 inhibition as measured by growth arrest upon drug treatment (PMID: 29232554). In a panel of melanoma and estrogen receptor-positive breast cancer cell lines, CDKN2A loss was found among cells with the highest sensitivity to palbociclib (PMID: 19874578, 24495407).All Solid TumorsSOLIDRibociclibLEVEL_4LEVEL_Fda3['19874578', '24495407', '25941111', '29232554', '39413339', '28283584']Palbociclib, ribociclib, and abemaciclib are selective small molecule inhibitors of CDK4 and CDK6 (PMID: 25941111). There are laboratory and anecdotal clinical data to support use of palbociclib, ribociclib, and abemaciclib monotherapies in patients with CDKN2A-mutated solid tumors. _In a retrospective study of patients with uterine leiomyosarcoma, a patient harboring a CDKN2A mutation experienced stable disease and significant symptom reduction upon treatment with palbociclib (PMID: 28283584). In the Phase II TAPUR (NCT02693535) trial of palbociclib in 28 patients with head and neck cancer harboring CDKN2A mutations, the objective response rate was 4% (95% CI=<1-18) and the disease control rate was 40% (one-sided 90% CI=27-100) (PMID: 39413339)._In vitro studies of cancer cell lines with CDKN2A loss demonstrated that they are sensitive to CDK4/6 inhibition as measured by growth arrest upon drug treatment (PMID: 29232554). In a panel of melanoma and estrogen receptor-positive breast cancer cell lines, CDKN2A loss was found among cells with the highest sensitivity to palbociclib (PMID: 19874578, 24495407).All Solid TumorsSOLIDAbemaciclibLEVEL_4LEVEL_Fda3['19874578', '24495407', '25941111', '29232554', '39413339', '28283584']Palbociclib, ribociclib, and abemaciclib are selective small molecule inhibitors of CDK4 and CDK6 (PMID: 25941111). There are laboratory and anecdotal clinical data to support use of palbociclib, ribociclib, and abemaciclib monotherapies in patients with CDKN2A-mutated solid tumors. _In a retrospective study of patients with uterine leiomyosarcoma, a patient harboring a CDKN2A mutation experienced stable disease and significant symptom reduction upon treatment with palbociclib (PMID: 28283584). In the Phase II TAPUR (NCT02693535) trial of palbociclib in 28 patients with head and neck cancer harboring CDKN2A mutations, the objective response rate was 4% (95% CI=<1-18) and the disease control rate was 40% (one-sided 90% CI=27-100) (PMID: 39413339)._In vitro studies of cancer cell lines with CDKN2A loss demonstrated that they are sensitive to CDK4/6 inhibition as measured by growth arrest upon drug treatment (PMID: 29232554). In a panel of melanoma and estrogen receptor-positive breast cancer cell lines, CDKN2A loss was found among cells with the highest sensitivity to palbociclib (PMID: 19874578, 24495407).All Solid TumorsSOLID21526190;28982163;26516359;15495191;10999737Palbociclib,Ribociclib,Abemaciclib28,1911,8
TUMORp.Gln209=ENSP00000286548.4:p.Gln209=chr977794572ATPASSNM_002072synonymous_variantLOWGNAQ5/7nanCOSV54105903&COSV54105914&COSV54108414SNV8.1800e-01v7.0..False06/30/2020.TrueTrueFalseUnknownUnknown55,280/10.3373493975903614GRCh38GNAQAAT77794572GNAQ_Q209L.GT:AD:AF:DP0/1:55,28:0.34:83TENSG00000156052TranscriptENST00000286548protein_coding1202626209QcAa/cAa-1HGNCHGNC:4390YESMANE_SelectNM_002072.51P1CCDS6658.1ENSP00000286548P50148.216A0A024R240.65UPI000006D0FBEnsembl1PDB-ENSP_mappings:6vu5.B&PDB-ENSP_mappings:7dfl.A&PDB-ENSP_mappings:7ezm.A&PDB-ENSP_mappings:7f6g.B&PDB-ENSP_mappings:7f6h.B&PDB-ENSP_mappings:7f6i.B&PDB-ENSP_mappings:7f8w.A&PDB-ENSP_mappings:7w3z.B&PDB-ENSP_mappings:7w40.B&PDB-ENSP_mappings:7xow.A&PDB-ENSP_mappings:8ia7.A&PDB-ENSP_mappings:8iys.A&PDB-ENSP_mappings:8jpb.Q&PDB-ENSP_mappings:8jpc.Q&PDB-ENSP_mappings:8jpe.Q&PDB-ENSP_mappings:8szg.C&PDB-ENSP_mappings:8uqn.A&PDB-ENSP_mappings:8uqo.A&PDB-ENSP_mappings:8zjd.A&PDB-ENSP_mappings:8zje.A&SMART:SM00275&PROSITE_profiles:PS51882&Superfamily:SSF52540&PANTHER:PTHR10218&Gene3D:3.40.50.300&Pfam:PF00503&Prints:PR00318&CDD:cd00066&AFDB-ENSP_mappings:AF-P50148-F11&1&11&1&1False.GNAQ, a G protein subunit, is recurrently mutated in uveal melanoma..Q209=2776GNAQGRCh38.MUTATION.This is a synonymous mutation and is not annotated by OncoKB.False.83
TUMORp.R130*ENSP00000361021.3:p.Arg130Terchr1087933147CTPASSNM_000314stop_gainedHIGHPTEN5/9c.388C>Trs121909224&CM094223&CM971273&COSV64288384&COSV64288463&COSV64297940&COSV64311187SNV2.737e-063.827e-05gnomADe_ASJ0.000.000.000.006.8500e-01Cowden_syndrome_1&Familial_prostate_cancer&Glioma_susceptibility_2&Familial_meningioma&Macrocephaly-autism_syndrome&PTEN-related_disorder&Prostate_cancer&Gastric_cancer&Cowden_syndrome&Rhabdomyosarcoma&Hereditary_cancer-predisposing_syndrome&not_provided&Ovarian_neoplasm&PTEN_hamartoma_tumor_syndrome&Abnormal_cardiovascular_system_morphologyNC_000010.11:g.87933147C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenicOncogeniccriteria_provided&_single_submitter43no_assertion_criteria_providedTier_I_-_StrongPTENR130*chr10:87933147-87933147v7.0LEVEL_Dx3LEVEL_Fda2False11/08/2024LEVEL_1TrueTrueTrueLoss-of-functionOncogenicCapivasertib+FulvestrantLEVEL_1LEVEL_1LEVEL_Dx364,510/1R130*0.4434782608695652GRCh38PTENCCT87933147PTEN_R130stop.GT:AD:AF:DP0/1:64,51:0.44:115TENSG00000171862TranscriptENST00000371953protein_coding1233388130R/*Cga/Tga1HGNCHGNC:9588YESMANE_SelectNM_000314.81P1CCDS31238.1ENSP00000361021P60484.218F6KD01.101UPI00001328C5P60484-1Ensembl1PDB-ENSP_mappings:1d5r.A&PDB-ENSP_mappings:5bug.A&PDB-ENSP_mappings:5bug.B&PDB-ENSP_mappings:5bug.C&PDB-ENSP_mappings:5bug.D&PDB-ENSP_mappings:5bzx.A&PDB-ENSP_mappings:5bzx.B&PDB-ENSP_mappings:5bzx.C&PDB-ENSP_mappings:5bzx.D&PDB-ENSP_mappings:5bzz.A&PDB-ENSP_mappings:5bzz.B&PDB-ENSP_mappings:5bzz.C&PDB-ENSP_mappings:5bzz.D&PDB-ENSP_mappings:7jtx.A&PDB-ENSP_mappings:7juk.A&PDB-ENSP_mappings:7jul.A&PDB-ENSP_mappings:7jvx.A&PANTHER:PTHR12305&PROSITE_profiles:PS50056&PROSITE_profiles:PS51181&PROSITE_patterns:PS00383&Pfam:PF22785&Gene3D:3.90.190.10&PIRSF:PIRSF038025&SMART:SM01301&SMART:SM00404&Superfamily:SSF52799&CDD:cd14509&AFDB-ENSP_mappings:AF-P60484-F102.236e-053.827e-050001.799e-0600pathogenic&likely_pathogenic0&1&1&1&1&1&11&1&1&1&1&1&123757202&27535533&25157968&26619011&21824802&28526761&9259288&10923032&11504908&20085938&21194675&23335809&9856571&11274365&17286265&18767981&21956414&22266152&23470840&9915974&9467011&34247193&33105631&29784605&35117297FAIL27-26-188PTEN78190.0000122858MONDO:MONDO:0008021&MedGen:CN072330&OMIM:158350&MONDO:MONDO:0700275&MedGen:C2931456&OMIM:176807&Orphanet:1331&MONDO:MONDO:0013092&MedGen:C2751642&OMIM:613028&Orphanet:182067&MONDO:MONDO:0011789&MedGen:C3551915&OMIM:607174&Orphanet:263662&MONDO:MONDO:0011537&MedGen:C1854416&OMIM:605309&Orphanet:210548&.&Human_Phenotype_Ontology:HP:0012125&MONDO:MONDO:0008315&MedGen:C0376358&Orphanet:1331&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&MONDO:MONDO:0016063&MedGen:C0018553&OMIM:PS158350&Orphanet:201&Human_Phenotype_Ontology:HP:0002859&MONDO:MONDO:0005212&MeSH:D012208&MedGen:C0035412&Orphanet:780&MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MedGen:C3661900&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&MONDO:MONDO:0017623&MeSH:D006223&MedGen:C1959582&Orphanet:306498&Human_Phenotype_Ontology:HP:0001632&Human_Phenotype_Ontology:HP:0002564&Human_Phenotype_Ontology:HP:0002565&Human_Phenotype_Ontology:HP:0030680&MedGen:C4049796SCV000187267&SCV000222110&SCV000253832&SCV000579271&SCV000604969&SCV000967757&SCV001134775&SCV001249159&SCV001340966&SCV001428573&SCV001448140&SCV001448935&SCV001760260&SCV002059850&SCV002061182&SCV002525581&SCV002576484&SCV002580289&SCV002793214&SCV003761297&SCV003841764&SCV004019961&SCV004032474&SCV004175664&SCV004207132&SCV005398854&SCV005685289&SCV005900566&SCV006059506&SCV006075390&SCV006099449&SCV006302678&SCV007107203&SCV007126383&SCV007449257&SCV007496233single_nucleotide_variantSO:0001483ClinGen:CA000433&OMIM:601728.0007PTEN:5728SO:0001587&nonsense&SO:0001623&5_prime_UTR_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094204121909224Colorectal_cancerMONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500SCV00607688110:87933147-879331471PTENp.R130*FalseThe PTEN R130* mutation is located in the phosphatase domain of the protein. This mutation has been found in glioblastoma, endometrial cancer, prostate cancer and colorectal cancer (PMID: 28572459). Expression of this mutation in endometrial cells demonstrated that it is inactivating as measured by in vivo tumor formation in a xenograft model (PMID: 24721394). PTEN R130* leads to loss of PTEN function as measured by yeast gene interaction assay, by altered developmental rate in Drosophila, by changes in rat neural development and by becoming a dominant negative regulator of the PI3-AKT signaling pathway (PMID: 32350270).PTEN, a lipid and protein phosphatase, is one of the most frequently mutated genes in cancer.32350270|28572459|24721394R130*5728PTENGRCh38.MUTATION.The PTEN R130* mutation is known to be oncogenic.FalseLEVEL_Fda2The PTEN R130* mutation is located in the phosphatase domain of the protein. This mutation has been found in glioblastoma, endometrial cancer, prostate cancer and colorectal cancer (PMID: 28572459). Expression of this mutation in endometrial cells demonstrated that it is inactivating as measured by in vivo tumor formation in a xenograft model (PMID: 24721394). PTEN R130* leads to loss of PTEN function as measured by yeast gene interaction assay, by altered developmental rate in Drosophila, by changes in rat neural development and by becoming a dominant negative regulator of the PI3-AKT signaling pathway (PMID: 32350270).['32350270', '28572459', '24721394']LEVEL_Dx3['19458356', '22491738', '19340001']This assertion is supported by (PMID: 22491738, 19340001, 19458356).T-Lymphoblastic Leukemia/LymphomaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidCapivasertib + FulvestrantLEVEL_1LEVEL_Fda2['37256976']Capivasertib, an orally available, ATP-competitive pan-AKT inhibitor, is FDA-approved with fulvestrant for the treatment of patients with PTEN-mutant ER+/HER2- metastatic breast cancer. FDA approval was based on the results of the Phase III CAPItello-291 trial of capivasertib plus fulvestrant in adult patients with or without AKT pathway-altered (PIK3CA, AKT1 or PTEN) ER+/HER2- advanced breast cancer. Of the patients with only PIK3CA, AKT1 or PTEN-mutant tumors (n=289), the capivasertib plus fulvestrant group (n=155) demonstrated an objective response rate of 26% (95% CI=19, 34), with a 2.3% complete response rate and 23% partial response rate, and a median progression-free survival of 7.3 months (95% CI=5.5, 9.0) whereas the placebo plus fulvestrant group (n=134) demonstrated an objective response rate of 8% (95% CI=4, 14), with a 8% partial response rate, and a median progression-free survival of 3.1 months (95% CI=2.0, 3.7) (HR=0.50 [95% CI=0.38, 0.65], P<0.0001) (PMID: 37256976). Of all patients, including patients with wildtype tumors and patients with PIK3CA, AKT1 or PTEN-mutant tumors (n=708), the capivasertib plus fulvestrant group (n=355) demonstrated a median progression-free survival of 7.2 months (95% CI=5.5, 7.4) whereas the placebo plus fulvestrant group (n=353) demonstrated a median progression-free survival of 3.6 months (95% CI=2.8, 3.7) (HR=0.60 [95% CI=0.51, 0.71], P<0.001) (PMID: 37256976).Breast CancerSOLIDBreastGSK2636771LEVEL_4LEVEL_Fda3['28645941', '34281912']GSK2636771 and AZD8186 are ATP-competitive small molecule inhibitors of PI3K. In a phase I clinical trial of GSK2636771 in PTEN-deficient advanced solid tumors, 11 (17%) of 65 patients experienced durable clinical benefit (>24 weeks), with 1 patient with castration-resistant prostate cancer having a partial response for over one year (PMID: 28645941). In a different Phase I trial of GSK2636771 plus enzalutamide in 36 patients with PTEN-deficient metastatic castration-resistant prostate cancer, the 12-week non-progressive disease rate was 50% (95% CI: 28.271.8, n = 22) in patients receiving 200mg of GSK2636771 daily, with 1 (3%) patient achieving a radiographic partial response lasting 36 weeks (PMID: 34281912). In a Phase I clinical trial of AZD8186 in 87 patients with advanced solid tumors, partial responses were seen in one patient with castration-resistant prostate cancer who was also treated in combination with vistusertib, a dual mTORC1/2 inhibitor, and in another patient with PTEN-deficient colorectal cancer (Abstract: Hansen et al. Abstract# 2570, ASCO 2017. http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2570).All Solid TumorsSOLIDAZD8186LEVEL_4LEVEL_Fda3['28645941', '34281912']GSK2636771 and AZD8186 are ATP-competitive small molecule inhibitors of PI3K. In a phase I clinical trial of GSK2636771 in PTEN-deficient advanced solid tumors, 11 (17%) of 65 patients experienced durable clinical benefit (>24 weeks), with 1 patient with castration-resistant prostate cancer having a partial response for over one year (PMID: 28645941). In a different Phase I trial of GSK2636771 plus enzalutamide in 36 patients with PTEN-deficient metastatic castration-resistant prostate cancer, the 12-week non-progressive disease rate was 50% (95% CI: 28.271.8, n = 22) in patients receiving 200mg of GSK2636771 daily, with 1 (3%) patient achieving a radiographic partial response lasting 36 weeks (PMID: 34281912). In a Phase I clinical trial of AZD8186 in 87 patients with advanced solid tumors, partial responses were seen in one patient with castration-resistant prostate cancer who was also treated in combination with vistusertib, a dual mTORC1/2 inhibitor, and in another patient with PTEN-deficient colorectal cancer (Abstract: Hansen et al. Abstract# 2570, ASCO 2017. http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2570).All Solid TumorsSOLID32350270;28572459;24721394GSK2636771,AZD818637256976;28645941;34281912;Hansen et al. Abstract# 2570, ASCO 2017.(http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2570)TLL19458356;22491738;19340001115Tstop_gainedPTEN5728GeneENST00000371953.3ENST00000371953.3:c.388C>TNP_000305.3:p.Arg130Ter636R130X/ARG130TER/RS121909224https://civicdb.org/links/variants/636PTEN_R130*632NM_000314.6:c.388C>T/NP_000305.3:p.Arg130Ter/ENST00000371953.3:c.388C>T/NC_000010.10:g.89692904C>TCA0004337819
TUMORp.G13DENSP00000308495.3:p.Gly13Aspchr1225245347CTPASSNM_004985missense_variantMODERATEKRAS2/5c.38G>Ars112445441&CM125166&COSV55497357&COSV55497388&COSV55522580SNVdeleterious_low_confidence(0.04)1.369e-061.971e-054.41e-05gnomADg_NFE0.010.000.000.000.8322.6400e-01KRAS-related_disorder&OCULOECTODERMAL_SYNDROME&_SOMATIC&Noonan_syndrome_and_Noonan-related_syndrome&Inborn_genetic_diseases&Familial_pancreatic_carcinoma&Encephalocraniocutaneous_lipomatosis&RASopathy&not_provided&Nevus_sebaceous&Non-small_cell_lung_carcinoma&Autoimmune_lymphoproliferative_syndrome_type_4&Breast_adenocarcinoma&Juvenile_myelomonocytic_leukemiaNC_000012.12:g.25245347C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongKRASG13Dchr12:25245347-25245347v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot05/13/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAvutometinib+DefactinibCobimetinib,TrametinibCobimetinib,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_1LEVEL_R1LEVEL_Dx280,310/1G13D0.27927927927927926GRCh38KRASCCT25245347KRAS_G13D.GT:AD:AF:DP0/1:80,31:0.28:111TENSG00000133703TranscriptENST00000311936protein_coding2283813G/DgGc/gAc-1HGNCHGNC:6407YESMANE_SelectNM_004985.51P4CCDS8702.1ENSP00000308495P01116.262UPI0000001252P01116-2Ensembl1Gene3D:3.40.50.300&AFDB-ENSP_mappings:AF-P01116-F1&Pfam:PF00071&Prints:PR00449&PROSITE_profiles:PS51419&PROSITE_profiles:PS51420&PROSITE_profiles:PS51421&PANTHER:PTHR24070&SMART:SM00173&SMART:SM00174&SMART:SM00175&Superfamily:SSF52540&NCBIFAM:TIGR00231&CDD:cd04138&Low_complexity_(Seg):seg0000001.8e-060000000004.41e-0500uncertain_significance&pathogenic&likely_pathogenic&not_provided0&1&1&1&11&1&1&1&124033266&22992668&26900293&2278970&3122217&12460918&16434492&19075190&22407852&25157968&17332249&17384584&18794081&32550823&19018267&21975775&19255327&19773371&23406027&15696205&16361624&16618717&18316791&19114683&19679400&20921462&20921465&21228335&3627975&19794967&21063026&21398618&22392911&22734028&23071293&23090619&23182985&24558511&24628546&25808193&26371285&26623049&33076847&36061173&31117243&34737598&37232746&28708103&35117297&36866106&32934698&39001385FAIL48-44-148KRAS1258027619.&.&MONDO:MONDO:0020297&MedGen:C5681679&Orphanet:98733&MeSH:D030342&MedGen:C0950123&MONDO:MONDO:0015278&MedGen:C2931038&OMIM:260350&Orphanet:1333&MONDO:MONDO:0013074&MedGen:C0406612&OMIM:613001&Orphanet:2396&MONDO:MONDO:0021060&MedGen:C5555857&Orphanet:536391&MedGen:C3661900&Human_Phenotype_Ontology:HP:0010815&MedGen:C3854181&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&MONDO:MONDO:0013767&MedGen:C2674723&OMIM:614470&Orphanet:268114&MONDO:MONDO:0004988&MedGen:C0858252&Human_Phenotype_Ontology:HP:0012209&MONDO:MONDO:0011908&MedGen:C0349639&OMIM:607785&Orphanet:86834SCV000061938&SCV001248878&SCV001444340&SCV001737088&SCV002016398&SCV002060774&SCV002117438&SCV005438357single_nucleotide_variantSO:0001483ClinGen:CA122534&OMIM:190070.0003&UniProtKB:P01116#VAR_016029KRAS:3845SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094256112445441Adenocarcinoma_of_the_large_intestine&Diffuse_midline_glioma&_H3_K27M-mutant&Embryonal_rhabdomyosarcoma&Colorectal_cancerHuman_Phenotype_Ontology:HP:0040275&MONDO:MONDO:0005008&MedGen:C1319315&MONDO:MONDO:0957196&MedGen:C4289688&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500SCV007105395&SCV00710540812:25245347-252453471KRASp.G13DTrueThe KRAS G13D mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in colorectal and lung cancer (PMID: 28572459). Expression of this mutation in colorectal cancer cell lines demonstrated that it is activating, as shown by increased protein activation, downstream pathway activation, colony formation and in vivo tumor formation compared to wildtype (PMID: 22722830, 26037647, 20147967, 32792368).KRAS, a GTPase which functions as an upstream regulator of the MAPK pathway, is frequently mutated in various cancer types including lung, colorectal and pancreatic cancers.28572459|22722830|32792368|20147967|26037647G13D3845KRASGRCh38.MUTATION.The KRAS G13D mutation is known to be oncogenic.FalseLEVEL_Fda2The KRAS G13D mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in colorectal and lung cancer (PMID: 28572459). Expression of this mutation in colorectal cancer cell lines demonstrated that it is activating, as shown by increased protein activation, downstream pathway activation, colony formation and in vivo tumor formation compared to wildtype (PMID: 22722830, 26037647, 20147967, 32792368).['28572459', '22722830', '32792368', '20147967', '26037647']LEVEL_Dx2['10049057', '23832011', '25691160', '26457647', '12717436']This assertion is supported by (PMID: 10049057, 23832011, 26457647, 12717436, PMID: 25691160).Juvenile Myelomonocytic LeukemiaMyelodysplastic/Myeloproliferative NeoplasmsLIQUIDMyeloidLEVEL_Dx2['22934674', '23512829']This assertion is supported by (PMID: 23512829, 22934674).Myelodysplastic SyndromesMyelodysplastic SyndromesLIQUIDMyeloidLEVEL_Dx3['22237106']This assertion is supported by (PMID: 22237106).Early T-Cell Precursor Lymphoblastic LeukemiaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidCetuximabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).Colorectal CancerSOLIDBowelTucatinib + TrastuzumabLEVEL_R1LEVEL_Fda2['30857956']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Patients with metastatic colorectal cancer harboring KRAS mutations do not respond favorably to trastuzumab as seen in the MyPath trial. In the multiple basket MyPath Phase IIa trial of pertuzumab and trastuzumab in which 56 metastatic colorectal cancer patients with HER2 amplification received combination therapy, the objective response rate for patients with KRAS wildtype colorectal cancer (43/56 patients) compared to KRAS mutated colorectal cancer (13/56 patients) was 40% (17/43, 95% CI, 25%56%) versus 8% (1/13, 95% CI 0.2%36%), respectively (PMID: 30857956).Colorectal CancerSOLIDBowelPanitumumabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).Colorectal CancerSOLIDBowelAvutometinib + DefactinibLEVEL_1LEVEL_Fda2['40644648']Avutometinib, a RAF/MEK clamp inhibitor, and defactinib, a FAK inhibitor, are FDA-approved in combination for the treatment of adult patients with KRAS-mutated recurrent low-grade serous ovarian cancer (LGSOC) who have received prior systemic therapy. FDA approval was based on the results of the Phase II RAMP-201 (NCT04625270) trial of avutometinib plus defactinib in 109 patients with recurrent LGSOC._In the Phase II RAMP-201 (NCT04625270) trial, patients with KRAS-mutated LGSOC (n=57) demonstrated an overall response rate (ORR) of 44% (n=25), with a 2% (n=2) complete response (CR) rate, 40% (n=23) partial response (PR) rate and 49% (n=28) stable disease (SD) rate, a median duration of response (DOR) of 31.0 months (95% CI=14.8-31.1) and a median progression-free survival (PFS) of 22.0 months (95% CI=11.1-36.6) (PMID: 40644648). Responders included patients with the following KRAS mutations: KRAS A146V, G12D, G12R, G12V and Q61H (PMID: 40644648). Of patients with KRAS wildtype LGSOC (n=52), the cohort demonstrated an ORR of 17% (n=9), with a 17% (n=9) PR rate and 65% (n=34) SD rate, and a median PFS of 9.2 months (95% CI=5.5-NE) (PMID: 40644648).Low-Grade Serous Ovarian CancerOvarian CancerSOLIDOvary/Fallopian TubeCobimetinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).Erdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidCobimetinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidCobimetinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).Rosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).Erdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).Rosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidCobimetinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).HistiocytosisLIQUIDMyeloidTrametinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).HistiocytosisLIQUIDMyeloidTrametinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).All Solid TumorsSOLIDCobimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).All Solid TumorsSOLIDBinimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).All Solid TumorsSOLID28572459;22722830;32792368;20147967;26037647Trametinib,Cobimetinib,Binimetinib20921465;21228335;20619739;24024839;18316791;30857956;40644648;30867592;32991018;29236635;30361829;33933896;25435214;24746704;23934108JMML,MDSETPLL10049057;23832011;25691160;26457647;12717436;22934674;23512829;22237106111Tmissense_variantKRAS3845GeneENST00000256078.4ENST00000256078.4:c.38G>ANP_004976.2:p.Gly13Asp81GLY13ASP/RS112445441https://civicdb.org/links/variants/81KRAS_G13D81NM_033360.3:c.38G>A/NP_004976.2:p.Gly13Asp/NC_000012.11:g.25398281C>T/ENST00000256078.4:c.38G>ACA12253412580
TUMORp.G12DENSP00000308495.3:p.Gly12Aspchr1225245350CTPASSNM_004985missense_variantMODERATEKRAS2/5c.35G>Ars121913529&COSV55497369&COSV55497419&COSV55497479SNVdeleterious_low_confidence(0.04)2.739e-061.314e-052.94e-05gnomADg_NFE0.010.000.000.000.8752.6400e-01Congenital_Pulmonary_Airway_Malformations&Lung_cancer&Gastric_cancer&Acute_myeloid_leukemia&Linear_nevus_sebaceous_syndrome&Noonan_syndrome_3&Familial_pancreatic_carcinoma&Cardiofaciocutaneous_syndrome_2&Autoimmune_lymphoproliferative_syndrome_type_4&Malignant_tumor_of_urinary_bladder&Cerebral_arteriovenous_malformation&Toriello-Lacassie-Droste_syndrome&Familial_cancer_of_breast&Atypical_endometrial_hyperplasia&Endometrial_hyperplasia_without_atypia&Primary_low_grade_serous_adenocarcinoma_of_ovary&Vascular_Tumors_Including_Pyogenic_Granuloma&Encephalocraniocutaneous_lipomatosis&Cardiovascular_phenotype&not_provided&RASopathy&Nevus_sebaceous&Ovarian_neoplasm&Carcinoma_of_pancreas&Epidermal_nevus&Capillary_malformation-arteriovenous_malformation_1&Non-small_cell_lung_carcinoma&Juvenile_myelomonocytic_leukemiaNC_000012.12:g.25245350C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenicOncogeniccriteria_provided&_single_submitter35criteria_provided&_single_submitterTier_I_-_StrongKRASG12Dchr12:25245350-25245350v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot05/13/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAvutometinib+DefactinibCobimetinib,TrametinibCobimetinib,Daraxonrasib,Setidegrasib,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_1LEVEL_R1LEVEL_Dx278,420/1G12D0.35GRCh38KRASCCT25245350KRAS_G12D.GT:AD:AF:DP0/1:78,42:0.35:120TENSG00000133703TranscriptENST00000311936protein_coding2253512G/DgGt/gAt-1HGNCHGNC:6407YESMANE_SelectNM_004985.51P4CCDS8702.1ENSP00000308495P01116.262UPI0000001252P01116-2Ensembl1Gene3D:3.40.50.300&AFDB-ENSP_mappings:AF-P01116-F1&Pfam:PF00071&Prints:PR00449&PROSITE_profiles:PS51419&PROSITE_profiles:PS51420&PROSITE_profiles:PS51421&PANTHER:PTHR24070&SMART:SM00173&SMART:SM00174&SMART:SM00175&Superfamily:SSF52540&NCBIFAM:TIGR00231&CDD:cd04138&Low_complexity_(Seg):seg0000002.7e-061.658e-05000000002.94e-0500association&pathogenic/likely_pathogenic&pathogenic&likely_pathogenic&not_provided0&1&1&11&1&1&126900293&2278970&3122217&12460918&16434492&19075190&22407852&22499344&25032700&25157968&29525983&17332249&21079152&17384584&18794081&19047918&22235099&19029981&32550823&19018267&21975775&17704260&19255327&19773371&22683711&23406027&15696205&16361624&16618717&18316791&19114683&19679400&20921462&20921465&21228335&32000721&19794967&21398618&23182985&7773929&8439212&15842656&17910045&19358724&19881948&20609353&20805368&20949522&21169357&22025163&22282465&22897852&23014527&25044103&26372703&33076847&32175330&31949278&33174010&37160318&30463544&32770181&31117243&31836588&34737598&34381078&37232746&27872090&28708103&35117297&33832922&34027089&29721857&26071483&36761421&34117074&36866106&35753820&33254149&35638910&28611940&35582142&29298116&37713191&37384296&37546424&38310289&37164664&39001385&38773265FAIL459-445KRAS125820.0000227621.&MONDO:MONDO:0008903&MedGen:C0242379&OMIM:211980&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&Human_Phenotype_Ontology:HP:0001914&Human_Phenotype_Ontology:HP:0004808&Human_Phenotype_Ontology:HP:0004843&Human_Phenotype_Ontology:HP:0005516&Human_Phenotype_Ontology:HP:0006724&Human_Phenotype_Ontology:HP:0006728&MONDO:MONDO:0018874&MeSH:D015470&MedGen:C0023467&OMIM:601626&Orphanet:519&Human_Phenotype_Ontology:HP:0010817&MONDO:MONDO:0008097&MedGen:C4552097&OMIM:163200&Orphanet:2612&MONDO:MONDO:0012371&MedGen:C1860991&OMIM:609942&Orphanet:648&MONDO:MONDO:0015278&MedGen:C2931038&OMIM:260350&Orphanet:1333&MONDO:MONDO:0014112&MedGen:C3809005&OMIM:615278&Orphanet:1340&MONDO:MONDO:0013767&MedGen:C2674723&OMIM:614470&Orphanet:268114&MONDO:MONDO:0001187&MedGen:C0005684&OMIM:109800&Human_Phenotype_Ontology:HP:0002408&MONDO:MONDO:0007154&MedGen:C0917804&OMIM:108010&Orphanet:46724&MONDO:MONDO:0010854&MedGen:C1838329&OMIM:600268&Orphanet:3339&MONDO:MONDO:0016419&MedGen:C0346153&OMIM:114480&Orphanet:227535&MONDO:MONDO:0006096&MedGen:C0349579&MONDO:MONDO:0006193&MedGen:C1516855&MedGen:C4302356&.&MONDO:MONDO:0013074&MedGen:C0406612&OMIM:613001&Orphanet:2396&MedGen:CN230736&MedGen:C3661900&MONDO:MONDO:0021060&MedGen:C5555857&Orphanet:536391&Human_Phenotype_Ontology:HP:0010815&MedGen:C3854181&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&MONDO:MONDO:0005192&MedGen:C0235974&Orphanet:1333&Orphanet:217074&Human_Phenotype_Ontology:HP:0010816&MONDO:MONDO:0008093&MedGen:C0334082&OMIM:162900&Orphanet:79414&MONDO:MONDO:0020783&MedGen:C4747394&OMIM:608354&Orphanet:137667&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&Human_Phenotype_Ontology:HP:0012209&MONDO:MONDO:0011908&MedGen:C0349639&OMIM:607785&Orphanet:86834SCV000329383&SCV000659085&SCV001736991&SCV002318898&SCV002525678&SCV002601600&SCV002821689&SCV004176950&SCV005023563&SCV005044128&SCV005414064&SCV005634967&SCV006304919single_nucleotide_variantSO:0001483ClinGen:CA122538&OMIM:190070.0005&OMIM:190070.0025&UniProtKB:P01116#VAR_016026KRAS:3845SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094257121913529Diffuse_midline_glioma&_H3_K27M-mutant&Ovarian_mucinous_adenocarcinoma&Medulloblastoma_non-WNT/non-SHH&Adenocarcinoma_of_the_large_intestine&Diffuse_pediatric-type_high-grade_glioma&_H3-wildtype_and_IDH-wildtype&Embryonal_rhabdomyosarcoma&Colorectal_cancer&Glioma&Alveolar_rhabdomyosarcoma&Papillary_thyroid_carcinoma&Precursor_B-cell_acute_lymphoblastic_leukemiaMONDO:MONDO:0957196&MedGen:C4289688&MONDO:MONDO:0005601&MedGen:C1335167&Orphanet:398961&MONDO:MONDO:0850198&MedGen:C4330667&Human_Phenotype_Ontology:HP:0040275&MONDO:MONDO:0005008&MedGen:C1319315&MONDO:MONDO:0858939&MedGen:C5669918&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500&Human_Phenotype_Ontology:HP:0009733&MONDO:MONDO:0021042&MeSH:D005910&MedGen:C0017638&Orphanet:182067&Human_Phenotype_Ontology:HP:0006779&MONDO:MONDO:0009994&MedGen:C0206655&OMIM:268220&Orphanet:780&Orphanet:99756&Human_Phenotype_Ontology:HP:0002895&MONDO:MONDO:0005075&MeSH:D000077273&MedGen:C0238463&Orphanet:146&Human_Phenotype_Ontology:HP:0004812&MONDO:MONDO:0020511&MedGen:C0349636&Orphanet:99860SCV007105405&SCV007105406&SCV007105409&SCV007105415&SCV007105422&SCV007105432&SCV00710552012:25245350-252453501KRASp.G12DTrueThe KRAS G12D mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in lung, colorectal, pancreatic and ovarian cancer (PMID: 28572459). Expression of this mutation in cell lines and mouse models demonstrated that it is activating, as measured by increased downstream pathway activation, colony formation and in vivo tumor development across multiple lineages compared to wildtype (PMID: 20570890, 20147967, 11751631, 15093544,19296721,17349581, 32792368). In vitro studies have demonstrated that this mutation confers resistance to BRAF inhibition in lymphoid cells as measured by decreased pathway activation in the presence of the drug, but is sensitive to the MEK inhibitor cobimetinib (PMID: 30341394). A patient with hairy cell leukemia acquired a KRAS G12D mutation following relapse on the BRAF inhibitor vemurafenib but was successfully treated with the cobimetinib for at least twelve months (PMID: 30341394). Preclinical studies with xenograft mouse models expressing KRAS G12D demonstrated sensitivity to treatment with setidegrasib as measured by reduced tumor volume following treatment (Abstract: Nagashima et al. Abstract# 5735, AACR 2023. https://aacrjournals.org/cancerres/article/83/7_Supplement/5735/722276).KRAS, a GTPase which functions as an upstream regulator of the MAPK pathway, is frequently mutated in various cancer types including lung, colorectal and pancreatic cancers.17349581|19296721|11751631|15093544|30341394|28572459|20570890|32792368|20147967G12D3845KRASGRCh38.MUTATION.The KRAS G12D mutation is known to be oncogenic.FalseLEVEL_Fda2The KRAS G12D mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in lung, colorectal, pancreatic and ovarian cancer (PMID: 28572459). Expression of this mutation in cell lines and mouse models demonstrated that it is activating, as measured by increased downstream pathway activation, colony formation and in vivo tumor development across multiple lineages compared to wildtype (PMID: 20570890, 20147967, 11751631, 15093544,19296721,17349581, 32792368). In vitro studies have demonstrated that this mutation confers resistance to BRAF inhibition in lymphoid cells as measured by decreased pathway activation in the presence of the drug, but is sensitive to the MEK inhibitor cobimetinib (PMID: 30341394). A patient with hairy cell leukemia acquired a KRAS G12D mutation following relapse on the BRAF inhibitor vemurafenib but was successfully treated with the cobimetinib for at least twelve months (PMID: 30341394). Preclinical studies with xenograft mouse models expressing KRAS G12D demonstrated sensitivity to treatment with setidegrasib as measured by reduced tumor volume following treatment (Abstract: Nagashima et al. Abstract# 5735, AACR 2023. https://aacrjournals.org/cancerres/article/83/7_Supplement/5735/722276).['17349581', '19296721', '11751631', '15093544', '30341394', '28572459', '20570890', '32792368', '20147967'][{'abstract': 'Nagashima et al. Abstract# 5735, AACR 2023.', 'link': 'https://aacrjournals.org/cancerres/article/83/7_Supplement/5735/722276'}]LEVEL_Dx2['10049057', '23832011', '25691160', '26457647', '12717436']This assertion is supported by (PMID: 10049057, 23832011, 26457647, 12717436, PMID: 25691160).Juvenile Myelomonocytic LeukemiaMyelodysplastic/Myeloproliferative NeoplasmsLIQUIDMyeloidLEVEL_Dx2['22934674', '23512829']This assertion is supported by (PMID: 23512829, 22934674).Myelodysplastic SyndromesMyelodysplastic SyndromesLIQUIDMyeloidLEVEL_Dx3['22237106']This assertion is supported by (PMID: 22237106).Early T-Cell Precursor Lymphoblastic LeukemiaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidCetuximabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).Colorectal CancerSOLIDBowelTucatinib + TrastuzumabLEVEL_R1LEVEL_Fda2['30857956']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Patients with metastatic colorectal cancer harboring KRAS mutations do not respond favorably to trastuzumab as seen in the MyPath trial. In the multiple basket MyPath Phase IIa trial of pertuzumab and trastuzumab in which 56 metastatic colorectal cancer patients with HER2 amplification received combination therapy, the objective response rate for patients with KRAS wildtype colorectal cancer (43/56 patients) compared to KRAS mutated colorectal cancer (13/56 patients) was 40% (17/43, 95% CI, 25%56%) versus 8% (1/13, 95% CI 0.2%36%), respectively (PMID: 30857956).Colorectal CancerSOLIDBowelPanitumumabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).Colorectal CancerSOLIDBowelAvutometinib + DefactinibLEVEL_1LEVEL_Fda2['40644648']Avutometinib, a RAF/MEK clamp inhibitor, and defactinib, a FAK inhibitor, are FDA-approved in combination for the treatment of adult patients with KRAS-mutated recurrent low-grade serous ovarian cancer (LGSOC) who have received prior systemic therapy. FDA approval was based on the results of the Phase II RAMP-201 (NCT04625270) trial of avutometinib plus defactinib in 109 patients with recurrent LGSOC._In the Phase II RAMP-201 (NCT04625270) trial, patients with KRAS-mutated LGSOC (n=57) demonstrated an overall response rate (ORR) of 44% (n=25), with a 2% (n=2) complete response (CR) rate, 40% (n=23) partial response (PR) rate and 49% (n=28) stable disease (SD) rate, a median duration of response (DOR) of 31.0 months (95% CI=14.8-31.1) and a median progression-free survival (PFS) of 22.0 months (95% CI=11.1-36.6) (PMID: 40644648). Responders included patients with the following KRAS mutations: KRAS A146V, G12D, G12R, G12V and Q61H (PMID: 40644648). Of patients with KRAS wildtype LGSOC (n=52), the cohort demonstrated an ORR of 17% (n=9), with a 17% (n=9) PR rate and 65% (n=34) SD rate, and a median PFS of 9.2 months (95% CI=5.5-NE) (PMID: 40644648).Low-Grade Serous Ovarian CancerOvarian CancerSOLIDOvary/Fallopian TubeCobimetinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).Erdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidCobimetinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidCobimetinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).Rosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).Erdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).Rosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidCobimetinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).HistiocytosisLIQUIDMyeloidDaraxonrasibLEVEL_3ALEVEL_Fda3['38593348']Daraxonrasib is an orally available, small-molecule RAS(ON) multi-selective noncovalent inhibitor. There are promising clinical data in patients with non-small cell lung cancer (NSCLC) harboring a KRAS G12 mutation treated with daraxonrasib. _In a clinical study of daraxonrasib in 39 patients with KRAS G12X-mutant NSCLC (n=3 KRAS G12A, n=17 KRAS G12D, n=17 KRAS G12V, n=2 KRAS G12S), the overall response rate was 38% (15/39), with one patient (3%) demonstrating complete response (n=1 KRAS G12V), fourteen patients (35%) demonstrating partial response (n=7 KRAS G12D, n=7 KRAS G12V), nineteen patients (48%) demonstrating stable disease (n=1 KRAS G12A, n=8 KRAS G12D, n=9 KRAS G12V, n=1 KRAS G12S) and five patients (13%) demonstrating progressive disease (n=2 KRAS G12A, n=2 KRAS G12D, n=1 KRAS G12S) (Abstract: Arbour, KC. et al., Abstract#6520, Annals of Oncol., 2023. https://www.annalsofoncology.org/article/S0923-7534%2823%2902675-3/fulltext). In a case report, a patient with NSCLC harboring KRAS G12V was treated with daraxonrasib and achieved a complete response with a 100% decrease in both target lesions (PMID: 38593348). In vitro studies with KRAS position 12 (G12X) mutated RAS-addicted cell lines demonstrated increased sensitivity to daraxonrasib as measured by increased inhibition of cellular proliferation compared to other RAS-mutated cell lines (Abstract: Singh et al. Abstract # 3597, AACR 2022. https://s3.us-west-2.amazonaws.com/rvmdpubs.revmed.com/2022/AACR_2022_Singh.pdf). In vivo human xenograft models with KRAS G12X mutant tumors demonstrated sensitivity to daraxonrasib as measured by dose-dependent tumor regression, anti-tumor immunity and RAS pathway inhibition (Abstract: Koltun et al. Abstract# 3597, AACR 2022. https://aacrjournals.org/cancerres/article/82/12_Supplement/3597/702320).Non-Small Cell Lung CancerSOLIDLungDaraxonrasibLEVEL_3ALEVEL_Fda3['38593348']Daraxonrasib is an orally available, small-molecule RAS(ON) multi-selective noncovalent inhibitor. There are promising clinical data in patients with pancreatic adenocarcinoma harboring a KRAS G12 mutation treated with daraxonrasib. _In the Phase I RMC-6236-001 (NCT05379985) trial of daraxonrasib in 127 patients with RAS-mutant pancreatic adenocarcinoma (PDAC), the KRAS G12X-mutant cohort (n=42) demonstrated a median progression-free survival (PFS) of 8.5 months (95% CI=5.3-11.7), an objective response rate (ORR) of 29% (95% CI=1645) and a median overall survival (OS) of 14.5 months (95% CI=8.8-NE) (Abstract: Garrido-Laguna et al. 2025 ASCO Gastrointestinal Cancers Symposium. https://www.asco.org/abstracts-presentations/ABSTRACT474560). Of the RAS-mutant cohort (G12X, G13X or Q61X) (n=57), the median PFS was 7.6 months (95% CI=5.9-11.1), the ORR was 25% (95% CI=14-38) and the median OS was 14.5 months (95% CI=8.8-NE) (Abstract: Garrido-Laguna et al. 2025 ASCO Gastrointestinal Cancers Symposium. https://www.asco.org/abstracts-presentations/ABSTRACT474560). In a clinical study of daraxonrasib in 44 patients with KRAS G12X-mutant pancreatic adenocarcinoma (n=23 KRAS G12D, n=9 KRAS G12V, n=11 KRAS G12R, n=1 KRAS G12S), the overall response rate was 20% (9/44), with nine patients (20%) demonstrating partial response (n=4 KRAS G12D, n=2 KRAS G12V, n=3 KRAS G12R), 32 patients (73%) demonstrating stable disease (n=17 KRAS G12D, n=6 KRAS G12V, n=8 KRAS G12R, n=1 KRAS G12S) and two patients (4.5%) demonstrating progressive disease (n=2 KRAS G12D) (Abstract: Arbour et al. Abstract# 6520, Annals of Oncol., 2023. https://www.annalsofoncology.org/article/S0923-7534%2823%2902675-3/fulltext). _Preclinical studies with KRAS G12X mutated RAS-addicted cell lines and KRAS G12X mutant human xenograft models demonstrated increased sensitivity to daraxonrasib as measured by increased inhibition of cellular proliferation, dose-dependent tumor regression, anti-tumor immunity and RAS pathway inhibition (PMID: 38593348).Pancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasSetidegrasibLEVEL_3ALEVEL_Fda3['41879829', '40849515']Setidegrasib is an intravenously administered, small molecule KRAS G12D-targeted degrader. There are promising clinical data of response to setidegrasib in patients with KRAS G12D-mutant non-small cell lung cancer (NSCLC). In the Phase I (NCT05382559) trial of setidegrasib as a second-line of treatment or later in 45 patients with KRAS G12D-mutant NSCLC, the objective response rate was 36% (n=16) (95% CI=22-51), with one pending partial responses (PR) and fifteen confirmed PRs, the median time to a response was 1.4 months (range=1.2-8.1), the median progression-free survival (PFS) was 8.3 months (95% CI=4.1-NE), the 6-month overall survival (OS) was 77% (95% CI=62-87) and the 12-month OS was 59% (95% CI=40-74) (PMID: 41879829). In vivo studies with KRAS G12D-mutant NSCLC mouse xenograft models demonstrated antitumor activity to setidegrasib as measured by tumor regression (PMID: 40849515).Non-Small Cell Lung CancerSOLIDLungSetidegrasibLEVEL_3ALEVEL_Fda3['41879829', '40849515']Setidegrasib is an intravenously administered, small-molecule KRAS G12D-targeted degrader. There are promising clinical data of response to setidegrasib in patients with KRAS G12D-mutated pancreatic ductal adenocarcinoma (PDAC). _In the Phase I (NCT05382559) trial of setidegrasib as second-line treatment or third-line treatment in 21 patients with KRAS G12D-mutant PDAC, the objective response rate (ORR) was 24% (95% CI=8-47), with five confirmed partial responses (PR) and seven stable disease (SD) responses, the median time to response was 4.1 months (range=1.3-8.2), the median duration of response was 4.2 months (95% CI=2.7-NE), the median progression-free survival was 3.0 months (95% CI=1.4-6.9) and the median overall survival was 10.3 months (95% CI=4.2-13.0) (PMID: 41879829). In the exploratory analyses of the Phase I (NCT05382559) trial with 124 patients with KRAS G12D-mutant PDAC, 78% of patients with 50% reduced KRAS G12D variant allele frequency achieved SD or PR and demonstrated a clinical benefit (Abstract: Park et al. Abstract# 775, ASCO Gastrointestinal Cancers Symposium, 2026. https://ascopubs.org/doi/abs/10.1200/JCO.2026.44.2_suppl.775)._In vivo studies with KRAS G12D-mutant PDAC mouse xenograft models demonstrated antitumor activity with setidegrasib as measured by tumor regression (PMID: 40849515).Pancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasTrametinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).HistiocytosisLIQUIDMyeloidDaraxonrasibLEVEL_4LEVEL_Fda3Daraxonrasib is an orally available, small-molecular inhibitor of RAS. In vitro studies in human RAS-addicted cancer cell lines demonstrated sensitivity to daraxonrasib as measured by decreased ERK phosphorylation, decreased cell growth and induced apoptosis (Abstract: Koltun et al. Abstract# 3597, AACR 2022. https://aacrjournals.org/cancerres/article/82/12_Supplement/3597/702320). In vitro studies with KRAS position 12 (G12X) mutated RAS-addicted cell lines demonstrated increased sensitivity to daraxonrasib as measured by increased inhibition of cellular proliferation compared to other RAS-mutated cell lines (Abstract: Singh et al. Abstract # 3597, AACR 2022. https://s3.us-west-2.amazonaws.com/rvmdpubs.revmed.com/2022/AACR_2022_Singh.pdf). In vivo human xenograft models with KRAS G12X mutant tumors demonstrated sensitivity to daraxonrasib as measured by dose-dependent tumor regression, anti-tumor immunity and RAS pathway inhibition (Abstract: Koltun et al. Abstract# 3597, AACR 2022. https://aacrjournals.org/cancerres/article/82/12_Supplement/3597/702320). In a mouse clinical trial of daraxonrasib with KRAS G12X-mutant models of non-small cell lung cancer (n=15), pancreatic ductal adenocarcinoma (n=18) and colorectal cancer (n=18), the objective response rate was 53% (8/15), 61% (11/18) and 44% (8/18), respectively (Abstract: Singh et al. Abstract # 3597, AACR 2022. https://s3.us-west-2.amazonaws.com/rvmdpubs.revmed.com/2022/AACR_2022_Singh.pdf).All Solid TumorsSOLIDMRTX1133LEVEL_4LEVEL_Fda3['36472553']MRTX-1133 is an orally available, small-molecule inhibitor of KRAS G12D. In vitro studies with KRAS G12D-mutant PDAC cell lines demonstrated selective sensitivity to MRTX-1133 as measured by inhibition of KRAS G12D and downstream MAPK signaling activity compared to KRAS wildtype and KRAS G12C-mutant cell lines (PMID: 36472553). In vivo studies with KRAS G12D-mutant pancreatic ductal adenocarcinoma mouse xenograft models demonstrated antitumor activity to MRTX-1133 as measured by complete or near-complete remissions following treatment (PMID: 36472553).All Solid TumorsSOLIDSetidegrasibLEVEL_4LEVEL_Fda3['40849515']Setidegrasib is an intravenously administered, small-molecule KRAS G12D degrader. There are promising laboratory data to support use of setidegrasib in patients with KRAS G12D-mutated solid tumors. In vitro studies with KRAS G12D-mutated pancreatic cancer cells demonstrated selective sensitivity to setidegrasib as measured by degradation of KRAS G12D, inhibition of ERK phosphorylation and inhibition of cellular proliferation compared to KRAS wildtype cancer cells (PMID: 40849515). In vivo studies with KRAS G12D-mutant pancreatic ductal adenocarcinoma and non-small cell lung cancer mouse xenograft models demonstrated antitumor activity to setidegrasib as measured by tumor regression (PMID: 40849515).All Solid TumorsSOLIDTrametinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).All Solid TumorsSOLIDCobimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).All Solid TumorsSOLIDBinimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).All Solid TumorsSOLID17349581;19296721;11751631;15093544;30341394;28572459;20570890;32792368;20147967;Nagashima et al. Abstract# 5735, AACR 2023.(https://aacrjournals.org/cancerres/article/83/7_Supplement/5735/722276)Daraxonrasib,MRTX1133,Setidegrasib,Trametinib,Cobimetinib,Binimetinib20921465;21228335;20619739;24024839;18316791;30857956;40644648;30867592;32991018;29236635;30361829;38593348;Koltun et al. Abstract# 3597, AACR 2022.(https://aacrjournals.org/cancerres/article/82/12_Supplement/3597/702320);Arbour, KC. et al., Abstract#6520, Annals of Oncol., 2023.(https://www.annalsofoncology.org/article/S0923-7534%2823%2902675-3/fulltext);Singh et al. Abstract # 3597, AACR 2022.(https://s3.us-west-2.amazonaws.com/rvmdpubs.revmed.com/2022/AACR_2022_Singh.pdf);Garrido-Laguna et al. 2025 ASCO Gastrointestinal Cancers Symposium.(https://www.asco.org/abstracts-presentations/ABSTRACT474560);Arbour et al. Abstract# 6520, Annals of Oncol., 2023.(https://www.annalsofoncology.org/article/S0923-7534%2823%2902675-3/fulltext);41879829;40849515;Park et al. Abstract# 775, ASCO Gastrointestinal Cancers Symposium, 2026.(https://ascopubs.org/doi/abs/10.1200/JCO.2026.44.2_suppl.775);36472553;33933896;25435214;24746704;23934108JMML,MDSETPLL10049057;23832011;25691160;26457647;12717436;22934674;23512829;22237106120Tmissense_variantKRAS3845GeneENST00000256078.4ENST00000256078.4:c.35G>ANP_004976.2:p.Gly12Asp79GLY12ASP/RS121913529https://civicdb.org/links/variants/79KRAS_G12D79NM_004985.4:c.35G>A/NP_004976.2:p.Gly12Asp/NC_000012.11:g.25398284C>T/ENST00000256078.4:c.35G>ACA12253812582
TUMORp.G12CENSP00000308495.3:p.Gly12Cyschr1225245351CAPASSNM_004985missense_variantMODERATEKRAS2/5c.34G>Trs121913530&CM076251&COSV55497461&COSV55497469&COSV55497582&COSV56157736SNVdeleterious_low_confidence(0)0.000.010.000.000.8532.6400e-01Gallbladder_cancer&Lung_cancer&RASopathy&not_provided&Lung_carcinoma&Non-small_cell_lung_carcinoma&Lung_adenocarcinoma&Endometrial_carcinomaNC_000012.12:g.25245351C>Acriteria_provided&_single_submitterLikely_pathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongKRASG12Cchr12:25245351-25245351v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot05/13/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAdagrasib,Adagrasib+Cetuximab,Avutometinib+Defactinib,Sotorasib,Sotorasib+PanitumumabAdagrasib,Adagrasib+Panitumumab,Cobimetinib,Sotorasib,Sotorasib+Cetuximab,TrametinibAdagrasib,Cobimetinib,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_1LEVEL_R1LEVEL_Dx270,300/1G12C0.3GRCh38KRASCCA25245351KRAS_G12C.GT:AD:AF:DP0/1:70,30:0.3:100AENSG00000133703TranscriptENST00000311936protein_coding2243412G/CGgt/Tgt-1HGNCHGNC:6407YESMANE_SelectNM_004985.51P4CCDS8702.1ENSP00000308495P01116.262UPI0000001252P01116-2Ensembl1Gene3D:3.40.50.300&AFDB-ENSP_mappings:AF-P01116-F1&Pfam:PF00071&Prints:PR00449&PROSITE_profiles:PS51419&PROSITE_profiles:PS51420&PROSITE_profiles:PS51421&PANTHER:PTHR24070&SMART:SM00173&SMART:SM00174&SMART:SM00175&Superfamily:SSF52540&NCBIFAM:TIGR00231&CDD:cd04138&Low_complexity_(Seg):segnot_provided&pathogenic&pathogenic/likely_pathogenic&likely_pathogenic0&1&1&1&1&11&1&1&1&1&124033266&26900293&12460918&25157968&17332249&17384584&18794081&19018267&21975775&17704260&19255327&19773371&22683711&23406027&15696205&16361624&16618717&18316791&19114683&19679400&20921462&20921465&21228335&22722830&32000721&23182985&7773929&19358724&20805368&23014527&25044103&6320174&6695174&11745231&18594010&30048458&32175330&32805489&34649968&37160318&28347348&31117243&29610392&34737598&34381078&30797065&26242988&33254149&35638910&23480694&32934698&35658005&31666701&37425402&37713191&38413718FAIL438-58KRAS125780.0000227617MONDO:MONDO:0005411&MedGen:C0153452&MONDO:MONDO:0008903&MedGen:C0242379&OMIM:211980&MONDO:MONDO:0021060&MedGen:C5555857&Orphanet:536391&MedGen:C3661900&MONDO:MONDO:0005138&MedGen:C0684249&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&Human_Phenotype_Ontology:HP:0030078&MONDO:MONDO:0005061&MeSH:D000077192&MedGen:C0152013&Human_Phenotype_Ontology:HP:0012114&MONDO:MONDO:0002447&MedGen:C0476089&OMIM:608089SCV004501632single_nucleotide_variantSO:0001483ClinGen:CA122528&OMIM:190070.0001&UniProtKB:P01116#VAR_006839KRAS:3845SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094260121913530Diffuse_pediatric-type_high-grade_glioma&_H3-wildtype_and_IDH-wildtype&Embryonal_rhabdomyosarcoma&Ovarian_mucinous_adenocarcinoma&Adenocarcinoma_of_the_large_intestineMONDO:MONDO:0858939&MedGen:C5669918&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0005601&MedGen:C1335167&Orphanet:398961&Human_Phenotype_Ontology:HP:0040275&MONDO:MONDO:0005008&MedGen:C1319315SCV007105402&SCV007105420&SCV007105431&SCV00710552112:25245351-252453511KRASp.G12CTrueThe KRAS G12C mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in lung and colorectal cancer (PMID: 28572459). Expression of this mutation in lung and breast cancer cell lines and mouse models demonstrated that it is activating, as measured by increased pathway activation, cell proliferation, colony formation and in vivo tumor formation compared to wildtype (PMID: 25705018, 26841430, 16051643, 32792368). In vitro studies of cells expressing the KRAS G12C mutation demonstrate that it is sensitive to several targeted therapies designed specifically for this allele, including ARS853 (PMID: 26841430, 24256730). In a phase I clinical trial of the KRAS G12C inhibitor AMG510 in which thirteen patients with non-small cell lung cancer harboring this mutation were given the target drug dose, 100% of patients responded, with seven patients having partial response and six patients having stable disease (Abstract: Fakih et al. Abstract# 3003, ASCO 2019. https://meetinglibrary.asco.org/record/172411/abstract). KRAS G12C has been identified as an acquired resistance mutation in two patients with EGFR-mutated non-small cell lung cancer following a durable response to osimertinib (PMID: 38096473).KRAS, a GTPase which functions as an upstream regulator of the MAPK pathway, is frequently mutated in various cancer types including lung, colorectal and pancreatic cancers.25705018|38096473|24256730|28572459|16051643|32792368|26841430G12C3845KRASGRCh38.MUTATION.The KRAS G12C mutation is known to be oncogenic.FalseLEVEL_Fda2The KRAS G12C mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in lung and colorectal cancer (PMID: 28572459). Expression of this mutation in lung and breast cancer cell lines and mouse models demonstrated that it is activating, as measured by increased pathway activation, cell proliferation, colony formation and in vivo tumor formation compared to wildtype (PMID: 25705018, 26841430, 16051643, 32792368). In vitro studies of cells expressing the KRAS G12C mutation demonstrate that it is sensitive to several targeted therapies designed specifically for this allele, including ARS853 (PMID: 26841430, 24256730). In a phase I clinical trial of the KRAS G12C inhibitor AMG510 in which thirteen patients with non-small cell lung cancer harboring this mutation were given the target drug dose, 100% of patients responded, with seven patients having partial response and six patients having stable disease (Abstract: Fakih et al. Abstract# 3003, ASCO 2019. https://meetinglibrary.asco.org/record/172411/abstract). KRAS G12C has been identified as an acquired resistance mutation in two patients with EGFR-mutated non-small cell lung cancer following a durable response to osimertinib (PMID: 38096473).['25705018', '38096473', '24256730', '28572459', '16051643', '32792368', '26841430'][{'abstract': 'Fakih et al. Abstract# 3003, ASCO 2019.', 'link': 'https://meetinglibrary.asco.org/record/172411/abstract'}]LEVEL_Dx2['10049057', '23832011', '25691160', '26457647', '12717436']This assertion is supported by (PMID: 10049057, 23832011, 26457647, 12717436, PMID: 25691160).Juvenile Myelomonocytic LeukemiaMyelodysplastic/Myeloproliferative NeoplasmsLIQUIDMyeloidLEVEL_Dx2['22934674', '23512829']This assertion is supported by (PMID: 23512829, 22934674).Myelodysplastic SyndromesMyelodysplastic SyndromesLIQUIDMyeloidLEVEL_Dx3['22237106']This assertion is supported by (PMID: 22237106).Early T-Cell Precursor Lymphoblastic LeukemiaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidCetuximabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).Colorectal CancerSOLIDBowelTucatinib + TrastuzumabLEVEL_R1LEVEL_Fda2['30857956']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Patients with metastatic colorectal cancer harboring KRAS mutations do not respond favorably to trastuzumab as seen in the MyPath trial. In the multiple basket MyPath Phase IIa trial of pertuzumab and trastuzumab in which 56 metastatic colorectal cancer patients with HER2 amplification received combination therapy, the objective response rate for patients with KRAS wildtype colorectal cancer (43/56 patients) compared to KRAS mutated colorectal cancer (13/56 patients) was 40% (17/43, 95% CI, 25%56%) versus 8% (1/13, 95% CI 0.2%36%), respectively (PMID: 30857956).Colorectal CancerSOLIDBowelPanitumumabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).Colorectal CancerSOLIDBowelAdagrasibLEVEL_1LEVEL_Fda2['35658005']Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. FDA approval was based on the results of the Phase I/II KRYSTAL-1 (NCT03785249) trial of adagrasib in 112 evaluable patients with KRAS G12C-mutant non-small cell lung cancer in which the overall response rate (ORR) was 42.9% (48 of 112 patients) with a disease control rate of 79.5% (89 of 112 patients), the median duration of response (DOR) of 8.5 months (95% CI= 6.213.8), median progression-free survival (PFS) of 6.5 months (95% CI= 4.78.4) and median overall survival (OS) of 12.6 months (95% CI= 9.2NE) (PMID: 35658005). In the two-year follow-up of the Phase I/II KRYSTAL-1 trial in 128 evaluable patients with KRAS G12C-mutant non-small cell lung cancer, the ORR was 43.0% (n=55/128 patients), the median DOR was 12.4 months (95% CI= 7.0-15.2), the median PFS was 6.9 months (95% CI= 5.4-8.7) with a 1-year PFS rate of 35.0% (95% CI= 25.9-44.2) and the median OS was 14.1 months (95% CI= 9.2-18.7) with a 1-year and 2-year OS rate of 52.8% and 31.3%, respectively (Abstract: Gadgeel, S. et al., Abstract# MA06.04, Journal of Thoracic Oncology Vol. 18. https://www.jto.org/article/S1556-0864%2823%2900954-1/fulltext).Non-Small Cell Lung CancerSOLIDLungAdagrasib + CetuximabLEVEL_1LEVEL_Fda2['38587856']Adagrasib, a small molecule KRAS G12C inhibitor, and cetuximab, an anti-EGFR monoclonal antibody, are FDA-approved in combination for the treatment of adult patients with KRAS G12C-mutated locally advanced or metastatic colorectal cancer (CRC), as determined by an FDA-approved test, who have received prior treatment with fluoropyrimidine-, oxaliplatin- and irinotecan-based chemotherapy. KRAS G12C mutation for treatment with adagrasib plus cetuximab was detected by the therascreen KRAS RGQ PCR Kit. FDA approval was based on the results of the Phase I/II KRYSTAL-1 (NCT03785249) trial of adagrasib plus cetuximab in 94 patients with KRAS G12C-mutated CRC. In the Phase I/II KRYSTAL-1 (NCT03785249) trial, the objective response rate was 34% (95% CI=26.4-44.5), with a 34% (n=32) partial response rate and 51.1% (n=48) stable disease rate, the median duration of response was 5.8 months (95% CI=4.2-7.6), the median progression-free survival was 6.9 months (95% CI=5.7-7.4) and the median overall survival was 15.9 months (95% CI=11.8-18.8) (PMID: 38587856).Colorectal CancerSOLIDBowelAvutometinib + DefactinibLEVEL_1LEVEL_Fda2['40644648']Avutometinib, a RAF/MEK clamp inhibitor, and defactinib, a FAK inhibitor, are FDA-approved in combination for the treatment of adult patients with KRAS-mutated recurrent low-grade serous ovarian cancer (LGSOC) who have received prior systemic therapy. FDA approval was based on the results of the Phase II RAMP-201 (NCT04625270) trial of avutometinib plus defactinib in 109 patients with recurrent LGSOC._In the Phase II RAMP-201 (NCT04625270) trial, patients with KRAS-mutated LGSOC (n=57) demonstrated an overall response rate (ORR) of 44% (n=25), with a 2% (n=2) complete response (CR) rate, 40% (n=23) partial response (PR) rate and 49% (n=28) stable disease (SD) rate, a median duration of response (DOR) of 31.0 months (95% CI=14.8-31.1) and a median progression-free survival (PFS) of 22.0 months (95% CI=11.1-36.6) (PMID: 40644648). Responders included patients with the following KRAS mutations: KRAS A146V, G12D, G12R, G12V and Q61H (PMID: 40644648). Of patients with KRAS wildtype LGSOC (n=52), the cohort demonstrated an ORR of 17% (n=9), with a 17% (n=9) PR rate and 65% (n=34) SD rate, and a median PFS of 9.2 months (95% CI=5.5-NE) (PMID: 40644648).Low-Grade Serous Ovarian CancerOvarian CancerSOLIDOvary/Fallopian TubeSotorasibLEVEL_1LEVEL_Fda2['38157806', '34096690', '32955176', '37098232', '36764316']Sotorasib is a small molecule inhibitor of the KRAS G12C mutant protein that is FDA-approved for adult patients with KRAS G12C-mutant locally advanced or metastatic non-small cell lung cancer (NSCLC). FDA approval was based on the results of the Phase II CodeBreaK 100 trial of sotorasib in 124 patients with KRAS G12C mutant NSCLC in which the objective response rate was 36% (95% CI= 28-45) and the median duration of response was 10.0 months (range: 1.3+, 11.1), with 2% of evaluable patients having a complete response and 35% of evaluable patients having a partial response (PMID: 34096690). In the two-year analysis of the Phase I/Phase II CodeBreaK 100 trial of sotorasib in 174 patients with KRAS G12C mutant NSCLC, the objective response rate was 41%, the median duration of response was 12.3 months, the progression-free survival was 6.3 months, the overall survival was 12.5 months and the two-year overall survival rate was 33% (PMID: 37098232). In the Phase III CodeBreaK 200 trial of sotorasib versus docetaxel in 345 patients with KRAS G12C-mutant NSCLC (n=171 and n=174, respectively), the objective response rates were 28.1% versus 13.2% (p < .001), the median duration of response was 8.6 months versus 6.8 months, and the overall rate of disease control was 82.5% versus 60.3%, respectively (PMID: 36764316). In the Phase I trial of sotorasib in 59 patients with KRAS G12C-mutant NSCLC, the objective response rate was 32.2% (n=19), the disease control rate was 88.1% (n=52) and the median progression-free survival was 6.3 months (range, 0.0+ to 14.9 [with + indicating that the value includes patient data that were censored at data cutoff]) (PMID: 32955176). In a retrospective, observational study of the Italian expanded access program of sotorasib in 196 patients with KRAS G12C-mutant advanced NSCLC, the objective response rate was 26% (n=51), with 51 patients demonstrating a partial response, 60 patients demonstrating stable disease and 65 patients demonstrating progressive disease, the median progression-free survival was 5.8 months (95% CI=5-6.5) and the median overall survival was 8.2 months (95% CI=6.3-9.9) (PMID: 38157806).Non-Small Cell Lung CancerSOLIDLungSotorasib + PanitumumabLEVEL_1LEVEL_Fda2['37870968']Sotorasib, a small molecule KRAS G12C inhibitor, and panitumumab, an anti-EGFR monoclonal antibody, are FDA-approved in combination for the treatment of adult patients with KRAS G12C-mutated metastatic colorectal cancer (mCRC) as determined by an FDA-approved test, who have received prior fluoropyrimidine-, oxaliplatin- and irinotecan-based chemotherapy. KRAS G12C mutation for treatment with sotorasib plus panitumumab was detected by the Guardant360 CDx or the therascreen KRAS RGQ PCR Kit. FDA approval was based on the results of the Phase III CodeBreaK 300 (NCT05198934) trial of sotorasib plus panitumumab versus standard-of-care (trifluridine/tipiracil or regorafenib) in patients with KRAS G12C-mutated CRC.__In the Phase III CodeBreaK 300 (NCT05198934) trial, the sotorasib cohort (n=53) demonstrated an overall response rate (ORR) of 26% (95% CI=15-40), with a 1.9% (n=1) complete response (CR) rate and 25% (n=13) partial response (PR) rate, a median progression-free survival (PFS) of 5.6 months (95% CI=4.2-6.3) and a median overall survival (OS) that was not reached (95% CI=8.6-NR) (PMID: 37870968). In the standard-of-care cohort (n=54), the ORR was 0% (95% CI=0-7), the median PFS was 2 months (95% CI=1.9-3.9) (HR=0.48 [95% CI=0.3-0.78], p=0.005) and the median OS was 10.3 months (95% CI=7-NR) (HR=0.7 [95% CI=0.41-1.18]) (PMID: 37870968).Colorectal CancerSOLIDBowelAdagrasibLEVEL_2LEVEL_Fda2['37099736']Adagrasib is an orally available, small molecule KRAS G12C inhibitor that is FDA-approved for adult patients with KRAS G12C-mutated locally advanced or metastatic non-small cell lung cancer, as determined by an FDA-approved test, who have received at least one prior systemic therapy. The NCCN Biliary Tract Cancers Guidelines (V2.2024) lists tucatinib plus trastuzumab under "Subsequent-Line Therapy for Biliary Tract Cancers if Disease Progression" for patients with KRAS G12C-mutant biliary tract cancer. NCCN recommendation was based on the results of the Phase II KRYSTAL-1 (NCT03785249) trial of adagrasib in 64 patients with KRAS G12C-mutated solid tumors (n=12, biliary tract cancer). In the Phase II KRYSTAL-1 (NCT03785249), the KRAS G12C-mutant biliary tract cancer cohort demonstrated an overall response rate of 41.7% (5/12) (95% CI=15.2-72.3), a median progression-free survival of 8.6 months (95% CI=2.7-11.3) and a median overall survival of 15.1 months (95% CI=8.6-NE) (PMID: 37099736).Hepatobiliary CancerSOLIDMIXEDAdagrasibLEVEL_2LEVEL_Fda2['31658955', '37099736']Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. The Pancreatic Cancer NCCN v1.2023 lists adagrasib for patients with KRAS G12C-mutant pancreatic cancer. In a phase II trial (KRYSTAL-1, NCT03785249) of adagrasib in 30 patients with previously treated, inoperable, or metastatic KRAS G12C-mutant gastrointestinal cancers excluding colorectal cancer, preliminary data demonstrated a 100% disease control rate in 27 evaluable patients (PMID: 37099736). Among ten evaluable patients with pancreatic ductal adenocarcinoma, 50% experienced a partial response after a median of 8.1 months and the rest developed stable disease (PMID: 37099736). In updated data from the KRYSTAL-1 trial, the overall response rate in 21 patients with KRAS G12C-mutant pancreatic cancer to treatment with adagrasib was 33.3% (Abstract: Pant et al. Abstract # 425082, ASCO Monthly Plenary Series April 2023. https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.36_suppl.425082). In a preclinical setting, seventeen of 26 (65%) KRAS G12C-positive cell line and patient-derived xenograft models from multiple tumor types that were treated with adagrasib resulted in tumor regression (PMID: 31658955).Pancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasAdagrasibLEVEL_2LEVEL_Fda2['37099736']Adagrasib is an orally available, small molecule KRAS G12C inhibitor that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. The NCCN Small Bowel Adenocarcinoma Guidelines (V1.2025) lists adagrasib monotherapy under "Second-Line and Subsequent Therapy" for patients with KRAS G12C-mutant small bowel adenocarcinoma. NCCN recommendation is based on the results of the Phase I/II KRYSTAL-1 (NCT03785249) trial of adagrasib in patients with KRAS G12C-mutant colorectal cancer. Due to the infrequency of KRAS G12C-mutant small bowel cancers, this recommendation relies on evidence extrapolated from colorectal cancer patients.__In the Phase I/II KRYSTAL-1 (NCT03785249) trial arm of adagrasib monotherapy for patients with KRAS G12C-mutant solid tumors, patients with small bowel cancer (n=2) demonstrated an overall response rate (ORR) of 50.0% (n=1) (95% CI=1.3-98.7), with one partial response, a median progression-free survival (PFS) of 5.6 months (95% CI=2.6-NE) and a median overall survival (OS) of 7.9 months (95% CI=6.2-NE) (PMID: 37099736).Small Bowel CancerSOLIDBowelAdagrasib + PanitumumabLEVEL_2LEVEL_Fda2['37870968', '38587856', '36546659', '38177853']Adagrasib and sotorasib are KRAS G12C-targeted inhibitors that have been FDA-approved for the treatment of adult patients with KRAS G12C-mutated non-small cell lung cancer. The NCCN compendium lists KRAS G12C-targeted inhibitors, either adragrasib or sotorasib, in combination with an anti-EGFR monoclonal antibody, either cetuximab or panitumumab, as a treatment for patients with KRAS G12C-mutated colorectal cancer. __In the Phase I-II KRYSTAL-1 trial of adagrasib versus adagrasib plus cetuximab in patients with KRAS G12C-mutated colorectal cancer, the combination therapy group (n=28) demonstrated a response rate of 46% (95% CI=28, 66), a median response duration of 7.6 months (95% CI=5.7, NE) and a median progression-free survival (PFS) of 6.9 months (95% CI=5.4, 8.1), while the monotherapy group (n=43) demonstrated a response rate of 19% (95% CI=8, 33), a median response duration of 4.3 months (95% CI= 2.3, 8.3) and a median PFS of 5.6 months (95% CI=4.1, 8.3) (PMID: 36546659). In an updated analysis of the Phase I-II KRYSTAL-1 trial of adagrasib plus cetuximab in 94 patients with KRAS G12C-mutant colorectal cancer, the cohort demonstrated an objective response rate (ORR) of 34.0%, a median PFS of 6.9 months (95% CI=5.7-7.4) and a median overall survival of 15.9 months (95% CI=11.8-18.8) (PMID: 38587856). __In the Phase 1b dose-exploration and dose-expansion substudy of the CodeBreaK 101 trial of sotorasib plus panitumumab in 48 patients with KRAS G12C-mutated colorectal cancer (dose-exploration cohort, n=8, dose-expansion cohort, n=40), the dose-expansion cohort demonstrated an ORR of 30% (95% CI=16.6, 46.5), with 12 patients (30.0%, 95% CI=16.6, 46.5) achieving a confirmed partial response, a disease control rate of 92.5% (95% CI= 79.6, 98.4), a median PFS of 5.7 months (95% CI=4.2, 7.7), a median overall survival of 15.2 months (95% CI=12.5, not estimable) and tumor shrinkage of any magnitude in 35 patients (87.5%) (PMID: 38177853). In the Phase III CodeBreaK 300 trial of sotorasib plus panitumumab versus standard care in patients with KRAS G12C-mutated refractory metastatic colorectal cancer, the sotorasib 960-mg plus panitumumab therapy group (n=53) demonstrated an ORR of 26.4% (95% CI=15.3, 40.3) with 1 complete response and a median PFS of 5.6 months (95% CI=4.2, 6.3), while the standard care therapy group (n=54) demonstrated an ORR of 0% (95% CI=0.0, 6.6) and a median PFS of 2.2 months (95% CI=1.9, 3.9) (HR=0.49 [95% CI=0.30, 0.80], P=0.006) (PMID: 37870968).Colorectal CancerSOLIDBowelCobimetinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).Erdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidCobimetinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidCobimetinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).Rosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidSotorasibLEVEL_2LEVEL_Fda2['32955176']Sotorasib and adagrasib are orally available, small molecule KRAS G12C inhibitors that are FDA-approved for adult patients with KRAS G12C-mutated locally advanced or metastatic non-small cell lung cancer (NSCLC), as determined by an FDA-approved test. The NCCN compendium lists sotorasib and adagrasib as single agents for patients with KRAS G12C-mutant ampullary adenocarcinoma based on the results from the Phase I CodeBreaK100 (NCT03600883) trial of sotorasib in 28 patients with KRAS G12C-mutant solid tumors, excluding NSCLC and colorectal cancer. In the Phase I CodeBreaK100 (NCT03600883) trial, the cohort demonstrated an objective response rate of 14.3% (95% CI=4.03-32.67), with four patients achieving a partial response and 17 patients achieving stable disease (n=1, patient with ampullary cancer) (PMID: 32955176).Ampullary CancerSOLIDAmpulla of VaterSotorasibLEVEL_2LEVEL_Fda2['32955176']Sotorasib is a small molecule inhibitor of the KRAS G12C-mutant protein. The Pancreatic Cancer NCCN v1.2023 lists sotorasib for patients with KRAS G12C-mutant pancreatic cancer. In the Phase I/II CodeBreak100 trial in 38 patients with KRAS G12C-mutant pancreatic cancer, eight patients had a confirmed partial response for an overall response rate of 21% (95% CI= 9.55-37.32) (Abstract: Strickler et al. Abstract# 360490, ASCO GI 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.36_suppl.360490). In the Phase I trial of sotorasib in 12 patients with KRAS G12C-mutant pancreatic cancer, one patient (n=1/12, 8.33%) had a confirmed partial response to treatment (PMID: 32955176).Pancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasSotorasibLEVEL_2LEVEL_Fda2['32955176']Sotorasib is an orally available, small molecule KRAS G12C inhibitor that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. The NCCN Small Bowel Adenocarcinoma Guidelines (V1.2025) lists sotorasib monotherapy under "Second-Line and Subsequent Therapy" for patients with KRAS G12C-mutant small bowel adenocarcinoma. NCCN recommendation is based on the results of the Phase II CodeBreaK 100 (NCT03600883) trial of sotorasib in patients with KRAS G12C-mutant colorectal cancer. Due to the infrequency of KRAS G12C-mutant small bowel cancers, this recommendation relies on evidence extrapolated from colorectal cancer patients.__In the Phase II CodeBreaK 100 (NCT03600883) trial arm of sotorasib monotherapy for patients with KRAS G12C-mutant solid tumors, a patient with small bowel cancer demonstrated stable disease after treatment with sotorasib (PMID: 32955176).Small Bowel CancerSOLIDBowelAdagrasibLEVEL_2LEVEL_Fda2['32955176']Sotorasib and adagrasib are orally available, small molecule KRAS G12C inhibitors that are FDA-approved for adult patients with KRAS G12C-mutated locally advanced or metastatic non-small cell lung cancer (NSCLC), as determined by an FDA-approved test. The NCCN compendium lists sotorasib and adagrasib as single agents for patients with KRAS G12C-mutant ampullary adenocarcinoma based on the results from the Phase I CodeBreaK100 (NCT03600883) trial of sotorasib in 28 patients with KRAS G12C-mutant solid tumors, excluding NSCLC and colorectal cancer. In the Phase I CodeBreaK100 (NCT03600883) trial, the cohort demonstrated an objective response rate of 14.3% (95% CI=4.03-32.67), with four patients achieving a partial response and 17 patients achieving stable disease (n=1, patient with ampullary cancer) (PMID: 32955176).Ampullary CancerSOLIDAmpulla of VaterSotorasib + CetuximabLEVEL_2LEVEL_Fda2['37870968', '38587856', '36546659', '38177853']Adagrasib and sotorasib are KRAS G12C-targeted inhibitors that have been FDA-approved for the treatment of adult patients with KRAS G12C-mutated non-small cell lung cancer. The NCCN compendium lists KRAS G12C-targeted inhibitors, either adragrasib or sotorasib, in combination with an anti-EGFR monoclonal antibody, either cetuximab or panitumumab, as a treatment for patients with KRAS G12C-mutated colorectal cancer. __In the Phase I-II KRYSTAL-1 trial of adagrasib versus adagrasib plus cetuximab in patients with KRAS G12C-mutated colorectal cancer, the combination therapy group (n=28) demonstrated a response rate of 46% (95% CI=28, 66), a median response duration of 7.6 months (95% CI=5.7, NE) and a median progression-free survival (PFS) of 6.9 months (95% CI=5.4, 8.1), while the monotherapy group (n=43) demonstrated a response rate of 19% (95% CI=8, 33), a median response duration of 4.3 months (95% CI= 2.3, 8.3) and a median PFS of 5.6 months (95% CI=4.1, 8.3) (PMID: 36546659). In an updated analysis of the Phase I-II KRYSTAL-1 trial of adagrasib plus cetuximab in 94 patients with KRAS G12C-mutant colorectal cancer, the cohort demonstrated an objective response rate (ORR) of 34.0%, a median PFS of 6.9 months (95% CI=5.7-7.4) and a median overall survival of 15.9 months (95% CI=11.8-18.8) (PMID: 38587856). __In the Phase 1b dose-exploration and dose-expansion substudy of the CodeBreaK 101 trial of sotorasib plus panitumumab in 48 patients with KRAS G12C-mutated colorectal cancer (dose-exploration cohort, n=8, dose-expansion cohort, n=40), the dose-expansion cohort demonstrated an ORR of 30% (95% CI=16.6, 46.5), with 12 patients (30.0%, 95% CI=16.6, 46.5) achieving a confirmed partial response, a disease control rate of 92.5% (95% CI= 79.6, 98.4), a median PFS of 5.7 months (95% CI=4.2, 7.7), a median overall survival of 15.2 months (95% CI=12.5, not estimable) and tumor shrinkage of any magnitude in 35 patients (87.5%) (PMID: 38177853). In the Phase III CodeBreaK 300 trial of sotorasib plus panitumumab versus standard care in patients with KRAS G12C-mutated refractory metastatic colorectal cancer, the sotorasib 960-mg plus panitumumab therapy group (n=53) demonstrated an ORR of 26.4% (95% CI=15.3, 40.3) with 1 complete response and a median PFS of 5.6 months (95% CI=4.2, 6.3), while the standard care therapy group (n=54) demonstrated an ORR of 0% (95% CI=0.0, 6.6) and a median PFS of 2.2 months (95% CI=1.9, 3.9) (HR=0.49 [95% CI=0.30, 0.80], P=0.006) (PMID: 37870968).Colorectal CancerSOLIDBowelTrametinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).Erdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).Langerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidTrametinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).Rosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidAdagrasibLEVEL_3ALEVEL_Fda3['31658955']Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. In a phase II trial (KRYSTAL-1, NCT03785249) of adagrasib in 30 patients with previously treated, inoperable, or metastatic KRAS G12C-mutant gastrointestinal cancers excluding colorectal cancer, preliminary data demonstrated a 100% disease control rate in 27 evaluable patients (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). After a median of 6.3 months, four of eight patients with biliary tract cancer, one patient with gastroesophageal junction cancer, and one with small bowel cancer had partial responses, and all other evaluable patients with GI cancers developed stable disease (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). In a preclinical setting, seventeen of 26 (65%) KRAS G12C-positive cell line and patient-derived xenograft models from multiple tumor types that were treated with adagrasib resulted in tumor regression (PMID: 31658955). Furthermore, case reports of patients with KRAS G12C-positive lung and colon adenocarcinomas have also reported objective responses to adagrasib (PMID: 31658955).Esophagogastric CancerSOLIDEsophagus/StomachAdagrasibLEVEL_3ALEVEL_Fda3['31658955']Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. In a phase II trial (KRYSTAL-1, NCT03785249) of adagrasib in 30 patients with previously treated, inoperable, or metastatic KRAS G12C-mutant gastrointestinal cancers excluding colorectal cancer, preliminary data demonstrated a 100% disease control rate in 27 evaluable patients (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). After a median of 6.3 months, four of eight patients with biliary tract cancer, one patient with gastroesophageal junction cancer, and one with small bowel cancer had partial responses, and all other evaluable patients with GI cancers developed stable disease (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). In a preclinical setting, seventeen of 26 (65%) KRAS G12C-positive cell line and patient-derived xenograft models from multiple tumor types that were treated with adagrasib resulted in tumor regression (PMID: 31658955). Furthermore, case reports of patients with KRAS G12C-positive lung and colon adenocarcinomas have also reported objective responses to adagrasib (PMID: 31658955).Tubular Adenoma of the ColonSOLIDBowelAdagrasibLEVEL_3ALEVEL_Fda3['31658955']Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. In a phase II trial (KRYSTAL-1, NCT03785249) of adagrasib in 30 patients with previously treated, inoperable, or metastatic KRAS G12C-mutant gastrointestinal cancers excluding colorectal cancer, preliminary data demonstrated a 100% disease control rate in 27 evaluable patients (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). After a median of 6.3 months, four of eight patients with biliary tract cancer, one patient with gastroesophageal junction cancer, and one with small bowel cancer had partial responses, and all other evaluable patients with GI cancers developed stable disease (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). In a preclinical setting, seventeen of 26 (65%) KRAS G12C-positive cell line and patient-derived xenograft models from multiple tumor types that were treated with adagrasib resulted in tumor regression (PMID: 31658955). Furthermore, case reports of patients with KRAS G12C-positive lung and colon adenocarcinomas have also reported objective responses to adagrasib (PMID: 31658955).Gastrointestinal Neuroendocrine Tumors of the Esophagus/StomachSOLIDEsophagus/StomachAdagrasibLEVEL_3ALEVEL_Fda3['31658955']Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. In a phase II trial (KRYSTAL-1, NCT03785249) of adagrasib in 30 patients with previously treated, inoperable, or metastatic KRAS G12C-mutant gastrointestinal cancers excluding colorectal cancer, preliminary data demonstrated a 100% disease control rate in 27 evaluable patients (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). After a median of 6.3 months, four of eight patients with biliary tract cancer, one patient with gastroesophageal junction cancer, and one with small bowel cancer had partial responses, and all other evaluable patients with GI cancers developed stable disease (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). In a preclinical setting, seventeen of 26 (65%) KRAS G12C-positive cell line and patient-derived xenograft models from multiple tumor types that were treated with adagrasib resulted in tumor regression (PMID: 31658955). Furthermore, case reports of patients with KRAS G12C-positive lung and colon adenocarcinomas have also reported objective responses to adagrasib (PMID: 31658955).Anal CancerSOLIDBowelCobimetinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).HistiocytosisLIQUIDMyeloidTrametinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).HistiocytosisLIQUIDMyeloidTrametinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).All Solid TumorsSOLIDCobimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).All Solid TumorsSOLIDBinimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).All Solid TumorsSOLID25705018;38096473;24256730;28572459;16051643;32792368;26841430;Fakih et al. Abstract# 3003, ASCO 2019.(https://meetinglibrary.asco.org/record/172411/abstract)Trametinib,Cobimetinib,Binimetinib20921465;21228335;20619739;24024839;18316791;30857956;35658005;Gadgeel, S. et al., Abstract# MA06.04, Journal of Thoracic Oncology Vol. 18.(https://www.jto.org/article/S1556-0864%2823%2900954-1/fulltext);38587856;40644648;38157806;34096690;32955176;37098232;36764316;37870968;37099736;31658955;Pant et al. Abstract # 425082, ASCO Monthly Plenary Series April 2023.(https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.36_suppl.425082);36546659;38177853;30867592;32991018;29236635;Strickler et al. Abstract# 360490, ASCO GI 2022.(https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.36_suppl.360490);Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022.(https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519);30361829;33933896;25435214;24746704;23934108JMML,MDSETPLL10049057;23832011;25691160;26457647;12717436;22934674;23512829;22237106100Amissense_variantKRAS3845GeneENST00000256078.4ENST00000256078.4:c.34G>TNP_004976.2:p.Gly12Cys78GLY12CYS/RS121913530https://civicdb.org/links/variants/78KRAS_G12C78NM_004985.4:c.34G>T/NP_004976.2:p.Gly12Cys/NC_000012.11:g.25398285C>A/ENST00000256078.4:c.34G>TCA12252812578
TUMORchr1257748512N<DUP>PASSNM_000075coding_sequence_variant&5_prime_UTR_variant&3_prime_UTR_variant&intron_variantMODIFIERCDK41-8/81-7/7nanduplicationv7.0.LEVEL_Fda3False11/08/2024LEVEL_444728DUPTrueTrueTrueGain-of-functionOncogenicLEVEL_4.0/1GRCh38CDK4NN<DUP>57748512MantaDUP:CDK4_AMP.GT:PR:SR0/1:32,24:13,10duplicationENSG00000135446TranscriptENST00000257904protein_coding?-1079-1HGNCHGNC:1773YESMANE_SelectNM_000075.41P1CCDS8953.1ENSP00000257904P11802.259UPI0000113582P11802-1Ensembl10,10,157793240FalseCDK4 amplification results from the gain of the CDK4 gene on chromosome 12q13-14. Often, this leads to the overexpression of CDK4 protein, which has been demonstrated to induce hyperplasia and malignant transformation of human fibroblasts and astrocytes (PMID: 8101826, 10970848, 20534551). CDK4 overexpression is mutually exclusive with other genetic events in the same pathway, such as truncating mutations in RB1 or CDKN2A, and leads to the constitutive activation of the cell cycle. Mechanistically, increased availability of CDK4 results in the formation of CDK4/6-cyclin D complexes that are able to overcome p16-mediated inhibition and lead to cell cycle progression (PMID: 28303264). CDK4-amplified tumors are sensitive to inhibition with CDK4/6 inhibitors such as palbociclib and abemaciclib (PMID: 25028469, 23569312).CDK4, an intracellular kinase, is altered by amplification or mutation in various cancer types including soft tissue sarcomas and gliomas.23569312|28303264|25028469|20534551|8101826|10970848Amplification1019CDK4GRCh38.CNA.CDK4 amplification is known to be oncogenic.FalseLEVEL_Fda3CDK4 amplification results from the gain of the CDK4 gene on chromosome 12q13-14. Often, this leads to the overexpression of CDK4 protein, which has been demonstrated to induce hyperplasia and malignant transformation of human fibroblasts and astrocytes (PMID: 8101826, 10970848, 20534551). CDK4 overexpression is mutually exclusive with other genetic events in the same pathway, such as truncating mutations in RB1 or CDKN2A, and leads to the constitutive activation of the cell cycle. Mechanistically, increased availability of CDK4 results in the formation of CDK4/6-cyclin D complexes that are able to overcome p16-mediated inhibition and lead to cell cycle progression (PMID: 28303264). CDK4-amplified tumors are sensitive to inhibition with CDK4/6 inhibitors such as palbociclib and abemaciclib (PMID: 25028469, 23569312).['23569312', '28303264', '25028469', '20534551', '8101826', '10970848']PalbociclibLEVEL_4LEVEL_Fda3['37343202', '27124835', '23569312']Palbociclib and abemaciclib are small molecule inhibitors of cyclin-dependent kinases 4 and 6 (CDK4/6) that prevent downstream degradation of the RB tumor suppressor protein and are FDA-approved for use in patients with estrogen receptor-positive breast cancer. The NCCN recommends palbociclib as category 2A for patients with well-differentiated/dedifferentiated liposarcoma (WD-DDLS) based on the results of a Phase II study of palbociclib in CDK4-amplified, RB-positive WD-DDLS which showed a twelve-week progression-free survival of 66%, significantly exceeding the progression-free survival (PFS) goal of 40% (PMID: 23569312). A second phase II trial of palbociclib in patients with CDK4-amplified, RB-positive WD-DDLS showed that even with a lower dose of palbociclib, progression-free survival at twelve weeks was 57.2% (95% CI=42.4%-68.8%), which included one patient with a complete response (PMID: 27124835). In a case report, a patient with CDK4-amplified and MDM2-amplified WD-DDLS was treated with abemaciclib and demonstrated partial radiologic and near-complete pathological response (PMID: 37343202).Dedifferentiated LiposarcomaSoft Tissue SarcomaMIXEDSoft TissuePalbociclibLEVEL_4LEVEL_Fda3['37343202', '27124835', '23569312']Palbociclib and abemaciclib are small molecule inhibitors of cyclin-dependent kinases 4 and 6 (CDK4/6) that prevent downstream degradation of the RB tumor suppressor protein and are FDA-approved for use in patients with estrogen receptor-positive breast cancer. The NCCN recommends palbociclib as category 2A for patients with well-differentiated/dedifferentiated liposarcoma (WD-DDLS) based on the results of a Phase II study of palbociclib in CDK4-amplified, RB-positive WD-DDLS which showed a twelve-week progression-free survival of 66%, significantly exceeding the progression-free survival (PFS) goal of 40% (PMID: 23569312). A second phase II trial of palbociclib in patients with CDK4-amplified, RB-positive WD-DDLS showed that even with a lower dose of palbociclib, progression-free survival at twelve weeks was 57.2% (95% CI=42.4%-68.8%), which included one patient with a complete response (PMID: 27124835). In a case report, a patient with CDK4-amplified and MDM2-amplified WD-DDLS was treated with abemaciclib and demonstrated partial radiologic and near-complete pathological response (PMID: 37343202).Well-Differentiated LiposarcomaSoft Tissue SarcomaMIXEDSoft TissueAbemaciclibLEVEL_4LEVEL_Fda3['37343202', '27124835', '23569312']Palbociclib and abemaciclib are small molecule inhibitors of cyclin-dependent kinases 4 and 6 (CDK4/6) that prevent downstream degradation of the RB tumor suppressor protein and are FDA-approved for use in patients with estrogen receptor-positive breast cancer. The NCCN recommends palbociclib as category 2A for patients with well-differentiated/dedifferentiated liposarcoma (WD-DDLS) based on the results of a Phase II study of palbociclib in CDK4-amplified, RB-positive WD-DDLS which showed a twelve-week progression-free survival of 66%, significantly exceeding the progression-free survival (PFS) goal of 40% (PMID: 23569312). A second phase II trial of palbociclib in patients with CDK4-amplified, RB-positive WD-DDLS showed that even with a lower dose of palbociclib, progression-free survival at twelve weeks was 57.2% (95% CI=42.4%-68.8%), which included one patient with a complete response (PMID: 27124835). In a case report, a patient with CDK4-amplified and MDM2-amplified WD-DDLS was treated with abemaciclib and demonstrated partial radiologic and near-complete pathological response (PMID: 37343202).Dedifferentiated LiposarcomaSoft Tissue SarcomaMIXEDSoft TissueAbemaciclibLEVEL_4LEVEL_Fda3['37343202', '27124835', '23569312']Palbociclib and abemaciclib are small molecule inhibitors of cyclin-dependent kinases 4 and 6 (CDK4/6) that prevent downstream degradation of the RB tumor suppressor protein and are FDA-approved for use in patients with estrogen receptor-positive breast cancer. The NCCN recommends palbociclib as category 2A for patients with well-differentiated/dedifferentiated liposarcoma (WD-DDLS) based on the results of a Phase II study of palbociclib in CDK4-amplified, RB-positive WD-DDLS which showed a twelve-week progression-free survival of 66%, significantly exceeding the progression-free survival (PFS) goal of 40% (PMID: 23569312). A second phase II trial of palbociclib in patients with CDK4-amplified, RB-positive WD-DDLS showed that even with a lower dose of palbociclib, progression-free survival at twelve weeks was 57.2% (95% CI=42.4%-68.8%), which included one patient with a complete response (PMID: 27124835). In a case report, a patient with CDK4-amplified and MDM2-amplified WD-DDLS was treated with abemaciclib and demonstrated partial radiologic and near-complete pathological response (PMID: 37343202).Well-Differentiated LiposarcomaSoft Tissue SarcomaMIXEDSoft Tissue23569312;28303264;25028469;20534551;8101826;10970848Palbociclib,Abemaciclib32,2413,10
TUMORp.L3101RENSP00000369497.3:p.Leu3101Argchr1332394734TGPASSNM_000059missense_variantMODERATEBRCA225/27c.9302T>Grs28897758SNVdeleterious(0)possibly_damaging(0.888)4.857e-056.568e-066.206e-05gnomADe_NFE0.000.000.000.000.6718.0300e-01NICE_approved_PARP_inhibitor_treatment&Inherited_breast_cancer_and_ovarian_cancer&BRCA2-related_cancer_predisposition&Hereditary_cancer-predisposing_syndrome&Breast_and/or_ovarian_cancer&not_provided&Hereditary_breast_ovarian_cancer_syndrome&Breast-ovarian_cancer&_familial&_susceptibility_to&_2&Familial_cancer_of_breastNC_000013.11:g.32394734T>Gcriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenic1v7.0.LEVEL_Fda2False06/11/2024LEVEL_1TrueTrueTrueLikely Loss-of-functionLikely OncogenicNiraparib,Niraparib+Abiraterone Acetate+Prednisone,Olaparib,Olaparib+Abiraterone+Prednisone,Rucaparib,Talazoparib+Enzalutamide,Olaparib+BevacizumabOlaparib,Rucaparib,NiraparibOlaparib,TalazoparibLEVEL_1LEVEL_165,250/10.2777777777777778GRCh38BRCA2TTG32394734BRCA2_L3101R.GT:AD:AF:DP0/1:65,25:0.28:90GENSG00000139618TranscriptENST00000380152protein_coding950193023101L/RcTg/cGg1HGNCHGNC:1101YESMANE_SelectNM_000059.45A2CCDS9344.1ENSP00000369497P51587.244UPI00001FCBCCEnsembl1Gene3D:2.40.50.140&Pfam:PF09104&PIRSF:PIRSF002397&PANTHER:PTHR11289&Superfamily:SSF50249&CDD:cd044952.987e-05000006.206e-051.656e-05000000001.47e-0500pathogenic/likely_pathogenic&likely_pathogenic&pathogenic125741868&10923033&19043619&36061650FAIL-45-18-241BRCA23823046786.&.&MONDO:MONDO:0700269&MedGen:CN377758&MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MedGen:CN221562&MedGen:C3661900&MONDO:MONDO:0003582&MeSH:D061325&MedGen:C0677776&Orphanet:145&MONDO:MONDO:0012933&MedGen:C2675520&OMIM:612555&Orphanet:145&MONDO:MONDO:0016419&MedGen:C0346153&OMIM:114480&Orphanet:227535SCV000073800&SCV000213068&SCV000567965&SCV000800821&SCV000903964&SCV001362773&SCV001474032&SCV002041912&SCV004212907&SCV004220650&SCV004846155&SCV005068350&SCV005196391&SCV006277502single_nucleotide_variantSO:0001483ClinGen:CA026098BRCA2:675SO:0001583&missense_variant28897758TrueThe BRCA2 L3101R mutation is located in the DNA-binding domain of the protein (PMID: 35736817). In vitro studies have demonstrated that this mutation is inactivating as measured by loss of homology-directed DNA repair (HDR) in an in vitro HDR assay (PMID: 35736817). Germline BRCA2 L3101R mutations are considered likely pathogenic by the ACMG framework classification (PMID: 35736817).BRCA2, a tumor suppressor involved in the DNA damage response, is mutated in various cancer types.35736817L3101R675BRCA2GRCh38.MUTATION.The BRCA2 L3101R mutation is likely oncogenic.FalseLEVEL_Fda2The BRCA2 L3101R mutation is located in the DNA-binding domain of the protein (PMID: 35736817). In vitro studies have demonstrated that this mutation is inactivating as measured by loss of homology-directed DNA repair (HDR) in an in vitro HDR assay (PMID: 35736817). Germline BRCA2 L3101R mutations are considered likely pathogenic by the ACMG framework classification (PMID: 35736817).['35736817']NiraparibLEVEL_1LEVEL_Fda2['30948273', '27717299', '31562799']Niraparib, a small molecule PARP inhibitor, is FDA-approved as maintenance therapy for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status such as by harboring a deleterious or suspected deleterious BRCA mutation. FDA approval was based on the Phase III NOVA trial of niraparib versus placebo in patients with platinum-sensitive, recurrent ovarian cancer with or without BRCA1/2 mutations in which patients in the germline BRCA mutant cohort (n=203) experienced significantly longer progression-free survival with niraparib than those in the placebo group (21.0 vs. 5.5 months, HR=0.27, 95% CI = 0.17-0.41) (PMID: 27717299). FDA approval of niraparib in the non-germline BRCA mutant patient cohort (n=350) was based on the results of improved progression-free survival with niraparib versus placebo as maintenance therapy (9.3 months vs. 3.9 months, HR=0.45, 95% CI= 0.34-0.61) in the overall non-germline BRCA cohort. However, the overall non-germline BRCA cohort included patients with somatic BRCA mutation (PMID: 27717299). Further studies have shown the efficacy of niraparib in patients with homologous-recombination-deficient, platinum-sensitive ovarian cancer, including patients with BRCA mutation (PMID: 30948273, 31562799). The NCCN v5.2022 lists niraparib as a maintenance therapy for patients with BRCA1/2-mutant ovarian cancer.Peritoneal Serous CarcinomaPeritoneal Cancer, NOSSOLIDPeritoneumNiraparibLEVEL_1LEVEL_Fda2['30948273', '27717299', '31562799']Niraparib, a small molecule PARP inhibitor, is FDA-approved as maintenance therapy for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status such as by harboring a deleterious or suspected deleterious BRCA mutation. FDA approval was based on the Phase III NOVA trial of niraparib versus placebo in patients with platinum-sensitive, recurrent ovarian cancer with or without BRCA1/2 mutations in which patients in the germline BRCA mutant cohort (n=203) experienced significantly longer progression-free survival with niraparib than those in the placebo group (21.0 vs. 5.5 months, HR=0.27, 95% CI = 0.17-0.41) (PMID: 27717299). FDA approval of niraparib in the non-germline BRCA mutant patient cohort (n=350) was based on the results of improved progression-free survival with niraparib versus placebo as maintenance therapy (9.3 months vs. 3.9 months, HR=0.45, 95% CI= 0.34-0.61) in the overall non-germline BRCA cohort. However, the overall non-germline BRCA cohort included patients with somatic BRCA mutation (PMID: 27717299). Further studies have shown the efficacy of niraparib in patients with homologous-recombination-deficient, platinum-sensitive ovarian cancer, including patients with BRCA mutation (PMID: 30948273, 31562799). The NCCN v5.2022 lists niraparib as a maintenance therapy for patients with BRCA1/2-mutant ovarian cancer.Ovary/Fallopian TubeOvarian/Fallopian Tube CancerSOLIDOvary/Fallopian TubeNiraparibLEVEL_1LEVEL_Fda2['30948273', '27717299', '31562799']Niraparib, a small molecule PARP inhibitor, is FDA-approved as maintenance therapy for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status such as by harboring a deleterious or suspected deleterious BRCA mutation. FDA approval was based on the Phase III NOVA trial of niraparib versus placebo in patients with platinum-sensitive, recurrent ovarian cancer with or without BRCA1/2 mutations in which patients in the germline BRCA mutant cohort (n=203) experienced significantly longer progression-free survival with niraparib than those in the placebo group (21.0 vs. 5.5 months, HR=0.27, 95% CI = 0.17-0.41) (PMID: 27717299). FDA approval of niraparib in the non-germline BRCA mutant patient cohort (n=350) was based on the results of improved progression-free survival with niraparib versus placebo as maintenance therapy (9.3 months vs. 3.9 months, HR=0.45, 95% CI= 0.34-0.61) in the overall non-germline BRCA cohort. However, the overall non-germline BRCA cohort included patients with somatic BRCA mutation (PMID: 27717299). Further studies have shown the efficacy of niraparib in patients with homologous-recombination-deficient, platinum-sensitive ovarian cancer, including patients with BRCA mutation (PMID: 30948273, 31562799). The NCCN v5.2022 lists niraparib as a maintenance therapy for patients with BRCA1/2-mutant ovarian cancer.Ovarian CancerSOLIDOvary/Fallopian TubeNiraparib + Abiraterone Acetate + PrednisoneLEVEL_1LEVEL_Fda2['41057655', '36952634']Niraparib, a small molecule PARP inhibitor, and abiraterone acetate, a CYP17 inhibitor, are FDA-approved in combination with prednisone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated metastatic castration-resistant prostate cancer (mCRPC), based on an FDA-approved test. BRCA2 mutations for treatment with niraparib and abiraterone acetate plus prednisone were detected with the FoundationOne CDx and FoundationOne Liquid CDx. FDA approval was based on the results of the Phase III MAGNITUDE (NCT03748641) trial of niraparib versus placebo, both with combination abiraterone acetate and prednisone, in 423 patients with homologous recombination repair gene-mutated mCRPC. _In the Phase III MAGNITUDE (NCT03748641) trial for patients with BRCA1/2 mutations, the niraparib and abiraterone acetate plus prednisone cohort (n=113) demonstrated a median radiographic progression-free survival (rPFS) of 16.6 months (95% CI=13-NE) versus 10.9 months (95% CI = 8.3, 13.8) in the placebo and abiraterone acetate plus prednisone cohort (n=112) (HR=0.53 [95% CI=0.36-0.79], p<0.0014) (PMID: 36952634). In an exploratory overall survival (OS) analysis of the BRCA1/2 mutant subgroups, the niraparib cohort demonstrated a median OS of 30.4 months (95% CI=27.6-NE) versus 28.6 months (95% CI=23.8-33.0) (HR=0.79 (95% CI=0.55-1.12) (PMID: 36952634)._Niraparib with abiraterone acetate and prednisone is also FDA-approved for the treatment of adult patients with deleterious or suspected deleterious BRCA2-mutated metastatic castration-sensitive prostate cancer (mCSPC), based on an FDA-approved test. BRCA2 mutations for treatment with niraparib and abiraterone acetate plus prednisone in mCSPC were detected with the FoundationOne CDx and FoundationOne Liquid CDx. FDA approval for mCSPC was based on the Phase III AMPLITUDE (NCT04497844) trial of niraparib versus placebo, both with combination abiraterone acetate and prednisone, in 696 patients with homologous recombination repair (HRR) gene-mutated (HRRm) mCSPC._In the Phase III AMPLITUDE (NCT04497844) trial for patients with BRCA2 mutations (n=323), the niraparib and abiraterone acetate plus prednisone cohort demonstrated a median rPFS that was not estimable (95% CI=41-NE) versus 26 months (95% CI = 18-28) in the placebo and abiraterone acetate plus prednisone cohort (HR=0.46 (95% CI: 0.32-0.66)) (PMID: 41057655).Prostate CancerSOLIDProstateOlaparibLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434']Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).Peritoneal Serous CarcinomaPeritoneal Cancer, NOSSOLIDPeritoneumOlaparibLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434']Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).Ovary/Fallopian TubeOvarian/Fallopian Tube CancerSOLIDOvary/Fallopian TubeOlaparibLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434']Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).Ovarian CancerSOLIDOvary/Fallopian TubeOlaparibLEVEL_1LEVEL_Fda2['32343890']Olaparib is an orally available, small molecule PARP inhibitor that is FDA-approved for the treatment of adult patients with deleterious or suspected deleterious germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC) who have progressed following prior treatment with enzalutamide or abiraterone, based on an FDA-approved companion diagnostic. BRCA2 mutations for treatment with olaparib were detected by the FoundationOne CDx, BRACAnalysis CDx or the FoundationOne Liquid CDx. FDA approval was based on the results of the Phase III PROfound (NCT02987543) trial of olaparib in adult patients with mCRPC who had disease progression while receiving a new hormonal agent and who had a deleterious or suspected deleterious mutation in a homologous recombination repair gene. _In the Phase III PROfound (NCT02987543) trial, the BRCA2 (n=128) and BRCA1 (n=13) mutation cohorts treated with olaparib demonstrated a progression-free survival (PFS) of 9.8 months versus 3.0 months in the placebo cohorts (HR= 0.22 [95% CI=0.15-0.32]) (PMID: 32343890). The median overall survival was 19.1 months and 15.1 months (HR=0.61 [95% CI=0.37-1.01]) in the olaparib cohort versus placebo cohort, respectively (PMID: 32343890).Prostate CancerSOLIDProstateOlaparib + Abiraterone + PrednisoneLEVEL_1LEVEL_Fda2['37714168']Olaparib is an orally available, small-molecule PARP inhibitor that is FDA-approved in combination with abiraterone and prednisone/prednisolone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated (BRCAm) metastatic castration-resistant prostate cancer (mCRPC), as determined by an FDA-approved companion diagnostic test. BRCA mutations for treatment with olaparib were detected with the FoundationOne CDx or the FoundationOne Liquid CDx. FDA approval was based on the results of the Phase III PROpel (NCT03732820) trial of olaparib plus abiraterone and prednisone/prednisolone in 796 adult patients with mCRPC undergoing first-line treatment after failure of primary androgen deprivation therapy. _In the Phase III PROpel (NCT03732820) trial, patients with BRCAm mCRPC in the olaparib plus abiraterone and prednisone/prednisolone cohort (n=47) did not reach a median radiological progression-free survival (rPFS) (95% CI=NR-NR) and demonstrated a median overall survival (OS) of 42.1 months (95% CI=38.4-NR) (PMID: 37714168). Patients with BRCAm mCRPC in the placebo plus abiraterone and prednisone/prednisolone cohort (n=38) demonstrated a median rPFS of 8 months (95% CI=6-15) (HR=0.24 [95% CI=0.12-0.45]) and a median OS of 34.7 months (95% CI=31.0-39.3)(HR=0.81 [95% CI=0.67-1.00], p=0.054) (PMID: 37714168).Prostate CancerSOLIDProstateRucaparibLEVEL_1LEVEL_Fda2['35658487', '40580808']Rucaparib is an orally available, small-molecule PARP inhibitor that is FDA-approved for the maintenance treatment of adult patients with a deleterious BRCA mutation (germline and/or somatic)- associated recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in a complete or partial response to platinum-based chemotherapy. BRCA1 mutations for maintenance treatment with rucaparib were detected by the BRACAnalysis CDx or the FoundationFocus CDxBRCA Assay. FDA approval was based on the results of the Phase III ARIEL3 (NCT01968213) trial of rucaparib versus placebo in 564 patients with epithelial ovarian, fallopian tube, or primary peritoneal cancer. Additionally, rucaparib is NCCN-recommended as a first-line maintenance treatment in newly diagnosed patients with advanced ovarian cancer based on the results of the Phase III ATHENA-MONO (NCT03522246) trial of rucaparib versus placebo in patients with newly diagnosed BRCA-mutated ovarian cancer.__In the Phase III ARIEL3 (NCT01968213) trial, the rucaparib cohort (n=375 [BRCA1 mutated, n=80, BRCA2 mutated, n=50, Germline BRCA1 and BRCA2 mutated, n=82, Somatic BRCA1 and BRCA2 mutated, n=40]) (epithelial ovarian cancer, n=312, fallopian tube cancer, n=32, primary peritoneal cancer, n=31) demonstrated a median OS of 45.9 months (95% CI-37.7-59.6) and a median time to disease progression on subsequent therapy or death (PFS2) of 26.1 months (95% CI=22.8-32.8) in the BRCA-mutated subgroup (PMID: 40580808). In the placebo cohort (n=189 [BRCA1 mutated, n=37, BRCA2 mutated, n=29, Germline BRCA1 and BRCA2 mutated, n=48, Somatic BRCA1 and BRCA2 mutated, n=16]) (epithelial ovarian cancer, n=159, fallopian tube cancer, n=10, primary peritoneal cancer, n=19, high-grade serous adenocarcinoma, n=1), the median OS was 47.8 months. (95% CI=43.2-55.8) (HR=0.83 [95% CI=0.58-1.19]) and the median PFS2 was 18.2 months (95% CI=15.7-24.4) (HR=0.67 [95% CI=0.48-0.94]) in the BRCA-mutated subgroup (PMID: 40580808).__In the Phase III ATHENA-MONO (NCT03522246) trial, the homologous recombination deficiency (HRD) population was treated with either rucaparib (n=185 [BRCA mutated, n=91, BRCA wildtype/loss of heterozygosity [LOH] high, n=94] or placebo (n=49 [BRCA mutated, n=24, BRCA wildtype/LOH high, n=25] (PMID: 35658487). Of the rucaparib cohort, the median progression-free survival (PFS) was 28.7 months (95% CI=23.0-NR) and the objective response rate (ORR) was 58.8% (95% CI=32.9-81.6), with a 58.8% (n=10) partial response (PR) rate, 35.3% (n=6) stable disease (SD) rate and 5.9% (n=1) progressive disease (PD) rate (PMID: 35658487). Of the placebo cohort, the median PFS was 11.3 months (95% CI=9.1-22.1) (HR=0.47 [95% CI=0.31-22.1], p=0.0004) and the ORR was 20.0% (95% CI=0.5-71.6), with a 20% (n=1) PR rate, 40% (n=2) SD rate and 40% (n=2) PD rate (PMID: 35658487).Peritoneal Serous CarcinomaPeritoneal Cancer, NOSSOLIDPeritoneumRucaparibLEVEL_1LEVEL_Fda2['35658487', '40580808']Rucaparib is an orally available, small-molecule PARP inhibitor that is FDA-approved for the maintenance treatment of adult patients with a deleterious BRCA mutation (germline and/or somatic)- associated recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in a complete or partial response to platinum-based chemotherapy. BRCA1 mutations for maintenance treatment with rucaparib were detected by the BRACAnalysis CDx or the FoundationFocus CDxBRCA Assay. FDA approval was based on the results of the Phase III ARIEL3 (NCT01968213) trial of rucaparib versus placebo in 564 patients with epithelial ovarian, fallopian tube, or primary peritoneal cancer. Additionally, rucaparib is NCCN-recommended as a first-line maintenance treatment in newly diagnosed patients with advanced ovarian cancer based on the results of the Phase III ATHENA-MONO (NCT03522246) trial of rucaparib versus placebo in patients with newly diagnosed BRCA-mutated ovarian cancer.__In the Phase III ARIEL3 (NCT01968213) trial, the rucaparib cohort (n=375 [BRCA1 mutated, n=80, BRCA2 mutated, n=50, Germline BRCA1 and BRCA2 mutated, n=82, Somatic BRCA1 and BRCA2 mutated, n=40]) (epithelial ovarian cancer, n=312, fallopian tube cancer, n=32, primary peritoneal cancer, n=31) demonstrated a median OS of 45.9 months (95% CI-37.7-59.6) and a median time to disease progression on subsequent therapy or death (PFS2) of 26.1 months (95% CI=22.8-32.8) in the BRCA-mutated subgroup (PMID: 40580808). In the placebo cohort (n=189 [BRCA1 mutated, n=37, BRCA2 mutated, n=29, Germline BRCA1 and BRCA2 mutated, n=48, Somatic BRCA1 and BRCA2 mutated, n=16]) (epithelial ovarian cancer, n=159, fallopian tube cancer, n=10, primary peritoneal cancer, n=19, high-grade serous adenocarcinoma, n=1), the median OS was 47.8 months. (95% CI=43.2-55.8) (HR=0.83 [95% CI=0.58-1.19]) and the median PFS2 was 18.2 months (95% CI=15.7-24.4) (HR=0.67 [95% CI=0.48-0.94]) in the BRCA-mutated subgroup (PMID: 40580808).__In the Phase III ATHENA-MONO (NCT03522246) trial, the homologous recombination deficiency (HRD) population was treated with either rucaparib (n=185 [BRCA mutated, n=91, BRCA wildtype/loss of heterozygosity [LOH] high, n=94] or placebo (n=49 [BRCA mutated, n=24, BRCA wildtype/LOH high, n=25] (PMID: 35658487). Of the rucaparib cohort, the median progression-free survival (PFS) was 28.7 months (95% CI=23.0-NR) and the objective response rate (ORR) was 58.8% (95% CI=32.9-81.6), with a 58.8% (n=10) partial response (PR) rate, 35.3% (n=6) stable disease (SD) rate and 5.9% (n=1) progressive disease (PD) rate (PMID: 35658487). Of the placebo cohort, the median PFS was 11.3 months (95% CI=9.1-22.1) (HR=0.47 [95% CI=0.31-22.1], p=0.0004) and the ORR was 20.0% (95% CI=0.5-71.6), with a 20% (n=1) PR rate, 40% (n=2) SD rate and 40% (n=2) PD rate (PMID: 35658487).Ovary/Fallopian TubeOvarian/Fallopian Tube CancerSOLIDOvary/Fallopian TubeRucaparibLEVEL_1LEVEL_Fda2['35658487', '40580808']Rucaparib is an orally available, small-molecule PARP inhibitor that is FDA-approved for the maintenance treatment of adult patients with a deleterious BRCA mutation (germline and/or somatic)- associated recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in a complete or partial response to platinum-based chemotherapy. BRCA1 mutations for maintenance treatment with rucaparib were detected by the BRACAnalysis CDx or the FoundationFocus CDxBRCA Assay. FDA approval was based on the results of the Phase III ARIEL3 (NCT01968213) trial of rucaparib versus placebo in 564 patients with epithelial ovarian, fallopian tube, or primary peritoneal cancer. Additionally, rucaparib is NCCN-recommended as a first-line maintenance treatment in newly diagnosed patients with advanced ovarian cancer based on the results of the Phase III ATHENA-MONO (NCT03522246) trial of rucaparib versus placebo in patients with newly diagnosed BRCA-mutated ovarian cancer.__In the Phase III ARIEL3 (NCT01968213) trial, the rucaparib cohort (n=375 [BRCA1 mutated, n=80, BRCA2 mutated, n=50, Germline BRCA1 and BRCA2 mutated, n=82, Somatic BRCA1 and BRCA2 mutated, n=40]) (epithelial ovarian cancer, n=312, fallopian tube cancer, n=32, primary peritoneal cancer, n=31) demonstrated a median OS of 45.9 months (95% CI-37.7-59.6) and a median time to disease progression on subsequent therapy or death (PFS2) of 26.1 months (95% CI=22.8-32.8) in the BRCA-mutated subgroup (PMID: 40580808). In the placebo cohort (n=189 [BRCA1 mutated, n=37, BRCA2 mutated, n=29, Germline BRCA1 and BRCA2 mutated, n=48, Somatic BRCA1 and BRCA2 mutated, n=16]) (epithelial ovarian cancer, n=159, fallopian tube cancer, n=10, primary peritoneal cancer, n=19, high-grade serous adenocarcinoma, n=1), the median OS was 47.8 months. (95% CI=43.2-55.8) (HR=0.83 [95% CI=0.58-1.19]) and the median PFS2 was 18.2 months (95% CI=15.7-24.4) (HR=0.67 [95% CI=0.48-0.94]) in the BRCA-mutated subgroup (PMID: 40580808).__In the Phase III ATHENA-MONO (NCT03522246) trial, the homologous recombination deficiency (HRD) population was treated with either rucaparib (n=185 [BRCA mutated, n=91, BRCA wildtype/loss of heterozygosity [LOH] high, n=94] or placebo (n=49 [BRCA mutated, n=24, BRCA wildtype/LOH high, n=25] (PMID: 35658487). Of the rucaparib cohort, the median progression-free survival (PFS) was 28.7 months (95% CI=23.0-NR) and the objective response rate (ORR) was 58.8% (95% CI=32.9-81.6), with a 58.8% (n=10) partial response (PR) rate, 35.3% (n=6) stable disease (SD) rate and 5.9% (n=1) progressive disease (PD) rate (PMID: 35658487). Of the placebo cohort, the median PFS was 11.3 months (95% CI=9.1-22.1) (HR=0.47 [95% CI=0.31-22.1], p=0.0004) and the ORR was 20.0% (95% CI=0.5-71.6), with a 20% (n=1) PR rate, 40% (n=2) SD rate and 40% (n=2) PD rate (PMID: 35658487).Ovarian CancerSOLIDOvary/Fallopian TubeRucaparibLEVEL_1LEVEL_Fda2['32795228', '36795891']Rucaparib is an orally available, small molecule PARP inhibitor that is FDA-approved for the treatment of adult patients with a deleterious BRCA mutation (germline and/or somatic)-associated metastatic castration-resistant prostate cancer (mCRPC), as detected by an FDA-approved companion diagnostic, who have been treated with androgen receptor-directed therapy and a taxane-based chemotherapy or androgen receptor-directed therapy alone. BRCA2 mutations for treatment with rucaparib were detected by the FoundationOne Liquid CDx. FDA approval was based on the results of the Phase II TRITON2 (NCT02952534) trial of rucaparib in 62 eligible patients with pre-treated BRCA-mutated mCRPC and the results of the Phase III TRITON3 (NCT02975934) trial of rucaparib in 405 eligible patients with mCRPC pre-treated with androgen receptor-directed therapy who could not have received prior chemotherapy in the castration-resistant setting._In the Phase II TRITON2 (NCT02952534) trial, the objective response rate was 44% (95% CI=31-57), with fifteen of 27 (56%) patients with a confirmed objective response demonstrating a duration of response of 6 months (PMID: 32795228)._In the Phase III TRITON3 trial of rucaparib versus physician's choice in patients with pre-treated BRCA-mutated mCRPC, patients treated with rucaparib (n=201) demonstrated a median progression-free survival of 11.2 months (95% CI=9.2, 13.8) compared to 6.4 months (95% CI=5.4, 8.3) for patients treated with physician's choice (n=101) (HR=0.05, 95% CI=0.36, 0.69) (PMID: 36795891). In addition, patients treated with rucaparib (n=201) demonstrated a median overall survival of 23.2 months (95% CI=19.1, 25.2) compared to 21.2 months (95% CI= 18.0, 23.1) for patients treated with physician's choice (n=101) (HR=0.91, 95% CI=0.68, 1.20) (PMID: 36795891).Prostate CancerSOLIDProstateTalazoparib + EnzalutamideLEVEL_1LEVEL_Fda2['37285865']Talazoparib is an orally available, small molecule PARP inhibitor that is FDA-approved in combination with enzalutamide for the treatment of adult patients with homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC). FDA approval was based on the results of the Phase III TALAPRO-2 (NCT03395197) trial of talazoparib plus enzalutamide in 399 adult patients with asymptomatic or mildly symptomatic mCRPC harboring HRR gene alterations receiving ongoing androgen deprivation therapy. _In the Phase III TALAPRO-2 (NCT03395197) trial, the talazoparib plus enzalutamide cohort (n=200) demonstrated a radiographic progression-free survival (rPFS) that was not evaluable (95% CI=21.9-NE) versus 13.8 months (95% CI=11.0-16.7) in the placebo plus enzalutamide cohort (n=199) (HR=0.45 [95% CI=0.33-0.61], p<0.0001) (PMID: 37285865). Of patients with BRCA1/2 mutations (n=155), the talazoparib plus enzalutamide cohort (n=71) demonstrated a rPFS that was not evaluable (95% CI=NE-NE) versus 11.0 months (95% CI=16.4-NE) in the placebo plus enzalutamide group (n=84) (HR=0.20 [95% CI=0.11-0.36]) (PMID: 37285865). Of patients harboring only BRCA2 mutations (n=115), the talazoparib plus enzalutamide cohort (n=71) demonstrated a rPFS that was not evaluable (95% CI=NE-NE) versus 11.0 months in the placebo plus enzalutamide cohort (n=60) (HR=0.19 [95% CI=0.10, 0.38], p<0.0001) (PMID: 37285865).Prostate CancerSOLIDProstateOlaparib + BevacizumabLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434']Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).Peritoneal Serous CarcinomaPeritoneal Cancer, NOSSOLIDPeritoneumOlaparib + BevacizumabLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434']Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).Ovary/Fallopian TubeOvarian/Fallopian Tube CancerSOLIDOvary/Fallopian TubeOlaparib + BevacizumabLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434']Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).Ovarian CancerSOLIDOvary/Fallopian TubeOlaparibLEVEL_2LEVEL_Fda3['33970096', '32299819']Olaparib, niraparib, and rucaparib are small-molecule PARP inhibitors that are FDA-approved for use in patients with breast and ovarian cancer, among others. The Uterine Cancer NCCN v1.2023 lists olaparib, niraparib, and rucaparib as recommended therapies for patients with BRCA2 mutations. In a clinical cohort, six patients with BRCA2-mutated or BRCA2-deleted uterine cancers had partial responses to treatment with PARP inhibitors (PMID: 32299819). In an additional case report, a single patient with uterine leiomyosarcoma harboring BRCA2/TP53/PTEN deletion had a rapid partial response to treatment with olaparib (PMID: 33970096).Uterine SarcomaSOLIDUterusRucaparibLEVEL_2LEVEL_Fda3['33970687', '17444865', '30051098', '34351646']Rucaparib, a small molecule PARP inhibitor, is FDA-approved for the treatment of patients with deleterious BRCA1/2 mutated advanced ovarian cancer who have been treated with two or more lines of chemotherapy. In the Phase II RUCAPANC study of rucaparib in nineteen patients with advanced pancreatic adenocarcinoma harboring deleterious germline or somatic BRCA1/2 mutations, two of three patients with somatic BRCA2 mutations had objective responses to treatment with rucaparib (complete response, n=1, partial response, n=1) and three BRCA2-mutant patients of sixteen patients with germine BRCA1/2 mutations had an objective response (PMID: 30051098). In a separate Phase II trial of rucaparib as maintenance therapy in patients with platinum-sensitive pancreatic cancer harboring BRCA1/2 or PALB2 mutations, seven of nineteen patients evaluable at interim analysis had a response to rucaparib (complete response, n=1, partial response, n=6, overall response rate = 36.8%), with responses seen in four patients with germline BRCA2 mutations, two patients with germline PALB2 mutations and one patient with somatic BRCA2 mutation (Abstract: Reiss Binder et al. Abstract# CT234, AACR 2019. https://cancerres.aacrjournals.org/content/79/13_Supplement/CT234). In vitro studies in pancreatic cancer cell lines demonstrated that PARP inhibition in combination with chemotherapy was more effective at inhibiting pancreatic cell growth in vitro or in xenograft models compared to chemotherapy alone (PMID: 17444865). (PMID: 33970687, 34351646) In a Phase II study to assess maintenance rucaparib treatment and reversion mutations in 42 patients with advanced pancreatic cancer harboring germline or somatic variants in BRCA1/2 or PALB2, the progression-free survival for patients with progression with no KRAS reversion mutations (n=23) compared to progression with acquired KRAS reversion mutations (n=5) was 279 days (95% CI, 225 to 428) versus 112 days (95% CI, 46 to 156) and the median overall survival rate was 701 days (95% CI, 586 to 829) versus 283 days (95% CI, 128 to 436), respectively (Abstract: Brown et al. Abstract# 734, ASCO 2023. https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.4_suppl.734).Pancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasRucaparibLEVEL_2LEVEL_Fda3['33970687', '17444865', '30051098', '34351646']Rucaparib, a small molecule PARP inhibitor, is FDA-approved for the treatment of patients with deleterious BRCA1/2 mutated advanced ovarian cancer who have been treated with two or more lines of chemotherapy. In the Phase II RUCAPANC study of rucaparib in nineteen patients with advanced pancreatic adenocarcinoma harboring deleterious germline or somatic BRCA1/2 mutations, two of three patients with somatic BRCA2 mutations had objective responses to treatment with rucaparib (complete response, n=1, partial response, n=1) and three BRCA2-mutant patients of sixteen patients with germine BRCA1/2 mutations had an objective response (PMID: 30051098). In a separate Phase II trial of rucaparib as maintenance therapy in patients with platinum-sensitive pancreatic cancer harboring BRCA1/2 or PALB2 mutations, seven of nineteen patients evaluable at interim analysis had a response to rucaparib (complete response, n=1, partial response, n=6, overall response rate = 36.8%), with responses seen in four patients with germline BRCA2 mutations, two patients with germline PALB2 mutations and one patient with somatic BRCA2 mutation (Abstract: Reiss Binder et al. Abstract# CT234, AACR 2019. https://cancerres.aacrjournals.org/content/79/13_Supplement/CT234). In vitro studies in pancreatic cancer cell lines demonstrated that PARP inhibition in combination with chemotherapy was more effective at inhibiting pancreatic cell growth in vitro or in xenograft models compared to chemotherapy alone (PMID: 17444865). (PMID: 33970687, 34351646) In a Phase II study to assess maintenance rucaparib treatment and reversion mutations in 42 patients with advanced pancreatic cancer harboring germline or somatic variants in BRCA1/2 or PALB2, the progression-free survival for patients with progression with no KRAS reversion mutations (n=23) compared to progression with acquired KRAS reversion mutations (n=5) was 279 days (95% CI, 225 to 428) versus 112 days (95% CI, 46 to 156) and the median overall survival rate was 701 days (95% CI, 586 to 829) versus 283 days (95% CI, 128 to 436), respectively (Abstract: Brown et al. Abstract# 734, ASCO 2023. https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.4_suppl.734).Acinar Cell Carcinoma of the PancreasPancreatic CancerSOLIDPancreasRucaparibLEVEL_2LEVEL_Fda3['33970096', '32299819']Olaparib, niraparib, and rucaparib are small-molecule PARP inhibitors that are FDA-approved for use in patients with breast and ovarian cancer, among others. The Uterine Cancer NCCN v1.2023 lists olaparib, niraparib, and rucaparib as recommended therapies for patients with BRCA2 mutations. In a clinical cohort, six patients with BRCA2-mutated or BRCA2-deleted uterine cancers had partial responses to treatment with PARP inhibitors (PMID: 32299819). In an additional case report, a single patient with uterine leiomyosarcoma harboring BRCA2/TP53/PTEN deletion had a rapid partial response to treatment with olaparib (PMID: 33970096).Uterine SarcomaSOLIDUterusNiraparibLEVEL_2LEVEL_Fda3['33970096', '32299819']Olaparib, niraparib, and rucaparib are small-molecule PARP inhibitors that are FDA-approved for use in patients with breast and ovarian cancer, among others. The Uterine Cancer NCCN v1.2023 lists olaparib, niraparib, and rucaparib as recommended therapies for patients with BRCA2 mutations. In a clinical cohort, six patients with BRCA2-mutated or BRCA2-deleted uterine cancers had partial responses to treatment with PARP inhibitors (PMID: 32299819). In an additional case report, a single patient with uterine leiomyosarcoma harboring BRCA2/TP53/PTEN deletion had a rapid partial response to treatment with olaparib (PMID: 33970096).Uterine SarcomaSOLIDUterusOlaparibLEVEL_3ALEVEL_Fda3['37992259', '33119476']Olaparib is an orally available, small molecule PARP inhibitor that is FDA-approved for the treatment of patients with deleterious or suspected deleterious germline BRCA-mutated, HER2-negative metastatic breast cancer who have been treated with chemotherapy either in the neoadjuvant, adjuvant, or metastatic setting. There are promising clinical data of response to olaparib in patients with breast cancer harboring somatic BRCA1/2 mutations. _Olaparib is recommended in the NCCN Breast Cancer Guidelines (V3.2025) under "Emerging Biomarkers And Novel Therapies For Patients With Stage IV (M1) Disease" as a category 2B treatment recommendation for patients with somatic BRCA1/2 mutations. NCCN recommendation is based on the results of the Phase II TBCRC 048 (NCT03344965) study of olaparib in 54 patients with somatic BRCA1/2 mutations or germline/somatic mutations in homologous recombination (HR)-related genes other than BRCA1/2. In the Phase II TBCRC 048 (NCT03344965) study, patients with somatic BRCA1/2 mutations demonstrated an overall response rate (ORR) of 50% (90% CI=28-72) and a median progression-free survival (PFS) of 6.3 months (90% CI=4.4-NA) (PMID: 33119476)._In a retrospective study of 24 patients with BRCA1/2 somatic-mutated HER2-negative metastatic breast cancer treated with PARP inhibitors, the median real-world PFS was 4.6 months (95% CI=3.0 to 8.1) and the median real-world overall survival (OS) was 21.2 months (95% CI=13.8 to NR) while patients harboring BRCA1/2 germline mutations (n=71) demonstrated a median real-world PFS of 6.0 months (95% CI=4.6 to 8.2) and a median real-world OS of 21.2 months (95% CI=14.2 to NR) (PMID: 37992259).Breast CancerSOLIDBreastOlaparibLEVEL_3ALEVEL_Fda3['31157963', '32444418']Olaparib, a small molecule PARP inhibitor, is NCCN-listed and FDA-approved for the maintenance treatment of adult patients with deleterious or suspected deleterious germline BRCA-mutated (gBRCAm) metastatic pancreatic adenocarcinoma (PAAD) whose disease has not progressed on at least sixteen weeks of a first-line platinum-based chemotherapy regimen. In a randomized, double-blind, placebo-controlled, phase III trial (POLO, NCT02184195) of olaparib in 154 patients with gBRCAm metastatic PAAD that did not progress during first-line platinum-based chemotherapy, the median progression-free survival (PFS) was significantly longer in the olaparib group (n = 92 patients) than in the placebo group (n = 62 patients) (7.4 months vs. 3.8 months, HR for disease progression or death=0.53, 95% CI=0.35-0.82, p = 0.004), and an interim analysis of overall survival (OS) showed no difference between the olaparib and placebo groups (median, 18.9 months vs. 18.1 months, HR for death=0.91, 95% CI=0.56-1.46, p = 0.68) (PMID: 31157963). In a study looking at PFS and OS of 262 advanced-stage PAAD patients that underwent both germline and somatic targeted-gene sequencing to identify homologous recombination (HR)-gene mutations, including BRCA1/2, HR-deficient (HRD) patients treated with first-line platinum (n=35 patients) had a superior median OS compared to patients with no HRD treated with or without first line platinum (25.1 [21.6-NR] vs. 15.3 [14.220.3] or 13 [10.116.9] months, respectively) (PMID: 32444418). In the Phase II TAPUR (NCT02693535) trial of olaparib in 30 patients with BRCA1/2-mutated advanced PAAD (n=9, BRCA1 only, n=18, BRCA2 only, n=3, BRCA1 and BRCA2), the disease control rate was 31% (90% CI=18-40, p=0.04), the objective response rate was 18% (95% CI=6-37), with two patients achieving complete response, three patients achieving partial response and three patients achieving stable disease of at least 16 weeks duration, the median PFS was eight weeks (95% CI=8-15) and the median OS was 38 weeks (95% CI=21-65) (Abstract: Ahn et al. JCO, Volume 8, 2024. https://ascopubs.org/doi/10.1200/PO.23.00240#abstract).Pancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasOlaparibLEVEL_3ALEVEL_Fda3['31157963', '32444418']Olaparib, a small molecule PARP inhibitor, is NCCN-listed and FDA-approved for the maintenance treatment of adult patients with deleterious or suspected deleterious germline BRCA-mutated (gBRCAm) metastatic pancreatic adenocarcinoma (PAAD) whose disease has not progressed on at least sixteen weeks of a first-line platinum-based chemotherapy regimen. In a randomized, double-blind, placebo-controlled, phase III trial (POLO, NCT02184195) of olaparib in 154 patients with gBRCAm metastatic PAAD that did not progress during first-line platinum-based chemotherapy, the median progression-free survival (PFS) was significantly longer in the olaparib group (n = 92 patients) than in the placebo group (n = 62 patients) (7.4 months vs. 3.8 months, HR for disease progression or death=0.53, 95% CI=0.35-0.82, p = 0.004), and an interim analysis of overall survival (OS) showed no difference between the olaparib and placebo groups (median, 18.9 months vs. 18.1 months, HR for death=0.91, 95% CI=0.56-1.46, p = 0.68) (PMID: 31157963). In a study looking at PFS and OS of 262 advanced-stage PAAD patients that underwent both germline and somatic targeted-gene sequencing to identify homologous recombination (HR)-gene mutations, including BRCA1/2, HR-deficient (HRD) patients treated with first-line platinum (n=35 patients) had a superior median OS compared to patients with no HRD treated with or without first line platinum (25.1 [21.6-NR] vs. 15.3 [14.220.3] or 13 [10.116.9] months, respectively) (PMID: 32444418). In the Phase II TAPUR (NCT02693535) trial of olaparib in 30 patients with BRCA1/2-mutated advanced PAAD (n=9, BRCA1 only, n=18, BRCA2 only, n=3, BRCA1 and BRCA2), the disease control rate was 31% (90% CI=18-40, p=0.04), the objective response rate was 18% (95% CI=6-37), with two patients achieving complete response, three patients achieving partial response and three patients achieving stable disease of at least 16 weeks duration, the median PFS was eight weeks (95% CI=8-15) and the median OS was 38 weeks (95% CI=21-65) (Abstract: Ahn et al. JCO, Volume 8, 2024. https://ascopubs.org/doi/10.1200/PO.23.00240#abstract).Acinar Cell Carcinoma of the PancreasPancreatic CancerSOLIDPancreasTalazoparibLEVEL_3ALEVEL_Fda3['30110579', '36394867', '37992259', '30563931']Talazoparib, a small molecule PARP inhibitor, is FDA-approved for patients with deleterious or suspected deleterious germline BRCA-mutated, HER2-negative locally advanced or metastatic breast cancer. FDA approval was based on the results from the Phase III EMBRACA trial of talazoparib (1 mg once daily) versus standard single-agent chemotherapy (2:1) in 431 patients with advanced, BRCA1/2 germline-mutated breast cancer in which the median progression-free survival was 8.6 months in the talazoparib group versus 5.6 months in the chemotherapy group (HR= 0.54, 95%CI=0.41 to 0.71, p<0.001) and the objective response rate was 62.6% in the talazoparib group versus 27.2% in the chemotherapy group (p<0.001) (PMID: 30110579). In the Phase II study of talazoparib in patients with germline BRCA-mutant breast cancer who had a prior response to platinum agents, the overall response rate was 21-37% (depending on cohort) (PMID: 30563931). In a Phase I study of talazoparib plus carboplatin in patients with and without DNA repair mutations, three patients with somatic BRCA mutations had stable disease beyond four months (Abstract: Dhawan et al. Abstract# 2527, ASCO 2017. https://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2527). In the Phase IIb tumor-agnostic JAVELIN BRCA/ATM trial of combination talazoparib and avelumab in 159 patients with BRCA1/2-altered solid tumors, the objective response was observed in 42 patients (26.4%, 95% CI = 19.7%34.0%) and the median duration of response was 10.9 months (95% CI = 6.2 months to not estimable) (PMID: 36394867). In a retrospective study for 24 patients with BRCA1/2 somatic-mutated HER2-negative metastatic breast cancer treated with PARP inhibitors, the median real-world PFS was 4.6 months (95% CI=3.0 to 8.1) and the median real-world overall survival was 21.2 months (95% CI=13.8 to NR) while patients harboring BRCA1/2 germline mutations (n=71) demonstrated a median real-world PFS of 6.0 months (95% CI=4.6 to 8.2) and a median real-world overall survival of 21.2 months (95% CI=14.2 to NR) (PMID: 37992259).Breast CancerSOLIDBreast3573681730948273;27717299;31562799;41057655;36952634;25366685;30285518;30345884;24882434;Penson et al. Abstract# 5506, ASCO 2019.(https://meetinglibrary.asco.org/record/173435/abstract);32343890;37714168;35658487;40580808;32795228;36795891;37285865;33970096;32299819;33970687;17444865;30051098;34351646;Brown et al. Abstract# 734, ASCO 2023.(https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.4_suppl.734);Reiss Binder et al. Abstract# CT234, AACR 2019.(https://cancerres.aacrjournals.org/content/79/13_Supplement/CT234);37992259;33119476;31157963;32444418;Ahn et al. JCO, Volume 8, 2024.(https://ascopubs.org/doi/10.1200/PO.23.00240#abstract);30110579;36394867;30563931;Dhawan et al. Abstract# 2527, ASCO 2017.(https://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2527)90
TUMORp.E1705*NP_085124.2:p.Glu1705Terchr1495094139GAPASSNM_030621stop_gainedHIGHDICER126/29c.5113G>TCOSV58615252&COSV58618257SNV2.7500e-01v7.0..False04/15/2025.TrueTrueFalseLikely Loss-of-functionLikely Oncogenic60,300/10.3333333333333333GRCh38DICER1GGA95094139DICER1_E1705K.GT:AD:AF:DP0/1:60,30:0.33:90A23405TranscriptNM_030621.4protein_coding540551131705E/*Gaa/Taa-1EntrezGeneHGNC:17098NP_085124.2RefSeq1&11&1FalseThe mutation effect description for truncating mutations in DICER1 is: DICER1 germline truncating mutations result in various forms of C-terminally truncated DICER1 protein and the loss of DICER1 protein function. These mutations have been identified in pleuropulmonary blastoma (PMID: 21266384, 21501861). In vitro studies with DICER1-deficient mouse myeloid progenitor cells demonstrated that loss of DICER1 is inactivating as measured by blocked monocyte differentiation, depleted macrophages and induced myeloid dysplasia compared to wildtype (PMID: 22353998, 20305640).DICER1, an endoribonuclease, is altered in various cancer types.20305640|22353998|21266384|21501861E1705*23405DICER1GRCh38.MUTATION.The DICER1 E1705* is a truncating mutation in a tumor suppressor gene, and therefore is likely oncogenic.False.The mutation effect description for truncating mutations in DICER1 is: DICER1 germline truncating mutations result in various forms of C-terminally truncated DICER1 protein and the loss of DICER1 protein function. These mutations have been identified in pleuropulmonary blastoma (PMID: 21266384, 21501861). In vitro studies with DICER1-deficient mouse myeloid progenitor cells demonstrated that loss of DICER1 is inactivating as measured by blocked monocyte differentiation, depleted macrophages and induced myeloid dysplasia compared to wildtype (PMID: 22353998, 20305640).['20305640', '22353998', '21266384', '21501861']20305640;22353998;21266384;2150186190
TUMORp.R248WENSP00000269305.4:p.Arg248Trpchr177674221GAPASSNM_000546missense_variantMODERATETP537/11c.742C>Trs121912651&CM010465&CM900211&COSV52662035&COSV52797251&COSV53097881SNVdeleterious(0)6.157e-0602.236e-05gnomADe_AMR0.000.000.000.000.9274.4900e-01TP53-related_disorder&Gallbladder_cancer&Congenital_fibrosarcoma&Lip_and_oral_cavity_carcinoma&Gastric_cancer&Breast_and/or_ovarian_cancer&Familial_pancreatic_carcinoma&Malignant_lymphoma&_large_B-cell&_diffuse&Hereditary_cancer-predisposing_syndrome&not_provided&Ovarian_neoplasm&Adrenocortical_carcinoma&_hereditary&Choroid_plexus_carcinoma&Li-Fraumeni_syndrome_1&Li-Fraumeni_syndromeNC_000017.11:g.7674221G>Areviewed_by_expert_panelPathogenicOncogeniccriteria_provided&_single_submitter35criteria_provided&_single_submitterTier_I_-_StrongTP53R248Wchr17:7674221-7674221v7.0..✓ Hotspot06/11/2024.TrueTrueTrueLoss-of-functionLikely OncogenicLEVEL_Px148,400/1R248W0.45454545454545453GRCh38TP53GGA7674221TP53_R248W.GT:AD:AF:DP0/1:48,40:0.45:88AENSG00000141510TranscriptENST00000269305protein_coding884742248R/WCgg/Tgg-1HGNCHGNC:11998YESMANE_SelectNM_000546.61P1CCDS11118.1ENSP00000269305P04637.307K7PPA8.92UPI000002ED67P04637-1Ensembl1PDB-ENSP_mappings:1gzh.A&PDB-ENSP_mappings:1gzh.C&PDB-ENSP_mappings:1kzy.A&PDB-ENSP_mappings:1kzy.B&PDB-ENSP_mappings:1tsr.A&PDB-ENSP_mappings:1tsr.B&PDB-ENSP_mappings:1tsr.C&PDB-ENSP_mappings:1tup.A&PDB-ENSP_mappings:1tup.B&PDB-ENSP_mappings:1tup.C&PDB-ENSP_mappings:1uol.A&PDB-ENSP_mappings:1uol.B&PDB-ENSP_mappings:1ycs.A&PDB-ENSP_mappings:2ac0.A&PDB-ENSP_mappings:2ac0.B&PDB-ENSP_mappings:2ac0.C&PDB-ENSP_mappings:2ac0.D&PDB-ENSP_mappings:2ady.A&PDB-ENSP_mappings:2ady.B&PDB-ENSP_mappings:2ahi.A&PDB-ENSP_mappings:2ahi.B&PDB-ENSP_mappings:2ahi.C&PDB-ENSP_mappings:2ahi.D&PDB-ENSP_mappings:2ata.A&PDB-ENSP_mappings:2ata.B&PDB-ENSP_mappings:2ata.C&PDB-ENSP_mappings:2ata.D&PDB-ENSP_mappings:2bim.A&PDB-ENSP_mappings:2bim.B&PDB-ENSP_mappings:2bin.A&PDB-ENSP_mappings:2bio.A&PDB-ENSP_mappings:2bip.A&PDB-ENSP_mappings:2biq.A&PDB-ENSP_mappings:2fej.A&PDB-ENSP_mappings:2h1l.M&PDB-ENSP_mappings:2h1l.N&PDB-ENSP_mappings:2h1l.O&PDB-ENSP_mappings:2h1l.P&PDB-ENSP_mappings:2h1l.Q&PDB-ENSP_mappings:2h1l.R&PDB-ENSP_mappings:2h1l.S&PDB-ENSP_mappings:2h1l.T&PDB-ENSP_mappings:2h1l.U&PDB-ENSP_mappings:2h1l.V&PDB-ENSP_mappings:2h1l.W&PDB-ENSP_mappings:2h1l.X&PDB-ENSP_mappings:2j1w.A&PDB-ENSP_mappings:2j1w.B&PDB-ENSP_mappings:2j1x.A&PDB-ENSP_mappings:2j1x.B&PDB-ENSP_mappings:2j1y.A&PDB-ENSP_mappings:2j1y.B&PDB-ENSP_mappings:2j1y.C&PDB-ENSP_mappings:2j1y.D&PDB-ENSP_mappings:2j1z.A&PDB-ENSP_mappings:2j1z.B&PDB-ENSP_mappings:2j20.A&PDB-ENSP_mappings:2j20.B&PDB-ENSP_mappings:2j21.A&PDB-ENSP_mappings:2j21.B&PDB-ENSP_mappings:2mej.B&PDB-ENSP_mappings:2ocj.A&PDB-ENSP_mappings:2ocj.B&PDB-ENSP_mappings:2ocj.C&PDB-ENSP_mappings:2ocj.D&PDB-ENSP_mappings:2pcx.A&PDB-ENSP_mappings:2vuk.A&PDB-ENSP_mappings:2vuk.B&PDB-ENSP_mappings:2wgx.A&PDB-ENSP_mappings:2wgx.B&PDB-ENSP_mappings:2x0u.A&PDB-ENSP_mappings:2x0u.B&PDB-ENSP_mappings:2x0v.A&PDB-ENSP_mappings:2x0v.B&PDB-ENSP_mappings:2x0w.A&PDB-ENSP_mappings:2x0w.B&PDB-ENSP_mappings:2xwr.A&PDB-ENSP_mappings:2xwr.B&PDB-ENSP_mappings:2ybg.A&PDB-ENSP_mappings:2ybg.B&PDB-ENSP_mappings:2ybg.C&PDB-ENSP_mappings:2ybg.D&PDB-ENSP_mappings:3d05.A&PDB-ENSP_mappings:3d06.A&PDB-ENSP_mappings:3d07.A&PDB-ENSP_mappings:3d07.B&PDB-ENSP_mappings:3d08.A&PDB-ENSP_mappings:3d09.A&PDB-ENSP_mappings:3d0a.A&PDB-ENSP_mappings:3d0a.B&PDB-ENSP_mappings:3d0a.C&PDB-ENSP_mappings:3d0a.D&PDB-ENSP_mappings:3igk.A&PDB-ENSP_mappings:3igl.A&PDB-ENSP_mappings:3kmd.A&PDB-ENSP_mappings:3kmd.B&PDB-ENSP_mappings:3kmd.C&PDB-ENSP_mappings:3kmd.D&PDB-ENSP_mappings:3kz8.A&PDB-ENSP_mappings:3kz8.B&PDB-ENSP_mappings:3q01.A&PDB-ENSP_mappings:3q01.B&PDB-ENSP_mappings:3q05.A&PDB-ENSP_mappings:3q05.B&PDB-ENSP_mappings:3q05.C&PDB-ENSP_mappings:3q05.D&PDB-ENSP_mappings:3q06.A&PDB-ENSP_mappings:3q06.B&PDB-ENSP_mappings:3q06.C&PDB-ENSP_mappings:3q06.D&PDB-ENSP_mappings:3ts8.A&PDB-ENSP_mappings:3ts8.B&PDB-ENSP_mappings:3ts8.C&PDB-ENSP_mappings:3ts8.D&PDB-ENSP_mappings:3zme.A&PDB-ENSP_mappings:3zme.B&PDB-ENSP_mappings:4agl.A&PDB-ENSP_mappings:4agl.B&PDB-ENSP_mappings:4agm.A&PDB-ENSP_mappings:4agm.B&PDB-ENSP_mappings:4agn.A&PDB-ENSP_mappings:4agn.B&PDB-ENSP_mappings:4ago.A&PDB-ENSP_mappings:4ago.B&PDB-ENSP_mappings:4agp.A&PDB-ENSP_mappings:4agp.B&PDB-ENSP_mappings:4agq.A&PDB-ENSP_mappings:4agq.B&PDB-ENSP_mappings:4hje.A&PDB-ENSP_mappings:4hje.B&PDB-ENSP_mappings:4hje.C&PDB-ENSP_mappings:4hje.D&PDB-ENSP_mappings:4ibq.A&PDB-ENSP_mappings:4ibq.B&PDB-ENSP_mappings:4ibq.C&PDB-ENSP_mappings:4ibq.D&PDB-ENSP_mappings:4ibs.A&PDB-ENSP_mappings:4ibs.B&PDB-ENSP_mappings:4ibs.C&PDB-ENSP_mappings:4ibs.D&PDB-ENSP_mappings:4ibt.A&PDB-ENSP_mappings:4ibt.B&PDB-ENSP_mappings:4ibt.C&PDB-ENSP_mappings:4ibt.D&PDB-ENSP_mappings:4ibu.A&PDB-ENSP_mappings:4ibu.B&PDB-ENSP_mappings:4ibu.C&PDB-ENSP_mappings:4ibu.D&PDB-ENSP_mappings:4ibv.A&PDB-ENSP_mappings:4ibw.A&PDB-ENSP_mappings:4iby.A&PDB-ENSP_mappings:4iby.B&PDB-ENSP_mappings:4ibz.A&PDB-ENSP_mappings:4ibz.B&PDB-ENSP_mappings:4ibz.C&PDB-ENSP_mappings:4ibz.D&PDB-ENSP_mappings:4ijt.A&PDB-ENSP_mappings:4kvp.A&PDB-ENSP_mappings:4kvp.B&PDB-ENSP_mappings:4kvp.C&PDB-ENSP_mappings:4kvp.D&PDB-ENSP_mappings:4lo9.A&PDB-ENSP_mappings:4lo9.B&PDB-ENSP_mappings:4lo9.C&PDB-ENSP_mappings:4lo9.D&PDB-ENSP_mappings:4loe.A&PDB-ENSP_mappings:4loe.B&PDB-ENSP_mappings:4loe.C&PDB-ENSP_mappings:4loe.D&PDB-ENSP_mappings:4lof.A&PDB-ENSP_mappings:4mzi.A&PDB-ENSP_mappings:4mzr.A&PDB-ENSP_mappings:4mzr.B&PDB-ENSP_mappings:4mzr.C&PDB-ENSP_mappings:4mzr.D&PDB-ENSP_mappings:4qo1.B&PDB-ENSP_mappings:4xr8.C&PDB-ENSP_mappings:4xr8.D&PDB-ENSP_mappings:5a7b.A&PDB-ENSP_mappings:5a7b.B&PDB-ENSP_mappings:5ab9.A&PDB-ENSP_mappings:5ab9.B&PDB-ENSP_mappings:5aba.A&PDB-ENSP_mappings:5aba.B&PDB-ENSP_mappings:5aoi.A&PDB-ENSP_mappings:5aoi.B&PDB-ENSP_mappings:5aoj.A&PDB-ENSP_mappings:5aoj.B&PDB-ENSP_mappings:5aok.A&PDB-ENSP_mappings:5aok.B&PDB-ENSP_mappings:5aol.A&PDB-ENSP_mappings:5aol.B&PDB-ENSP_mappings:5aom.A&PDB-ENSP_mappings:5aom.B&PDB-ENSP_mappings:5bua.A&PDB-ENSP_mappings:5ecg.A&PDB-ENSP_mappings:5ecg.B&PDB-ENSP_mappings:5g4m.A&PDB-ENSP_mappings:5g4m.B&PDB-ENSP_mappings:5g4n.A&PDB-ENSP_mappings:5g4n.B&PDB-ENSP_mappings:5g4o.A&PDB-ENSP_mappings:5g4o.B&PDB-ENSP_mappings:5lap.A&PDB-ENSP_mappings:5lap.B&PDB-ENSP_mappings:5lgy.A&PDB-ENSP_mappings:5lgy.B&PDB-ENSP_mappings:5lgy.C&PDB-ENSP_mappings:5lgy.D&PDB-ENSP_mappings:5mct.A&PDB-ENSP_mappings:5mct.B&PDB-ENSP_mappings:5mcu.A&PDB-ENSP_mappings:5mcu.B&PDB-ENSP_mappings:5mcv.A&PDB-ENSP_mappings:5mcv.B&PDB-ENSP_mappings:5mcw.A&PDB-ENSP_mappings:5mcw.B&PDB-ENSP_mappings:5mf7.A&PDB-ENSP_mappings:5mf7.B&PDB-ENSP_mappings:5mg7.A&PDB-ENSP_mappings:5mg7.B&PDB-ENSP_mappings:5o1a.A&PDB-ENSP_mappings:5o1a.B&PDB-ENSP_mappings:5o1b.A&PDB-ENSP_mappings:5o1b.B&PDB-ENSP_mappings:5o1c.A&PDB-ENSP_mappings:5o1c.B&PDB-ENSP_mappings:5o1d.A&PDB-ENSP_mappings:5o1d.B&PDB-ENSP_mappings:5o1e.A&PDB-ENSP_mappings:5o1e.B&PDB-ENSP_mappings:5o1f.A&PDB-ENSP_mappings:5o1f.B&PDB-ENSP_mappings:5o1g.A&PDB-ENSP_mappings:5o1g.B&PDB-ENSP_mappings:5o1h.A&PDB-ENSP_mappings:5o1h.B&PDB-ENSP_mappings:5o1i.A&PDB-ENSP_mappings:5o1i.B&PDB-ENSP_mappings:5xzc.B&PDB-ENSP_mappings:5xzc.C&PDB-ENSP_mappings:5xzc.D&PDB-ENSP_mappings:5xzc.E&PDB-ENSP_mappings:6ff9.A&PDB-ENSP_mappings:6ff9.B&PDB-ENSP_mappings:6ff9.C&PDB-ENSP_mappings:6ff9.D&PDB-ENSP_mappings:6fj5.A&PDB-ENSP_mappings:6fj5.B&PDB-ENSP_mappings:6fj5.C&PDB-ENSP_mappings:6fj5.D&PDB-ENSP_mappings:6gga.A&PDB-ENSP_mappings:6gga.B&PDB-ENSP_mappings:6ggb.A&PDB-ENSP_mappings:6ggb.B&PDB-ENSP_mappings:6ggc.A&PDB-ENSP_mappings:6ggc.B&PDB-ENSP_mappings:6ggd.A&PDB-ENSP_mappings:6ggd.B&PDB-ENSP_mappings:6gge.A&PDB-ENSP_mappings:6gge.B&PDB-ENSP_mappings:6ggf.A&PDB-ENSP_mappings:6ggf.B&PDB-ENSP_mappings:6lhd.A&PDB-ENSP_mappings:6lhd.B&PDB-ENSP_mappings:6rz3.A&PDB-ENSP_mappings:6shz.A&PDB-ENSP_mappings:6shz.B&PDB-ENSP_mappings:6si0.A&PDB-ENSP_mappings:6si0.B&PDB-ENSP_mappings:6si1.A&PDB-ENSP_mappings:6si1.B&PDB-ENSP_mappings:6si2.A&PDB-ENSP_mappings:6si2.B&PDB-ENSP_mappings:6si3.A&PDB-ENSP_mappings:6si3.B&PDB-ENSP_mappings:6si4.A&PDB-ENSP_mappings:6si4.B&PDB-ENSP_mappings:6sl6.A&PDB-ENSP_mappings:6xre.M&PDB-ENSP_mappings:6znc.A&PDB-ENSP_mappings:7b46.A&PDB-ENSP_mappings:7b46.B&PDB-ENSP_mappings:7b46.C&PDB-ENSP_mappings:7b46.D&PDB-ENSP_mappings:7b47.A&PDB-ENSP_mappings:7b47.B&PDB-ENSP_mappings:7b47.C&PDB-ENSP_mappings:7b47.D&PDB-ENSP_mappings:7b48.A&PDB-ENSP_mappings:7b48.B&PDB-ENSP_mappings:7b48.C&PDB-ENSP_mappings:7b48.D&PDB-ENSP_mappings:7b49.A&PDB-ENSP_mappings:7b49.B&PDB-ENSP_mappings:7b4a.A&PDB-ENSP_mappings:7b4a.B&PDB-ENSP_mappings:7b4b.A&PDB-ENSP_mappings:7b4b.B&PDB-ENSP_mappings:7b4b.C&PDB-ENSP_mappings:7b4b.D&PDB-ENSP_mappings:7b4c.A&PDB-ENSP_mappings:7b4c.B&PDB-ENSP_mappings:7b4c.C&PDB-ENSP_mappings:7b4c.D&PDB-ENSP_mappings:7b4d.A&PDB-ENSP_mappings:7b4e.A&PDB-ENSP_mappings:7b4f.A&PDB-ENSP_mappings:7b4g.A&PDB-ENSP_mappings:7b4h.A&PDB-ENSP_mappings:7b4n.A&PDB-ENSP_mappings:7dhy.A&PDB-ENSP_mappings:7dhy.B&PDB-ENSP_mappings:7dhy.C&PDB-ENSP_mappings:7dhy.D&PDB-ENSP_mappings:7dhz.A&PDB-ENSP_mappings:7dhz.B&PDB-ENSP_mappings:7dvd.A&PDB-ENSP_mappings:7dvd.B&PDB-ENSP_mappings:7dvd.C&PDB-ENSP_mappings:7dvd.D&PDB-ENSP_mappings:7eax.A&PDB-ENSP_mappings:7eax.B&PDB-ENSP_mappings:7eax.C&PDB-ENSP_mappings:7eax.D&PDB-ENSP_mappings:7eds.A&PDB-ENSP_mappings:7eeu.A&PDB-ENSP_mappings:7eeu.B&PDB-ENSP_mappings:7eeu.C&PDB-ENSP_mappings:7eeu.D&PDB-ENSP_mappings:7eeu.E&PDB-ENSP_mappings:7eeu.F&PDB-ENSP_mappings:7eeu.G&PDB-ENSP_mappings:7eeu.H&PDB-ENSP_mappings:7v97.A&PDB-ENSP_mappings:7v97.B&PDB-ENSP_mappings:7v97.C&PDB-ENSP_mappings:7v97.D&PDB-ENSP_mappings:7xzx.K&PDB-ENSP_mappings:7xzx.L&PDB-ENSP_mappings:7xzx.M&PDB-ENSP_mappings:7xzx.N&PDB-ENSP_mappings:7xzz.K&PDB-ENSP_mappings:7xzz.L&PDB-ENSP_mappings:7xzz.M&PDB-ENSP_mappings:7xzz.N&PDB-ENSP_mappings:7ygi.A&PDB-ENSP_mappings:7ygi.B&PDB-ENSP_mappings:8a31.A&PDB-ENSP_mappings:8a31.B&PDB-ENSP_mappings:8a32.A&PDB-ENSP_mappings:8a32.B&PDB-ENSP_mappings:8a92.A&PDB-ENSP_mappings:8a92.B&PDB-ENSP_mappings:8cg7.A&PDB-ENSP_mappings:8cg7.B&PDB-ENSP_mappings:8dc4.A&PDB-ENSP_mappings:8dc4.B&PDB-ENSP_mappings:8dc4.C&PDB-ENSP_mappings:8dc4.D&PDB-ENSP_mappings:8dc6.A&PDB-ENSP_mappings:8dc6.B&PDB-ENSP_mappings:8dc6.C&PDB-ENSP_mappings:8dc6.D&PDB-ENSP_mappings:8dc7.A&PDB-ENSP_mappings:8dc8.A&PDB-ENSP_mappings:8e7a.A&PDB-ENSP_mappings:8e7b.A&PDB-ENSP_mappings:8e7b.B&PDB-ENSP_mappings:8f2h.A&PDB-ENSP_mappings:8f2h.B&PDB-ENSP_mappings:8f2i.A&PDB-ENSP_mappings:8gcr.B&PDB-ENSP_mappings:8hll.A&PDB-ENSP_mappings:8hlm.A&PDB-ENSP_mappings:8hln.A&PDB-ENSP_mappings:8j8n.A&PDB-ENSP_mappings:8j8n.B&PDB-ENSP_mappings:8j8n.C&PDB-ENSP_mappings:8j8n.D&PDB-ENSP_mappings:8qwk.A&PDB-ENSP_mappings:8qwl.A&PDB-ENSP_mappings:8qwm.A&PDB-ENSP_mappings:8qwm.B&PDB-ENSP_mappings:8qwn.A&PDB-ENSP_mappings:8qwo.A&PDB-ENSP_mappings:8qwo.B&PDB-ENSP_mappings:8qwp.A&PDB-ENSP_mappings:8qwp.B&PDB-ENSP_mappings:8r1f.C&PDB-ENSP_mappings:8r1g.C&PDB-ENSP_mappings:8r1g.F&PDB-ENSP_mappings:8wd2.A&PDB-ENSP_mappings:8wd2.B&PDB-ENSP_mappings:8xp5.A&PDB-ENSP_mappings:8xp5.B&Superfamily:SSF49417&Prints:PR00386&PROSITE_patterns:PS00348&Gene3D:2.60.40.720&Pfam:PF00870&PANTHER:PTHR11447&CDD:cd08367&AFDB-ENSP_mappings:AF-P04637-F102.236e-0500006.296e-0601.159e-050000000000uncertain_significance&pathogenic&pathogenic/likely_pathogenic&likely_pathogenic0&1&1&1&1&11&1&1&1&1&125741868&24033266&26900293&32293552&25157968&26619011&25105660&16489069&17606709&30744407&1631137&1978757&21343334&8099841&8425176&8527048&9598730&9825943&12826609&17427234&20013323&28664506&37182128&34771529&34178683&36866106&35483882&37391803&38310289&38413718FAIL492230-40TP53123470.0000127386.&MONDO:MONDO:0005411&MedGen:C0153452&MONDO:MONDO:0004557&MedGen:C0334459&MONDO:MONDO:0023644&MedGen:C0220641&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&MedGen:CN221562&MONDO:MONDO:0015278&MedGen:C2931038&OMIM:260350&Orphanet:1333&MONDO:MONDO:0018905&MeSH:D016403&MedGen:C0079744&Orphanet:544&MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MedGen:C3661900&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&MONDO:MONDO:0008734&MedGen:C1859972&OMIM:202300&Orphanet:1501&Human_Phenotype_Ontology:HP:0030392&MONDO:MONDO:0016718&MedGen:C0431109&Orphanet:251899&Gene:553989&MedGen:C1835398&OMIM:151623&Orphanet:524&MONDO:MONDO:0018875&MedGen:C0085390&OMIM:PS151623&Orphanet:524SCV001142555single_nucleotide_variantSO:0001483ClinGen:CA000382&OMIM:191170.0001&UniProtKB:P04637#VAR_005984TP53:7157SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094410121912651Breast_phyllodes_tumor&Diffuse_glioma&_H3_G34_mutant&Medulloblastoma_SHH_activated_and_TP53_mutant&Diffuse_pediatric-type_high-grade_glioma&_H3-wildtype_and_IDH-wildtype&Colorectal_cancerMONDO:MONDO:0021047&MedGen:C0238031&MONDO:MONDO:0957197&MedGen:CN377580&MONDO:MONDO:0956964&MedGen:CN377553&MONDO:MONDO:0858939&MedGen:C5669918&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500SCV007104830&SCV007105490&SCV007105612&SCV00710563617:7674221-76742211TP53p.R248WTrueThe TP53 R248W mutation is located in the protein's DNA binding domain. This mutation has been found in Li-Fraumeni syndrome (PMID: 25584008). In vitro studies have demonstrated that this mutation is inactivating, as evidenced by increased p53-mediated transactivation and failure to suppress colony growth in the mutant compared to wildtype (PMID: 18762571, 10229196, 25584008).TP53, a tumor suppressor in the DNA damage pathway, is the most frequently mutated gene in cancer.25584008|18762571|10229196R248W7157TP53GRCh38.MUTATION.The TP53 R248W mutation is likely oncogenic.False.The TP53 R248W mutation is located in the protein's DNA binding domain. This mutation has been found in Li-Fraumeni syndrome (PMID: 25584008). In vitro studies have demonstrated that this mutation is inactivating, as evidenced by increased p53-mediated transactivation and failure to suppress colony growth in the mutant compared to wildtype (PMID: 18762571, 10229196, 25584008).['25584008', '18762571', '10229196']25584008;18762571;10229196MDS,AMLMRC,TMN,CLLSLL,PMF,AML,MPN,ETMCL21714648;25092778;24220272;25412851;25860933;25412846;25952993;23243274;24004666;20697090;19188171;24652989;25516983;22052707;22887079;22186996;18596741;8639789;7579380;28819011;24684350;26022239;24478400;2929669288Amissense_variantTP537157GeneENST00000269305.4ENST00000269305.4:c.742C>TNP_000537.3:p.Arg248Trp118ARG248TRP/RS121912651https://civicdb.org/links/variants/118TP53_R248W118NM_000546.5:c.742C>T/NP_000537.3:p.Arg248Trp/NC_000017.10:g.7577539G>A/ENST00000269305.4:c.742C>TCA00038212347
TUMORp.R175HENSP00000269305.4:p.Arg175Hischr177675088CTPASSNM_000546missense_variantMODERATETP535/11c.524G>Ars28934578&CM062017&CM951224&COSV52661038&COSV52677601&COSV52731306&COSV53801286SNVtolerated(0.08)4.104e-066.57e-061.47e-05gnomADg_NFE0.000.000.010.000.9224.4900e-01TP53-related_disorder&Colorectal_cancer&Nasopharyngeal_carcinoma&Bone_osteosarcoma&Hepatocellular_carcinoma&Li-Fraumeni_syndrome_1&Glioma_susceptibility_1&Bone_marrow_failure_syndrome_5&Basal_cell_carcinoma&_susceptibility_to&_7&Adrenocortical_carcinoma&_hereditary&Carcinoma_of_pancreas&Choroid_plexus_papilloma&Familial_cancer_of_breast&Lip_and_oral_cavity_carcinoma&Gastric_cancer&Hereditary_cancer-predisposing_syndrome&not_provided&Ovarian_neoplasm&Malignant_tumor_of_esophagus&Li-Fraumeni_syndrome&Squamous_cell_carcinoma_of_the_head_and_neckNC_000017.11:g.7675088C>Treviewed_by_expert_panelPathogenicOncogeniccriteria_provided&_single_submitter19criteria_provided&_single_submitterTier_I_-_StrongTP53R175Hchr17:7675088-7675088v7.0..✓ Hotspot06/11/2024.TrueTrueTrueLoss-of-functionOncogenicLEVEL_Px143,450/1R175H0.5113636363636364GRCh38TP53CCT7675088TP53_R175H.GT:AD:AF:DP0/1:43,45:0.51:88TENSG00000141510TranscriptENST00000269305protein_coding666524175R/HcGc/cAc-1HGNCHGNC:11998YESMANE_SelectNM_000546.61P1CCDS11118.1ENSP00000269305P04637.307K7PPA8.92UPI000002ED67P04637-1Ensembl1PDB-ENSP_mappings:1gzh.A&PDB-ENSP_mappings:1gzh.C&PDB-ENSP_mappings:1kzy.A&PDB-ENSP_mappings:1kzy.B&PDB-ENSP_mappings:1tsr.A&PDB-ENSP_mappings:1tsr.B&PDB-ENSP_mappings:1tsr.C&PDB-ENSP_mappings:1tup.A&PDB-ENSP_mappings:1tup.B&PDB-ENSP_mappings:1tup.C&PDB-ENSP_mappings:1uol.A&PDB-ENSP_mappings:1uol.B&PDB-ENSP_mappings:1ycs.A&PDB-ENSP_mappings:2ac0.A&PDB-ENSP_mappings:2ac0.B&PDB-ENSP_mappings:2ac0.C&PDB-ENSP_mappings:2ac0.D&PDB-ENSP_mappings:2ady.A&PDB-ENSP_mappings:2ady.B&PDB-ENSP_mappings:2ahi.A&PDB-ENSP_mappings:2ahi.B&PDB-ENSP_mappings:2ahi.C&PDB-ENSP_mappings:2ahi.D&PDB-ENSP_mappings:2ata.A&PDB-ENSP_mappings:2ata.B&PDB-ENSP_mappings:2ata.C&PDB-ENSP_mappings:2ata.D&PDB-ENSP_mappings:2bim.A&PDB-ENSP_mappings:2bim.B&PDB-ENSP_mappings:2bin.A&PDB-ENSP_mappings:2bio.A&PDB-ENSP_mappings:2bip.A&PDB-ENSP_mappings:2biq.A&PDB-ENSP_mappings:2fej.A&PDB-ENSP_mappings:2h1l.M&PDB-ENSP_mappings:2h1l.N&PDB-ENSP_mappings:2h1l.O&PDB-ENSP_mappings:2h1l.P&PDB-ENSP_mappings:2h1l.Q&PDB-ENSP_mappings:2h1l.R&PDB-ENSP_mappings:2h1l.S&PDB-ENSP_mappings:2h1l.T&PDB-ENSP_mappings:2h1l.U&PDB-ENSP_mappings:2h1l.V&PDB-ENSP_mappings:2h1l.W&PDB-ENSP_mappings:2h1l.X&PDB-ENSP_mappings:2j1w.A&PDB-ENSP_mappings:2j1w.B&PDB-ENSP_mappings:2j1x.A&PDB-ENSP_mappings:2j1x.B&PDB-ENSP_mappings:2j1y.A&PDB-ENSP_mappings:2j1y.B&PDB-ENSP_mappings:2j1y.C&PDB-ENSP_mappings:2j1y.D&PDB-ENSP_mappings:2j1z.A&PDB-ENSP_mappings:2j1z.B&PDB-ENSP_mappings:2j20.A&PDB-ENSP_mappings:2j20.B&PDB-ENSP_mappings:2j21.A&PDB-ENSP_mappings:2j21.B&PDB-ENSP_mappings:2mej.B&PDB-ENSP_mappings:2ocj.A&PDB-ENSP_mappings:2ocj.B&PDB-ENSP_mappings:2ocj.C&PDB-ENSP_mappings:2ocj.D&PDB-ENSP_mappings:2pcx.A&PDB-ENSP_mappings:2vuk.A&PDB-ENSP_mappings:2vuk.B&PDB-ENSP_mappings:2wgx.A&PDB-ENSP_mappings:2wgx.B&PDB-ENSP_mappings:2x0u.A&PDB-ENSP_mappings:2x0u.B&PDB-ENSP_mappings:2x0v.A&PDB-ENSP_mappings:2x0v.B&PDB-ENSP_mappings:2x0w.A&PDB-ENSP_mappings:2x0w.B&PDB-ENSP_mappings:2xwr.A&PDB-ENSP_mappings:2xwr.B&PDB-ENSP_mappings:2ybg.A&PDB-ENSP_mappings:2ybg.B&PDB-ENSP_mappings:2ybg.C&PDB-ENSP_mappings:2ybg.D&PDB-ENSP_mappings:3d05.A&PDB-ENSP_mappings:3d06.A&PDB-ENSP_mappings:3d07.A&PDB-ENSP_mappings:3d07.B&PDB-ENSP_mappings:3d08.A&PDB-ENSP_mappings:3d09.A&PDB-ENSP_mappings:3d0a.A&PDB-ENSP_mappings:3d0a.B&PDB-ENSP_mappings:3d0a.C&PDB-ENSP_mappings:3d0a.D&PDB-ENSP_mappings:3igk.A&PDB-ENSP_mappings:3igl.A&PDB-ENSP_mappings:3kmd.A&PDB-ENSP_mappings:3kmd.B&PDB-ENSP_mappings:3kmd.C&PDB-ENSP_mappings:3kmd.D&PDB-ENSP_mappings:3kz8.A&PDB-ENSP_mappings:3kz8.B&PDB-ENSP_mappings:3q01.A&PDB-ENSP_mappings:3q01.B&PDB-ENSP_mappings:3q05.A&PDB-ENSP_mappings:3q05.B&PDB-ENSP_mappings:3q05.C&PDB-ENSP_mappings:3q05.D&PDB-ENSP_mappings:3q06.A&PDB-ENSP_mappings:3q06.B&PDB-ENSP_mappings:3q06.C&PDB-ENSP_mappings:3q06.D&PDB-ENSP_mappings:3ts8.A&PDB-ENSP_mappings:3ts8.B&PDB-ENSP_mappings:3ts8.C&PDB-ENSP_mappings:3ts8.D&PDB-ENSP_mappings:3zme.A&PDB-ENSP_mappings:3zme.B&PDB-ENSP_mappings:4agl.A&PDB-ENSP_mappings:4agl.B&PDB-ENSP_mappings:4agm.A&PDB-ENSP_mappings:4agm.B&PDB-ENSP_mappings:4agn.A&PDB-ENSP_mappings:4agn.B&PDB-ENSP_mappings:4ago.A&PDB-ENSP_mappings:4ago.B&PDB-ENSP_mappings:4agp.A&PDB-ENSP_mappings:4agp.B&PDB-ENSP_mappings:4agq.A&PDB-ENSP_mappings:4agq.B&PDB-ENSP_mappings:4hje.A&PDB-ENSP_mappings:4hje.B&PDB-ENSP_mappings:4hje.C&PDB-ENSP_mappings:4hje.D&PDB-ENSP_mappings:4ibq.A&PDB-ENSP_mappings:4ibq.B&PDB-ENSP_mappings:4ibq.C&PDB-ENSP_mappings:4ibq.D&PDB-ENSP_mappings:4ibs.A&PDB-ENSP_mappings:4ibs.B&PDB-ENSP_mappings:4ibs.C&PDB-ENSP_mappings:4ibs.D&PDB-ENSP_mappings:4ibt.A&PDB-ENSP_mappings:4ibt.B&PDB-ENSP_mappings:4ibt.C&PDB-ENSP_mappings:4ibt.D&PDB-ENSP_mappings:4ibu.A&PDB-ENSP_mappings:4ibu.B&PDB-ENSP_mappings:4ibu.C&PDB-ENSP_mappings:4ibu.D&PDB-ENSP_mappings:4ibv.A&PDB-ENSP_mappings:4ibw.A&PDB-ENSP_mappings:4iby.A&PDB-ENSP_mappings:4iby.B&PDB-ENSP_mappings:4ibz.A&PDB-ENSP_mappings:4ibz.B&PDB-ENSP_mappings:4ibz.C&PDB-ENSP_mappings:4ibz.D&PDB-ENSP_mappings:4ijt.A&PDB-ENSP_mappings:4kvp.A&PDB-ENSP_mappings:4kvp.B&PDB-ENSP_mappings:4kvp.C&PDB-ENSP_mappings:4kvp.D&PDB-ENSP_mappings:4lo9.A&PDB-ENSP_mappings:4lo9.B&PDB-ENSP_mappings:4lo9.C&PDB-ENSP_mappings:4lo9.D&PDB-ENSP_mappings:4loe.A&PDB-ENSP_mappings:4loe.B&PDB-ENSP_mappings:4loe.C&PDB-ENSP_mappings:4loe.D&PDB-ENSP_mappings:4lof.A&PDB-ENSP_mappings:4mzi.A&PDB-ENSP_mappings:4mzr.A&PDB-ENSP_mappings:4mzr.B&PDB-ENSP_mappings:4mzr.C&PDB-ENSP_mappings:4mzr.D&PDB-ENSP_mappings:4qo1.B&PDB-ENSP_mappings:4xr8.C&PDB-ENSP_mappings:4xr8.D&PDB-ENSP_mappings:5a7b.A&PDB-ENSP_mappings:5a7b.B&PDB-ENSP_mappings:5ab9.A&PDB-ENSP_mappings:5ab9.B&PDB-ENSP_mappings:5aba.A&PDB-ENSP_mappings:5aba.B&PDB-ENSP_mappings:5aoi.A&PDB-ENSP_mappings:5aoi.B&PDB-ENSP_mappings:5aoj.A&PDB-ENSP_mappings:5aoj.B&PDB-ENSP_mappings:5aok.A&PDB-ENSP_mappings:5aok.B&PDB-ENSP_mappings:5aol.A&PDB-ENSP_mappings:5aol.B&PDB-ENSP_mappings:5aom.A&PDB-ENSP_mappings:5aom.B&PDB-ENSP_mappings:5bua.A&PDB-ENSP_mappings:5ecg.A&PDB-ENSP_mappings:5ecg.B&PDB-ENSP_mappings:5g4m.A&PDB-ENSP_mappings:5g4m.B&PDB-ENSP_mappings:5g4n.A&PDB-ENSP_mappings:5g4n.B&PDB-ENSP_mappings:5g4o.A&PDB-ENSP_mappings:5g4o.B&PDB-ENSP_mappings:5lap.A&PDB-ENSP_mappings:5lap.B&PDB-ENSP_mappings:5lgy.A&PDB-ENSP_mappings:5lgy.B&PDB-ENSP_mappings:5lgy.C&PDB-ENSP_mappings:5lgy.D&PDB-ENSP_mappings:5mct.A&PDB-ENSP_mappings:5mct.B&PDB-ENSP_mappings:5mcu.A&PDB-ENSP_mappings:5mcu.B&PDB-ENSP_mappings:5mcv.A&PDB-ENSP_mappings:5mcv.B&PDB-ENSP_mappings:5mcw.A&PDB-ENSP_mappings:5mcw.B&PDB-ENSP_mappings:5mf7.A&PDB-ENSP_mappings:5mf7.B&PDB-ENSP_mappings:5mg7.A&PDB-ENSP_mappings:5mg7.B&PDB-ENSP_mappings:5o1a.A&PDB-ENSP_mappings:5o1a.B&PDB-ENSP_mappings:5o1b.A&PDB-ENSP_mappings:5o1b.B&PDB-ENSP_mappings:5o1c.A&PDB-ENSP_mappings:5o1c.B&PDB-ENSP_mappings:5o1d.A&PDB-ENSP_mappings:5o1d.B&PDB-ENSP_mappings:5o1e.A&PDB-ENSP_mappings:5o1e.B&PDB-ENSP_mappings:5o1f.A&PDB-ENSP_mappings:5o1f.B&PDB-ENSP_mappings:5o1g.A&PDB-ENSP_mappings:5o1g.B&PDB-ENSP_mappings:5o1h.A&PDB-ENSP_mappings:5o1h.B&PDB-ENSP_mappings:5o1i.A&PDB-ENSP_mappings:5o1i.B&PDB-ENSP_mappings:5xzc.B&PDB-ENSP_mappings:5xzc.C&PDB-ENSP_mappings:5xzc.D&PDB-ENSP_mappings:5xzc.E&PDB-ENSP_mappings:6ff9.A&PDB-ENSP_mappings:6ff9.B&PDB-ENSP_mappings:6ff9.C&PDB-ENSP_mappings:6ff9.D&PDB-ENSP_mappings:6fj5.A&PDB-ENSP_mappings:6fj5.B&PDB-ENSP_mappings:6fj5.C&PDB-ENSP_mappings:6fj5.D&PDB-ENSP_mappings:6gga.A&PDB-ENSP_mappings:6gga.B&PDB-ENSP_mappings:6ggb.A&PDB-ENSP_mappings:6ggb.B&PDB-ENSP_mappings:6ggc.A&PDB-ENSP_mappings:6ggc.B&PDB-ENSP_mappings:6ggd.A&PDB-ENSP_mappings:6ggd.B&PDB-ENSP_mappings:6gge.A&PDB-ENSP_mappings:6gge.B&PDB-ENSP_mappings:6ggf.A&PDB-ENSP_mappings:6ggf.B&PDB-ENSP_mappings:6lhd.A&PDB-ENSP_mappings:6lhd.B&PDB-ENSP_mappings:6rz3.A&PDB-ENSP_mappings:6shz.A&PDB-ENSP_mappings:6shz.B&PDB-ENSP_mappings:6si0.A&PDB-ENSP_mappings:6si0.B&PDB-ENSP_mappings:6si1.A&PDB-ENSP_mappings:6si1.B&PDB-ENSP_mappings:6si2.A&PDB-ENSP_mappings:6si2.B&PDB-ENSP_mappings:6si3.A&PDB-ENSP_mappings:6si3.B&PDB-ENSP_mappings:6si4.A&PDB-ENSP_mappings:6si4.B&PDB-ENSP_mappings:6sl6.A&PDB-ENSP_mappings:6vqo.P&PDB-ENSP_mappings:6vqo.Q&PDB-ENSP_mappings:6vr1.P&PDB-ENSP_mappings:6vr1.Q&PDB-ENSP_mappings:6vr5.P&PDB-ENSP_mappings:6vr5.Q&PDB-ENSP_mappings:6vrm.P&PDB-ENSP_mappings:6vrn.P&PDB-ENSP_mappings:6w51.C&PDB-ENSP_mappings:6w51.F&PDB-ENSP_mappings:6w51.I&PDB-ENSP_mappings:6w51.L&PDB-ENSP_mappings:6xre.M&PDB-ENSP_mappings:6znc.A&PDB-ENSP_mappings:7b46.A&PDB-ENSP_mappings:7b46.B&PDB-ENSP_mappings:7b46.C&PDB-ENSP_mappings:7b46.D&PDB-ENSP_mappings:7b47.A&PDB-ENSP_mappings:7b47.B&PDB-ENSP_mappings:7b47.C&PDB-ENSP_mappings:7b47.D&PDB-ENSP_mappings:7b48.A&PDB-ENSP_mappings:7b48.B&PDB-ENSP_mappings:7b48.C&PDB-ENSP_mappings:7b48.D&PDB-ENSP_mappings:7b49.A&PDB-ENSP_mappings:7b49.B&PDB-ENSP_mappings:7b4a.A&PDB-ENSP_mappings:7b4a.B&PDB-ENSP_mappings:7b4b.A&PDB-ENSP_mappings:7b4b.B&PDB-ENSP_mappings:7b4b.C&PDB-ENSP_mappings:7b4b.D&PDB-ENSP_mappings:7b4c.A&PDB-ENSP_mappings:7b4c.B&PDB-ENSP_mappings:7b4c.C&PDB-ENSP_mappings:7b4c.D&PDB-ENSP_mappings:7b4d.A&PDB-ENSP_mappings:7b4e.A&PDB-ENSP_mappings:7b4f.A&PDB-ENSP_mappings:7b4g.A&PDB-ENSP_mappings:7b4h.A&PDB-ENSP_mappings:7b4n.A&PDB-ENSP_mappings:7dhy.A&PDB-ENSP_mappings:7dhy.B&PDB-ENSP_mappings:7dhy.C&PDB-ENSP_mappings:7dhy.D&PDB-ENSP_mappings:7dhz.A&PDB-ENSP_mappings:7dhz.B&PDB-ENSP_mappings:7dvd.A&PDB-ENSP_mappings:7dvd.B&PDB-ENSP_mappings:7dvd.C&PDB-ENSP_mappings:7dvd.D&PDB-ENSP_mappings:7eax.A&PDB-ENSP_mappings:7eax.B&PDB-ENSP_mappings:7eax.C&PDB-ENSP_mappings:7eax.D&PDB-ENSP_mappings:7eds.A&PDB-ENSP_mappings:7eeu.A&PDB-ENSP_mappings:7eeu.B&PDB-ENSP_mappings:7eeu.C&PDB-ENSP_mappings:7eeu.D&PDB-ENSP_mappings:7eeu.E&PDB-ENSP_mappings:7eeu.F&PDB-ENSP_mappings:7eeu.G&PDB-ENSP_mappings:7eeu.H&PDB-ENSP_mappings:7rm4.C&PDB-ENSP_mappings:7rm4.H&PDB-ENSP_mappings:7rm4.M&PDB-ENSP_mappings:7rm4.R&PDB-ENSP_mappings:7v97.A&PDB-ENSP_mappings:7v97.B&PDB-ENSP_mappings:7v97.C&PDB-ENSP_mappings:7v97.D&PDB-ENSP_mappings:7xzx.K&PDB-ENSP_mappings:7xzx.L&PDB-ENSP_mappings:7xzx.M&PDB-ENSP_mappings:7xzx.N&PDB-ENSP_mappings:7xzz.K&PDB-ENSP_mappings:7xzz.L&PDB-ENSP_mappings:7xzz.M&PDB-ENSP_mappings:7xzz.N&PDB-ENSP_mappings:7ygi.A&PDB-ENSP_mappings:7ygi.B&PDB-ENSP_mappings:8a31.A&PDB-ENSP_mappings:8a31.B&PDB-ENSP_mappings:8a32.A&PDB-ENSP_mappings:8a32.B&PDB-ENSP_mappings:8a92.A&PDB-ENSP_mappings:8a92.B&PDB-ENSP_mappings:8cg7.A&PDB-ENSP_mappings:8cg7.B&PDB-ENSP_mappings:8dc4.A&PDB-ENSP_mappings:8dc4.B&PDB-ENSP_mappings:8dc4.C&PDB-ENSP_mappings:8dc4.D&PDB-ENSP_mappings:8dc6.A&PDB-ENSP_mappings:8dc6.B&PDB-ENSP_mappings:8dc6.C&PDB-ENSP_mappings:8dc6.D&PDB-ENSP_mappings:8dc7.A&PDB-ENSP_mappings:8dc8.A&PDB-ENSP_mappings:8e7a.A&PDB-ENSP_mappings:8e7b.A&PDB-ENSP_mappings:8e7b.B&PDB-ENSP_mappings:8f2h.A&PDB-ENSP_mappings:8f2h.B&PDB-ENSP_mappings:8f2i.A&PDB-ENSP_mappings:8gcr.B&PDB-ENSP_mappings:8hll.A&PDB-ENSP_mappings:8hlm.A&PDB-ENSP_mappings:8hln.A&PDB-ENSP_mappings:8j8n.A&PDB-ENSP_mappings:8j8n.B&PDB-ENSP_mappings:8j8n.C&PDB-ENSP_mappings:8j8n.D&PDB-ENSP_mappings:8qwk.A&PDB-ENSP_mappings:8qwl.A&PDB-ENSP_mappings:8qwm.A&PDB-ENSP_mappings:8qwm.B&PDB-ENSP_mappings:8qwn.A&PDB-ENSP_mappings:8qwo.A&PDB-ENSP_mappings:8qwo.B&PDB-ENSP_mappings:8qwp.A&PDB-ENSP_mappings:8qwp.B&PDB-ENSP_mappings:8r1f.C&PDB-ENSP_mappings:8r1g.C&PDB-ENSP_mappings:8r1g.F&PDB-ENSP_mappings:8wd2.A&PDB-ENSP_mappings:8wd2.B&PDB-ENSP_mappings:8xp5.A&PDB-ENSP_mappings:8xp5.B&Superfamily:SSF49417&Prints:PR00386&Gene3D:2.60.40.720&Pfam:PF00870&PANTHER:PTHR11447&CDD:cd08367&AFDB-ENSP_mappings:AF-P04637-F10000005.396e-060000000001.47e-0500pathogenic&not_provided&likely_pathogenic0&1&1&1&1&1&11&1&1&1&1&1&126900293&34239995&25157968&21264207&34203389&21305319&32000721&25105660&16489069&17606709&18511570&23161690&33076847&24929325&21761402&16401470&8649785&9047394&11101847&15977174&18391940&19881536&20128691&20689556&21343334&22233476&22698404&23792586&24573247&36531003&31907277&31371350&34964846&33174010&35328276&32467344&36077746&28163917&34771529&35867400&23639312&25404506&37304756&36866106&34514028&30709875&30816478&12619118&37435187&38459566&38310289&38156855FAIL112811-35TP53123740.0000127413.&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500&MONDO:MONDO:0015459&MedGen:C2931822&OMIM:607107&Orphanet:150&MONDO:MONDO:0002629&MedGen:C0585442&OMIM:259500&Orphanet:668&Human_Phenotype_Ontology:HP:0001402&Human_Phenotype_Ontology:HP:0002899&Human_Phenotype_Ontology:HP:0003007&Human_Phenotype_Ontology:HP:0006750&MONDO:MONDO:0007256&MedGen:C2239176&OMIM:114550&Orphanet:88673&Gene:553989&MedGen:C1835398&OMIM:151623&Orphanet:524&MONDO:MONDO:0024498&MedGen:C2750850&OMIM:137800&MONDO:MONDO:0032573&MedGen:C4748488&OMIM:618165&MONDO:MONDO:0013876&MedGen:C3553606&OMIM:614740&MONDO:MONDO:0008734&MedGen:C1859972&OMIM:202300&Orphanet:1501&MONDO:MONDO:0005192&MedGen:C0235974&Orphanet:1333&Orphanet:217074&Human_Phenotype_Ontology:HP:0200022&MONDO:MONDO:0009837&MedGen:C0205770&OMIM:260500&Orphanet:251899&Orphanet:2807&MONDO:MONDO:0016419&MedGen:C0346153&OMIM:114480&Orphanet:227535&MONDO:MONDO:0023644&MedGen:C0220641&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MedGen:C3661900&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&MONDO:MONDO:0007576&MedGen:C0546837&OMIM:133239&Orphanet:99977&MONDO:MONDO:0018875&MedGen:C0085390&OMIM:PS151623&Orphanet:524&MONDO:MONDO:0010150&MeSH:D000077195&MedGen:C1168401&OMIM:275355&Orphanet:67037SCV005201131single_nucleotide_variantSO:0001483ClinGen:CA000251&OMIM:191170.0030&UniProtKB:P04637#VAR_005932TP53:7157SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV00509444028934578Diffuse_midline_glioma&_H3_K27M-mutant&Undifferentiated_embryonal_sarcoma_of_the_liver&Small_intestine_adenocarcinoma&IDH-wildtype_glioblastoma&Medulloblastoma_SHH_activated_and_TP53_mutant&Astrocytoma_IDH-mutant&NeuroblastomaMONDO:MONDO:0957196&MedGen:C4289688&MONDO:MONDO:0015795&MedGen:C2205345&Orphanet:178315&Human_Phenotype_Ontology:HP:0040274&MONDO:MONDO:0003198&MedGen:C0278803&Orphanet:104075&MONDO:MONDO:0850335&MedGen:CN372125&MONDO:MONDO:0956964&MedGen:CN377553&MedGen:C5669733&Human_Phenotype_Ontology:HP:0003006&Human_Phenotype_Ontology:HP:0006738&MONDO:MONDO:0005072&MeSH:D009447&MedGen:C0027819&Orphanet:635SCV007104864&SCV007105303&SCV007105574&SCV007105584&SCV007105618&SCV00710562717:7675088-76750881TP53p.R175HTrueThe TP53 R175H mutation is located in the protein's DNA binding domain. This mutation has been found in acute myeloid leukemia (PMID: 31068365). In vitro and in vivo studies have demonstrated that this mutation is inactivating and oncogenic, as measured by the reduced ability to induce apoptosis and form colonies, as well as increased cell migration and faster progression of hematopoietic malignancy of the mutant compared to TP53 wildtype or deletion (PMID: 15781620, 25584008, 31068365). Structural studies have also shown that this mutant is defective in protein folding and DNA binding (PMID: 10713666, 21445056).TP53, a tumor suppressor in the DNA damage pathway, is the most frequently mutated gene in cancer.25584008|15781620|10713666|21445056|31068365R175H7157TP53GRCh38.MUTATION.The TP53 R175H mutation is known to be oncogenic.False.The TP53 R175H mutation is located in the protein's DNA binding domain. This mutation has been found in acute myeloid leukemia (PMID: 31068365). In vitro and in vivo studies have demonstrated that this mutation is inactivating and oncogenic, as measured by the reduced ability to induce apoptosis and form colonies, as well as increased cell migration and faster progression of hematopoietic malignancy of the mutant compared to TP53 wildtype or deletion (PMID: 15781620, 25584008, 31068365). Structural studies have also shown that this mutant is defective in protein folding and DNA binding (PMID: 10713666, 21445056).['25584008', '15781620', '10713666', '21445056', '31068365']25584008;15781620;10713666;21445056;31068365MDS,AMLMRC,TMN,CLLSLL,PMF,AML,MPN,ETMCL21714648;25092778;24220272;25412851;25860933;25412846;25952993;23243274;24004666;20697090;19188171;24652989;25516983;22052707;22887079;22186996;18596741;8639789;7579380;28819011;24684350;26022239;24478400;2929669288Tmissense_variantTP537157GeneENST00000269305.4ENST00000269305.4:c.524G>ANP_000537.3:p.Arg175His116ARG175HIS/RS28934578/R43H/R136Hhttps://civicdb.org/links/variants/116TP53_R175H116NM_000546.5:c.524G>A/NP_000537.3:p.Arg175His/NC_000017.10:g.7578406C>T/ENST00000269305.4:c.524G>ACA00025112374
TUMORchr1739687914N<DUP>PASSNM_004448transcript_amplificationHIGHERBB2nanduplicationv7.0.LEVEL_Fda2False03/20/2026LEVEL_142512DUPTrueTrueTrueGain-of-functionOncogenicAdo-Trastuzumab Emtansine,Lapatinib,Capecitabine,Margetuximab,Chemotherapy,Neratinib,Pembrolizumab,Trastuzumab,Trastuzumab Deruxtecan,Pertuzumab,Tucatinib,LetrozoleAdo-Trastuzumab Emtansine,Lapatinib,Trastuzumab,Trastuzumab Deruxtecan,Carboplatin-Taxol Regimen,Pertuzumab,Tucatinib,DocetaxelTrastuzumab Deruxtecan,ZanidatamabLEVEL_1.0/1GRCh38ERBB2NN<DUP>39687914MantaDUP:ERBB2_AMP.GT:PR:SR0/1:25,18:10,8duplicationENSG00000141736TranscriptENST00000269571protein_coding1HGNCHGNC:3430YESMANE_SelectNM_004448.41P1CCDS32642.1ENSP00000269571P04626.275X5DNK3.71UPI000003F55FP04626-1Ensembl10,10,139730426FalseERBB2 amplification results in overexpression of the HER2 protein. Overexpression of HER2 (ERBB2) in murine fibroblasts and in the mammary glands of genetically engineered mouse models have demonstrated that it is activating as measured by increased pathway activation and tumor growth (PMID: 23204226, 12124352, 11571643, 10716706, 2885917). In vitro studies have demonstrated that this mutation is sensitive to trastuzumab when expressed in biliary tract cancer cell lines as measured by decreased proliferation upon drug treatment (PMID: 30659304). One patient with biliary tract cancer overexpressing ERBB2 had a partial response to an ERBB2-targeting antibody linked to a cytotoxic agent, ado-trastuzumab emtansine (Abstract: Mondaca et al. JCO PO, 2019. https://ascopubs.org/doi/full/10.1200/PO.19.00223).ERBB2, a receptor tyrosine kinase, is altered by mutation, amplification and/or overexpression in various cancer types, most frequently in breast, esophagogastric and endometrial cancers.30659304|12124352|2885917|10716706|23204226|11571643Amplification2064ERBB2GRCh38.CNA.ERBB2 amplification is known to be oncogenic.FalseLEVEL_Fda2ERBB2 amplification results in overexpression of the HER2 protein. Overexpression of HER2 (ERBB2) in murine fibroblasts and in the mammary glands of genetically engineered mouse models have demonstrated that it is activating as measured by increased pathway activation and tumor growth (PMID: 23204226, 12124352, 11571643, 10716706, 2885917). In vitro studies have demonstrated that this mutation is sensitive to trastuzumab when expressed in biliary tract cancer cell lines as measured by decreased proliferation upon drug treatment (PMID: 30659304). One patient with biliary tract cancer overexpressing ERBB2 had a partial response to an ERBB2-targeting antibody linked to a cytotoxic agent, ado-trastuzumab emtansine (Abstract: Mondaca et al. JCO PO, 2019. https://ascopubs.org/doi/full/10.1200/PO.19.00223).['30659304', '12124352', '2885917', '10716706', '23204226', '11571643'][{'abstract': 'Mondaca et al. JCO PO, 2019.', 'link': 'https://ascopubs.org/doi/full/10.1200/PO.19.00223'}]Ado-Trastuzumab EmtansineLEVEL_1LEVEL_Fda2['23020162']Ado-trastuzumab emtansine (T-DM1) is an intravenously infused, ERBB2-targeted antibody and microtubule inhibitory conjugate that is FDA-approved for the treatment of patients with HER2-positive metastatic breast cancer who previously received trastuzumab and a taxane, separately or in combination. HER2-positive status was defined as immunohistochemistry (IHC) 3+ or FISH amplification ratio 2.0 in breast tumor samples. FDA approval was based on the results from the Phase III EMILIA (NCT00829166) trial of T-DM1 versus lapatinib plus capecitabine in 991 patients with HER2-positive advanced breast cancer who had prior treatment with trastuzumab and a taxane (PMID: 23020162). In the Phase III EMILIA (NCT00829166) trial, the T-DM1 treated cohort (n=495) demonstrated a median progression-free survival (PFS) of 9.6 months, a median overall survival (OS) of 30.9 months and an objective response rate (ORR) of 43.6% (n=173). The lapatinib plus capecitabine treated cohort (n=496) demonstrated a median PFS of 6.4 months (HR=0.650 [95% CI=0.549-0.771], p<0.0001), a median OS of 25.1 months (HR=0.682 [95% CI=0.548-0.849], p=0.0006) and an ORR of 30.8% (n=120) (12.7% ORR difference [95% CI=6.0-19.4]) (PMID: 23020162).Breast CancerSOLIDBreastLapatinib + CapecitabineLEVEL_1LEVEL_Fda2['19786658', '17192538']Lapatinib is an oral, ATP-competitive, reversible tyrosine kinase inhibitor that targets both EGFR and ERBB2 and is FDA-approved in combination with capecitabine for patients with advanced or metastatic ERBB2-overexpressing breast cancer who had received prior therapy with an anthracycline, a taxane or trastuzumab. FDA approval was based on results from a randomized, Phase III trial in which eligible patients treated with lapatinib and capecitabine had a shorter time-to-progression (TTP) (8.4 months vs. 4.4, hazard ratio, 0.47, p<0.001) compared to patients that received capecitabine alone (PMID: 17192538). Lapatinib is also FDA-approved in combination with letrozole for the treatment of metastatic, postmenopausal breast cancer that is both ERBB2-positive and hormone receptor-positive. FDA approval in this context was based on evidence from the EGF30008 trial in which eligible patients treated with lapatinib plus letrozole showed a significantly improved progression-free survival (PFS) (median PFS, 8.2 vs. 3.0 months) compared to patients treated with letrozole plus placebo (PMID: 19786658). Treatment with lapatinib also significantly improved clinical benefit rates (CBR) (48% with letrozole-lapatinib vs. 29% with letrozole alone) and was associated with a trend toward improvement in overall survival (OS) (PMID: 19786658).Breast CancerSOLIDBreastMargetuximab + ChemotherapyLEVEL_1LEVEL_Fda2['33480963']Margetuximab, a monoclonal antibody targeting the HER2 protein, is FDA-approved in combination with chemotherapy for the treatment of adult patients with metastatic HER2-positive breast cancer who have received two or more prior anti-HER2 regimens, at least one of which was for metastatic disease. FDA approval was based on the randomized, open-label Phase III SOPHIA trial of Margetuximab-cmkb + chemotherapy versus Trastuzumab + chemotherapy in 536 patients with HER2+ breast cancer who had received two or more prior anti-HER2 regimens, in which the progression-free survival was 5.8 months (95% CI= 5.5-7.0) versus 4.9 months (95% CI:=4.2-5.6) [HR=76 (0.59, 0.98)], and the objective response rate was 22% (95% CI=17-27) versus 16% (95% CI=12-20), respectively (PMID: 33480963)Breast CancerSOLIDBreastNeratinibLEVEL_1LEVEL_Fda2['29146401', '30274983', '26874901', '30860945']Neratinib is a small molecule inhibitor of the ERBB2 and EGFR kinases that is FDA-approved for HER2-positive breast cancer previously treated with adjuvant trastuzumab. FDA approval was based on results from the Phase III ExteNET trial of neratinib in 2,840 patients with HER2-positive breast cancer who had been previously treated with trastuzumab in which the two-year disease-free survival rate was 93.9% (95% CI= 92.4-95.2) in the neratinib group versus 91.0% (95% CI= 89.3-92.5) in the placebo group (HR= 0.63, p=00017) following one year of drug administration (PMID: 26874901). Five-year follow-up of patients from the ExteNET trial demonstrated that the benefit of neratinib treatment continues past the two-year follow-up, with the five-year invasive disease-free survival being 90.2% (95% CI= 88.3-91.8) in the neratinib group versus 87.7% (95% CI= 85.7-89.4) in the placebo group (PMID: 29146401). In vitro studies in mice have demonstrated that sustained ER inhibition can lead to ERBB2 pathway activation, suggesting a mechanism for neratinib utility in this context (PMID: 30274983). Neratinib with the addition of chemotherapy (capecitabine) has been shown to be active in patients with ERBB2-positive breast cancer with brain metastases (PMID: 30860945).Breast CancerSOLIDBreastPembrolizumab + Trastuzumab + ChemotherapyLEVEL_1LEVEL_Fda2['37871604', '34912120']Pembrolizumab is an intravenously administered, anti-PD-1 antibody that is FDA-approved in combination with trastuzumab, fluoropyrimidine- and platinum-containing chemotherapy for the first-line treatment of adults with locally advanced unresectable or metastatic HER2-positive gastric or gastroesophageal junction (GEJ) adenocarcinoma whose tumors express PD-L1 (combined positive score [CPS] 1) as determined by an FDA-approved test. PD-L1 protein expression for treatment with pembrolizumab plus trastuzumab and chemotherapy was detected through the PD-L1 IHC 22C3 pharmDx kit. FDA approval was based on results from the Phase III KEYNOTE-811 (NCT03615326) trial of pembrolizumab plus trastuzumab and chemotherapy versus placebo plus trastuzumab and chemotherapy in patients with HER2-positive (defined as immunohistochemistry [IHC] 3+ or IHC 2+ with positive in-situ hybridization [ISH] or fluorescence in-situ hybridization [FISH]) gastric or GEJ adenocarcinoma. _In the initial analysis of the Phase III KEYNOTE-811 (NCT03615326) trial, the pembrolizumab cohort (n=133) demonstrated an overall response rate (ORR) of 74.4% (95% CI= 66.2-81.6), with fifteen (11.3%) complete responses (CR), 84 (63.2%) partial responses (PR) and 29 (21.8%) stable disease (SD) responses, versus 51.9% (95% CI= 43.0-60.7) in the placebo cohort (n=131), with four (3.1%) CRs, 64 (48.9%) PRs and 49 (37.4%) SD responses (PMID: 34912120). _In the 38-month interim analysis for the Phase III KEYNOTE-811 (NCT03615326) trial, 286 (82%) patients of the pembrolizumab cohort (n=350) and 304 (88%) patients of the placebo cohort (n=346) discontinued treatment due to disease progression (PMID: 37871604). The pembrolizumab group demonstrated a median progression-free survival (PFS) of 10.0 months (95% CI=8.6-12.2) and a median overall survival (OS) of 20.0 months (95% CI=17.8-22.1). The placebo cohort demonstrated a median PFS of 8.1 months (95% CI=7.1-8.6) (HR=0.73 [95% CI=0.61-0.87]) and a median OS of 16.9 months (95% CI=15.0-18.7) (HR=0.84 [95% CI=0.70-1.01]) (PMID: 37871604)._In the final analysis of the Phase III KEYNOTE-811 (NCT03615326) trial of patients with PD-L1 (CPS 1) status, the pembrolizumab cohort (n=298) demonstrated a median PFS of 10.9 months and a median OS of 20.1 months (Abstract: Janjigian et al. Abstract# 1400O, ESMO 2024. https://www.annalsofoncology.org/article/S0923-7534(24)02985-5/fulltext). The placebo cohort (n=296) demonstrated a median PFS of 7.3 months (HR=0.72 [95% CI=0.60-0.87]) and a median OS of 15.7 months (HR=0.79 [95% CI=0.66-0.95]) (Abstract: Janjigian et al. Abstract# 1400O, ESMO 2024. https://www.annalsofoncology.org/article/S0923-7534(24)02985-5/fulltext).Esophagogastric AdenocarcinomaEsophagogastric CancerSOLIDEsophagus/StomachTrastuzumabLEVEL_1LEVEL_Fda2['16236738']Trastuzumab, a humanized, recombinant monoclonal antibody that targets the HER2 receptor, is FDA approved for the adjuvant treatment of HER2-overexpressing breast cancer. FDA approval was based on two Phase III trials (NSABP B31 and NCCTG N9831) of trastuzumab in 3,752 patients with HER2-overexpressing breast cancer in which disease-free survival at four years was 85.3% in the trastuzumab group versus 67.1% in the control group, and overall survival at four years was 91.4% in the trastuzumab group versus 86.6% in the control group (HR=0.48, 95% CI= 0.39-0.59)(PMID: 16236738).Breast CancerSOLIDBreastTrastuzumab DeruxtecanLEVEL_1LEVEL_Fda2['38092229', '31825192']Trastuzumab deruxtecan (T-DXd) is a HER2-directed antibody and topoisomerase inhibitor conjugate that is FDA-approved for patients with unresectable or metastatic HER2-positive (defined as immunohistochemistry (IHC) 3+) breast cancer previously treated with anti-HER2-based regimens in the metastatic setting. FDA approval was based on the results of the Phase II DESTINY-Breast01 (NCT03248492) trial of T-DXd in 184 adult patients with HER2-positive (IHC 3+ or ISH-positive) metastatic breast cancer. __In the Phase II DESTINY-Breast01 (NCT03248492) trial, response to T-DXd was observed in 112 of 184 patients (60.9%) (95% CI=53.4-68.0) and the median progression-free survival (PFS) was 16.4 months (95% CI=12.7-NR) (PMID: 31825192). __In the updated survival results from the Phase II DESTINY-Breast01 (NCT03248492) trial, the overall response rate (ORR) by independent central review was 62.0% (95% CI=54.5-69.0), the median overall survival was 29.1 months (95% CI=24.6-36.1), the median PFS was 19.4 months (95% CI=14.1-25.0) and the median duration of response (DOR) was 18.2 months (95 %CI=15.0-NE) (PMID: 38092229).Breast CancerSOLIDBreastTrastuzumab DeruxtecanLEVEL_1LEVEL_Fda2['32469182', '37329891']Trastuzumab Deruxtecan is a HER2-directed antibody and topoisomerase inhibitor conjugate that is FDA-approved for patients with locally advanced or metastatic HER2-positive gastric or gastroesophageal (GEJ) adenocarcinoma who have received a prior trastuzumab-based regimen. FDA approval was based on the multicenter, open-label, randomized DESTINY-Gastric01 trial of trastuzumab deruxtecan versus irinotecan or paclitaxel in 188 patients with HER2+ locally advanced or metastatic gastric or GEJ adenocarcinoma in which the median overall survival was 12.5 months (95% CI: 9.6-14.3) versus 8.4 months (95% CI= 6.9-10.7)(HR= 0.59 [0.39-0.88], p = 0.0097) and the overall response rate was 40.5% (95% CI= 31.8-49.6) versus 11.3% (95% CI= 4.7-21.9) (PMID: 32469182). In the single-arm, Phase II DESTINY-Gastric02 trial of trastuzumab deruxtecan in 79 patients with HER2-positive unresectable or metastatic gastric or GEJ adenocarcinoma, the objective response rate was 42% (33/79, 95% CI: 30.853.4) with 5% complete response (4/79) and 37% partial response (29/79) (PMID: 37329891).Esophagogastric AdenocarcinomaEsophagogastric CancerSOLIDEsophagus/StomachTrastuzumab Deruxtecan + PertuzumabLEVEL_1LEVEL_Fda2['41160818']Trastuzumab deruxtecan (T-DXd) is a HER2-directed antibody and topoisomerase inhibitor conjugate that is FDA-approved in combination with pertuzumab for the first-line treatment of adult patients with unresectable or metastatic HER2-positive (defined as immunohistochemistry (IHC) 3+ or in situ hybridization (ISH) positive) breast cancer as determined by an FDA-approved test. HER2-positive (IHC3+ or ISH-positive) was detected by the PATHWAY anti-HER-2/neu (4B5) Rabbit Monoclonal Primary Antibody and HER2 Dual ISH DNA Probe Cocktail companion diagnostic devices. FDA approval was based on the results of the Phase III DESTINY-Breast09 (NCT04784715) trial of T-DXd in 1157 adults with HER2-positive (IHC3+ or ISH-positive) advanced or metastatic breast cancer who had not received prior chemotherapy or HER2-targeted therapy or had received neoadjuvant or adjuvant HER2-targeted therapy more than six months before the diagnosis of advanced or metastatic disease. __In the Phase III DESTINY-Breast09 (NCT04784715) trial, the T-DXd plus pertuzumab cohort (n=383) demonstrated an overall response rate (ORR) of 85.1% (95% CI=81.2-88.5), with a complete response (CR) of 15.1% (n=58), partial response (PR) of 70% (n=268), stable disease (SD) rate of 9.9% (n=38) and progressive disease (PD) rate of 3.4% (n=13), the median progression-free survival (PFS) was 40.7 months (95% CI=36.5-NC) and median duration of response (DOR) was 39.2 months (95% CI=35.1-NC) (PMID: 41160818). In the taxane (docetaxel or paclitaxel), trastuzumab and pertuzumab cohort (n=387), the ORR was 78.6% (95% CI=74.1-82.5), with a CR of 8.5% (n=33), PR of 70% (n=271), SD rate of 14.5% (n=56) and PD rate of 3.1% (n=12), the median PFS was 26.9 months (95% CI=21.8-NC) and the median DOR was 26.4 months (95% CI=22.3-NC) (PMID: 41160818).Breast CancerSOLIDBreastTrastuzumab + ChemotherapyLEVEL_1LEVEL_Fda2['20728210']Trastuzumab, a humanized, recombinant monoclonal antibody that targets the HER2 receptor, is FDA-approved in combination with cisplatin and a fluoropyrimidine for the treatment of patients with HER2-overexpressing metastatic gastric or gastroesophageal (GE) junction adenocarcinoma who have not been treated previously for metastatic disease. FDA approval is based on results from the randomized, Phase III ToGA trial in which 584 patients with advanced gastric or GE cancer that was positive for HER2 overexpression received chemotherapy (cisplatin with either capecitabine or 5-fluorouracil, n=290) with or without trastuzumab (n=294) (PMID: 20728210). The inclusion of trastuzumab improved median overall survival (13.8 months vs. 11.1 months, HR=0.74, p=0.0046) compared to chemotherapy alone (PMID: 20728210).Esophagogastric AdenocarcinomaEsophagogastric CancerSOLIDEsophagus/StomachTrastuzumab + Pertuzumab + ChemotherapyLEVEL_1LEVEL_Fda2['28581356', '27179402', '39259927', '23704196', '32171426', '35681574']Pertuzumab and trastuzumab are intravenously administered, humanized monoclonal HER2-targeted antibodies that are FDA-approved in combination with docetaxel as treatment for patients with HER2-positive metastatic breast cancer who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease. Pertuzumab and trastuzumab are also FDA-approved in combination with chemotherapy as neoadjuvant treatment of patients with HER2-positive, locally advanced, inflammatory, or early-stage breast cancer (either greater than 2 cm in diameter or node-positive) as part of a complete treatment regimen for early breast cancer and adjuvant treatment of patients with HER2-positive early breast cancer at high risk of recurrence. HER2-positive status was defined as immunohistochemistry (IHC) 3+ or FISH amplification ratio 2.0 in breast tumor samples. FDA approval for the treatment of HER2-positive metastatic breast cancer was based on results from the Phase III CLEOPATRA (NCT00567190) trial of trastuzumab and pertuzumab plus docetaxel versus placebo and trastuzumab plus docetaxel in 808 patients with HER2-positive metastatic breast cancer (IHC +3 or FISH amplification ratio 2.0). FDA approval for the neoadjuvant and adjuvant treatment of HER2-positive early breast cancer was based on the results of the Phase II NeoSphere (NCT00545688), Phase II TRYPHAENA (NCT00976989), Phase II BERENICE (NCT02132949) and Phase III APHINITY (NCT01358877) trials of pertuzumab and trastuzumab plus chemotherapy. __In the Phase III CLEOPATRA (NCT00567190) trial, the pertuzumab and trastuzumab with docetaxel cohort (n=402) demonstrated an objective response rate (ORR) of 80.2%, with a 5.5% (n=19) complete response (CR) rate and 74.6% (n=256) partial response (PR) rate, a median progression-free survival (PFS) of 18.5 months and a final analysis median overall survival (OS) of 56.5 months (PMID: 32171426). The placebo and trastuzumab with docetaxel cohort (n=406) demonstrated an ORR of 69.3% (ORR difference=10.8% [95% CI=4.2-17.5], p=0.0011), with a 4.2% (n=14) CR rate and 65.2% (n=219) PR rate, a median PFS of 12.4 months (HR=0.62 [95% CI=0.51-0.75], p<0.0001) and a final analysis median OS of 40.8 months (HR=0.68 [95% CI=0.56-0.84], p=0.0002) (PMID: 32171426).__In the Phase II NeoSphere (NCT00545688) trial of neoadjuvant regimens for 417 patients with HER2-positive breast cancer (IHC 3+ or FISH amplification ratio 2.0), the pertuzumab and trastuzumab with docetaxel cohort (n=107) demonstrated an overall pathological CR (pCR) rate of 39.3% (95% CI=30.0-49.2) (PMID: 27179402). The trastuzumab plus docetaxel cohort (n=107), pertuzumab plus trastuzumab cohort (n=107) and pertuzumab plus docetaxel (n=96) demonstrated overall pCR rates of 21.5% (95% CI=14.1-30.5), 11.2% (95% CI=5.9-18.8) and 17.7% (95% CI=10.7-26.8), respectively (PMID: 27179402).__In the Phase II TRYPHAENA (NCT00976989) trial of neoadjuvant regimens for 225 patients with HER2-positive breast cancer (IHC 3+ or FISH amplification ratio 2.0), cohort A (3 cycles of 5-fluorouracil, epirubicin and cyclophosphamide [FEC] followed by 3 cycles of docetaxel, all in combination with pertuzumab and trastuzumab, n=72), cohort B (3 cycles of FEC alone followed by 3 cycles of docetaxel and trastuzumab in combination with pertuzumab, n=75) and cohort C (6 cycles of docetaxel, carboplatin and trastuzumab in combination with pertuzumab, n=76) demonstrated pCR rates of 56.2% (95% CI=44.1-67.8), 54.7% (95% CI=42.7-66.2) and 63.6% (95% CI=51.9-74.3), respectively (PMID: 23704196). __In the Phase II BERENICE (NCT02132949) trial of neoadjuvant regimens for 401 patients with locally advanced, inflammatory or early-stage HER2-positive breast cancer (IHC 3+ or ISH amplification ratio 2.0), cohort A (4 cycles of pertuzumab in combination with trastuzumab and weekly paclitaxel for 12 weeks) and cohort B (12 weeks or 4 cycles of FEC followed by 4 cycles of pertuzumab in combination with trastuzumab and docetaxel) demonstrated pCR rates of 61.8% (95% CI=54.7-68.6) and 60.7% (95% CI=53.6-67.5), respectively (PMID: 35681574).__In the Phase III APHINITY (NCT01358877) trial of pertuzumab and trastuzumab plus chemotherapy versus placebo and trastuzumab plus chemotherapy to standard adjuvant chemotherapy in 4804 patients with HER2-positive early breast cancer who had their primary tumor excised, the pertuzumab cohort (n=2400) demonstrated an invasive disease-free survival (IDFS) of 7.1%, a disease-free survival (DFS) of 8.0% and an OS of 3.3% (PMID: 28581356). The placebo cohort (n=2404) demonstrated an IDFS of 8.7% (HR=0.82 [95% CI=0.67-1.00], p=0.047), a DFS of 9.8% (HR=0.82 [95% CI=0.68-0.99]) and an OS of 3.7% (HR=0.89 [95% CI=0.66-1.21]) (PMID: 28581356). In the third interim analysis, the 8-year OS and IDFS were 92.7% and 86.1% in the pertuzumab cohort versus 92.0% (HR=0.83 [95% CI=0.68-1.02, p=0.078) and 81.2% (HR=0.72 [95% CI=0.60-0.87]) in the placebo cohort, respectively (PMID: 39259927).Breast CancerSOLIDBreastTrastuzumab + Tucatinib + CapecitabineLEVEL_1LEVEL_Fda2['31825569']Tucatinib is a small molecule inhibitor of HER2 that is FDA-approved in combination with trastuzumab and capecitabine for the treatment of adult patients with advanced, pretreated HER2-positive breast cancer that cant be removed with surgery or has spread to other parts of the body. FDA approval was based on the results of the Phase II HER2CLIMB trial of tucatinib plus trastuzumab and capecitabine versus trastuzumab and capecitabine plus placebo in 612 patients with HER2-positive metastatic breast cancer who were pretreated with trastuzumab, pertuzumab, and trastuzumab emtansine in which one-year progression-free survival was 33.1% in the tucatinib combination group and 12.3% in the placebo combination group (HR, 0.54, 95% CI, 0.42 to 0.71, P<0.001), the median overall survival was 21.9 months and 17.4 months, respectively (PMID: 31825569). Of the 291 patients with brain metastases, the median progression-free survival in the tucatinib group versus the placebo group was 7.6 months (95% CI= 6.2 to 9.5) versus 5.4 months (95% CI= 4.1 to 5.7), respectively (PMID: 31825569). Updated results from the Phase II HER2CLIMB trial showed that after a median follow-up of 29.6 months, the median overall survival was 21.6 months (95% CI=18.1-28.5) in the tucatinib combination group versus 12.5 months (95% CI= 11.2-16.9) in the trastuzumab and capecitabine-combination group in patients with active and stable brain metastases (n=291) (Abstract: Curigliano et al. Abstract# 1043, ASCO 2021. https://ascopubs.org/doi/abs/10.1200/JCO.2021.39.15_suppl.1043).Breast CancerSOLIDBreastTucatinib + TrastuzumabLEVEL_1LEVEL_Fda2['37142372']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. In the open-label MOUNTAINEER Phase II trial of tucatinib and trastuzumab, 84 metastatic colorectal cancer patients with RAS wildtype, HER2 amplification received combination treatment and 30 patients received tucatinib monotherapy (PMID: 37142372). In the combination therapy cohort, the objective response rate was 38.1% (95% CI, 27.7%-49.3%), with three patients (4%) reported to have a complete response and 29 patients (35%) reported to have a partial response. The median duration of response was 12.4 months (95% CI, 8.3-25.5), the median progression-free survival was 8.2 months (95% CI, 4.2-10.3), and the median overall survival was 24.1 months (95% CI, 20.3-36.7) (PMID: 37142372). In the tucatinib monotherapy cohort the objective response rate was 3.3% (95% CI, 0.1%-17.2%), with one patient reported to have a partial response. Twenty-eight of the 30 patients (93%) in the tucatinib monotherapy cohort crossed over to receive combination tucatinib and trastuzumab therapy and achieved an objective response rate of 17.9% (95% CI, 6.1-36.9%) with a median overall survival of 21.1 months (95% CI 18.6not estimable) (PMID: 37142372).Colorectal CancerSOLIDBowelLapatinib + LetrozoleLEVEL_1LEVEL_Fda2['19786658', '17192538']Lapatinib is an oral, ATP-competitive, reversible tyrosine kinase inhibitor that targets both EGFR and ERBB2 and is FDA-approved in combination with capecitabine for patients with advanced or metastatic ERBB2-overexpressing breast cancer who had received prior therapy with an anthracycline, a taxane or trastuzumab. FDA approval was based on results from a randomized, Phase III trial in which eligible patients treated with lapatinib and capecitabine had a shorter time-to-progression (TTP) (8.4 months vs. 4.4, hazard ratio, 0.47, p<0.001) compared to patients that received capecitabine alone (PMID: 17192538). Lapatinib is also FDA-approved in combination with letrozole for the treatment of metastatic, postmenopausal breast cancer that is both ERBB2-positive and hormone receptor-positive. FDA approval in this context was based on evidence from the EGF30008 trial in which eligible patients treated with lapatinib plus letrozole showed a significantly improved progression-free survival (PFS) (median PFS, 8.2 vs. 3.0 months) compared to patients treated with letrozole plus placebo (PMID: 19786658). Treatment with lapatinib also significantly improved clinical benefit rates (CBR) (48% with letrozole-lapatinib vs. 29% with letrozole alone) and was associated with a trend toward improvement in overall survival (OS) (PMID: 19786658).Breast CancerSOLIDBreastNeratinib + CapecitabineLEVEL_1LEVEL_Fda2['29146401', '30274983', '26874901', '30860945']Neratinib is a small molecule inhibitor of the ERBB2 and EGFR kinases that is FDA-approved for HER2-positive breast cancer previously treated with adjuvant trastuzumab. FDA approval was based on results from the Phase III ExteNET trial of neratinib in 2,840 patients with HER2-positive breast cancer who had been previously treated with trastuzumab in which the two-year disease-free survival rate was 93.9% (95% CI= 92.4-95.2) in the neratinib group versus 91.0% (95% CI= 89.3-92.5) in the placebo group (HR= 0.63, p=00017) following one year of drug administration (PMID: 26874901). Five-year follow-up of patients from the ExteNET trial demonstrated that the benefit of neratinib treatment continues past the two-year follow-up, with the five-year invasive disease-free survival being 90.2% (95% CI= 88.3-91.8) in the neratinib group versus 87.7% (95% CI= 85.7-89.4) in the placebo group (PMID: 29146401). In vitro studies in mice have demonstrated that sustained ER inhibition can lead to ERBB2 pathway activation, suggesting a mechanism for neratinib utility in this context (PMID: 30274983). Neratinib with the addition of chemotherapy (capecitabine) has been shown to be active in patients with ERBB2-positive breast cancer with brain metastases (PMID: 30860945).Breast CancerSOLIDBreastTrastuzumab + ChemotherapyLEVEL_1LEVEL_Fda2['16236738']Trastuzumab, a humanized, recombinant monoclonal antibody that targets the HER2 receptor, is FDA approved for the adjuvant treatment of HER2-overexpressing breast cancer. FDA approval was based on two Phase III trials (NSABP B31 and NCCTG N9831) of trastuzumab in 3,752 patients with HER2-overexpressing breast cancer in which disease-free survival at four years was 85.3% in the trastuzumab group versus 67.1% in the control group, and overall survival at four years was 91.4% in the trastuzumab group versus 86.6% in the control group (HR=0.48, 95% CI= 0.39-0.59)(PMID: 16236738).Breast CancerSOLIDBreastAdo-Trastuzumab EmtansineLEVEL_2LEVEL_Fda2['31504139']Ado-trastuzumab emtansine (T-DM1) is an intravenously infused, HER2-targeted antibody and microtubule inhibitory conjugate that is FDA-approved for the treatment of patients with HER2-positive metastatic breast cancer who previously received trastuzumab and a taxane, separately or in combination. The NCCN Head and Neck Cancer Guidelines (V3.2024) lists trastuzumab, trastuzumab plus docetaxel, T-DM1, trastuzumab deruxtecan and trastuzumab plus pertuzumab as HER2-targeted therapies for the treatment of patients with HER2-positive (defined as immunohistochemistry [IHC] 3+) salivary gland cancer. In the Phase II (NCT02675829) trial of T-DM1 in patients with HER2-positive (defined as ERBB2 copy number >7) solid tumors (n=15, patients with salivary gland cancer), the salivary gland cancer cohort demonstrated an objective response rate of 87% (n=13), with a 53.3% (n=8) complete response (CR) rate and 33.3% (n=5) partial response (PR) rate (Abstract: Liu, D. et al. Abstract# 3025, JCO 2023. https://ascopubs.org/doi/10.1200/JCO.2023.41.16_suppl.3025). In the Phase II NCI-MATCH (NCT02465060) trial of T-DM1 in patients with HER2-positive (IHC 3+ or HER2/CEP17 2 by FISH) tumors (n=3, patients with salivary gland cancer), the salivary gland cancer cohort achieved a PR in two patients (PMID: 31504139).Salivary Gland CancerSOLIDHead and NeckLapatinib + TrastuzumabLEVEL_2LEVEL_Fda2['27108243']Trastuzumab, a humanized, recombinant monoclonal antibody that targets the HER2 receptor, and lapatinib, a small molecule tyrosine kinase inhibitor of HER2/EGFR, are NCCN-compendium listed in combination for the treatment of patients with ERBB2-amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Results from the multicenter Phase II HERACLES trial in which 27 patients with previously treated HER2+, KRAS wildtype tumors were treated with trastuzumab plus lapatinib demonstrated an overall response rate of 30% (95% CI= 14-50), which included one patient with complete response (4%), seven patients with partial responses (26%) and twelve patients with stable disease (44%) (PMID: 27108243).Colorectal CancerSOLIDBowelTrastuzumabLEVEL_2LEVEL_Fda2['28006087', '30452336']Trastuzumab is an intravenously infused, anti-HER2 monoclonal antibody that is FDA-approved as a single agent and in combination with docetaxel for the treatment of patients with HER2-overexpressing breast cancer. The NCCN Head and Neck Cancer Guidelines (V3.2024) lists trastuzumab, trastuzumab plus docetaxel, ado-trastuzumab emtansine, trastuzumab deruxtecan and trastuzumab plus pertuzumab as HER2 targeted therapies for the treatment of patients with HER2-positive (defined as immunohistochemistry [IHC] 3+) salivary gland cancer. In a case report of two patients with HER2-positive salivary gland cancer treated with trastuzumab monotherapy, one patient with HER2-positive (IHC 3+) salivary duct carcinoma achieved a complete response (CR) and one patient with HER2-amplified (FISH amplification ratio 5.6) carcinoma ex pleomorphic adenoma demonstrated disease control for over 21 months (PMID: 28006087). In a pooled analysis of a Phase II trial of trastuzumab plus docetaxel in 57 patients with HER2-positive (IHC 3+) advanced salivary duct carcinoma, the overall response rate was 70.2% (95% CI=56.6-81.6), with a 14% (n=8) CR rate and 56.1% (n=32) partial response rate, and the median progression-free survival was 8.9 months (95% CI=7.8-9.9) (PMID: 30452336).Salivary Gland CancerSOLIDHead and NeckTrastuzumab DeruxtecanLEVEL_2LEVEL_Fda2['33961795']Trastuzumab Deruxtecan is a HER2-directed antibody and topoisomerase inhibitor conjugate that is FDA-approved for patients with HER2-positive breast and gastric cancer. The NCCN (Colorectal Cancer, v2.2021) lists trastuzumab deruxtecan as a category 2A recommendation for patients with ERBB2-amplified colorectal cancer. In a Phase II study of trastuzumab deruxtecan in 53 patients with HER2-expressing (IHC 3+) colorectal cancer, the overall response rate was 45.3% (95% CI=31.6%-59.6%) with one patient having a complete response and 23 patients having partial responses (Abstract: Siena et al. Abstract# 4000, ASCO 2020. https://ascopubs.org/doi/abs/10.1200/JCO.2020.38.15_suppl.4000). In an open-label, phase II study (DESTINY-CRC01, NCT03384940) of trastuzumab deruxtecan in 53 evaluable patients with HER2-expressing metastatic colorectal cancer that had progressed on two or more previous regimens, the objective response rate was 45.3% (95% CI=316596), with one (2%) patient achieving a complete response, 23 (43%) achieving a partial response, twenty (38%) achieving stable disease, and five (9%) exhibiting disease progression (PMID: 33961795).Colorectal CancerSOLIDBowelTrastuzumab DeruxtecanLEVEL_2LEVEL_Fda2['38231777']Trastuzumab deruxtecan (T-DXd) is an intravenously infused, HER2-targeted antibody and topoisomerase inhibitor conjugate that is FDA-approved for the treatment of adult patients with unresectable or metastatic HER2-positive breast cancer previously treated with anti-HER2-based regimens in the metastatic setting. The NCCN Head and Neck Cancer Guidelines (V3.2024) lists trastuzumab, trastuzumab plus docetaxel, ado-trastuzumab emtansine, T-DXd and trastuzumab plus pertuzumab as HER2 targeted therapies for the treatment of patients with HER2-positive (defined as immunohistochemistry (IHC) 3+) salivary gland cancer. In a pooled analysis from the results of the Phase I first-in-human study (NCT02564900) and the Phase I drug-drug interaction (NCT03383692) trials of T-DXd in seventeen patients with HER2-positive (IHC 1+/in situ hybridization [ISH]+) salivary gland cancer, the overall response rate was 58.8% (95% CI=32.9-81.6), with ten patients achieving a partial response and a median progression-free survival of 20.5 months (95% CI=11.1-NE) (PMID: 38231777).Salivary Gland CancerSOLIDHead and NeckTrastuzumab + Carboplatin-Taxol RegimenLEVEL_2LEVEL_Fda2['29584549']Trastuzumab, a humanized, recombinant monoclonal antibody that targets the HER2 receptor, is FDA approved for the adjuvant treatment of ERBB2-overexpressing breast cancer. Trastuzumab plus carboplatin-paclitaxel is listed in the NCCN as a category 2A therapeutic for ERBB2-amplified uterine cancer. In a phase II trial of carboplatin-paclitaxel with or without trastuzumab in 58 patients with ERBB2-overexpressing uterine serous carcinoma, overall progression-free survival was 12.6 months versus 8 months with the addition of paclitaxel, with the largest benefit seen in patients with stage III/IV advanced disease (17.9 months versus 9.3 months, p=0.013, HR=0.4 (90% CI 0.2-0.8)) (PMID: 29584549).Uterine Serous Carcinoma/Uterine Papillary Serous CarcinomaEndometrial CancerSOLIDUterusTrastuzumab + PertuzumabLEVEL_2LEVEL_Fda2['34339623']Trastuzumab and pertuzumab, both HER2-targeted antibodies, are NCCN-compendium listed in combination for the treatment of patients with HER2-positive biliary tract cancers. In the multicenter, open-label, Phase IIa MyPathway multiple basket study of trastuzumab and pertuzumab in patients with previously treated HER2-amplified and/or HER2 overexpression metastatic biliary tract cancer (n=39), the objective response rate was 23% (95% CI, 11-39%) with nine patients achieving partial response and eleven patients demonstrating stable disease (PMID: 34339623).Biliary TractBiliary Tract CancerSOLIDBiliary TractTrastuzumab + PertuzumabLEVEL_2LEVEL_Fda2['34339623']Trastuzumab and pertuzumab, both HER2-targeted antibodies, are NCCN-compendium listed in combination for the treatment of patients with HER2-positive biliary tract cancers. In the multicenter, open-label, Phase IIa MyPathway multiple basket study of trastuzumab and pertuzumab in patients with previously treated HER2-amplified and/or HER2 overexpression metastatic biliary tract cancer (n=39), the objective response rate was 23% (95% CI, 11-39%) with nine patients achieving partial response and eleven patients demonstrating stable disease (PMID: 34339623).Hepatobiliary CancerSOLIDMIXEDTrastuzumab + PertuzumabLEVEL_2LEVEL_Fda2['37793085', '36315917', '30857956']Trastuzumab and pertuzumab, both HER2-targeted antibodies, are NCCN-compendium listed in combination for the treatment of patients with HER2-amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Results from the MyPathway Phase IIa multiple basket study in which patients with previously treated HER2-amplified metastatic colorectal cancer were treated with trastuzumab plus pertuzumab demonstrated an overall response rate of 40% (95% CI= 25-56) in patients with wildtype KRAS (n=43), with a median progression-free survival of 5.3 months (95% CI= 2.7-6.1) and a median overall survival of 14.0 months (95% CI= 8.0-NE) (PMID: 30857956). Updated data from the MyPathway study in 69 patients with HER2-amplified colorectal cancer demonstrate an objective response rate of 31.9%, with one patient demonstrating a complete response (PMID: 37793085). In the Phase II TAPUR Study basket trial of trastuzumab plus pertuzumab in 28 patients with HER2-amplified advanced tumors, the overall response rate was 25%, with a median progression-free survival of 17.2 weeks (95% CI= 11.1-27.4) and a median overall survival of 60.0 weeks (95% CI= 32.1-102.3) (PMID: 36315917).Colorectal CancerSOLIDBowelTrastuzumab + PertuzumabLEVEL_2LEVEL_Fda2['32067683']Trastuzumab and pertuzumab are intravenously infused, anti-HER2 monoclonal antibodies that are FDA-approved in combination for the treatment of patients with HER2-positive metastatic breast cancer who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease. The NCCN Head and Neck Cancer Guidelines (V3.2024) lists trastuzumab, trastuzumab plus docetaxel, ado-trastuzumab emtansine, trastuzumab deruxtecan and trastuzumab plus pertuzumab as HER2 targeted therapies for the treatment of patients with HER2-positive salivary gland cancer. In the Phase IIa MyPathway _(NCT02091141) trial of trastuzumab plus pertuzumab in fifteen patients with HER2 amplification-positive (HER2/CEP17 ratio > 2.0 or NGS determined copy number gain) and/or overexpression (IHC 3+)-positive salivary gland cancer, the objective response rate was 60% (95% CI=32-84), with a 6.7% (n=1) complete response rate and 53.3% (n=8) partial response rate, with a median progression-free survival of 8.6 months (95% CI=2.3-NE) and a median overall survival of 20.4 months (95% CI=8.2-NE) (PMID: 32067683).Salivary Gland CancerSOLIDHead and NeckTrastuzumab + PertuzumabLEVEL_2LEVEL_Fda2['30857956']Trastuzumab and pertuzumab are intravenously infused, anti-HER2 monoclonal antibodies that are FDA-approved in combination for the treatment of patients with HER2-positive metastatic breast cancer who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease. The NCCN Small Bowel Adenocarcinoma Guidelines (V1.2026) lists trastuzumab plus pertuzumab and trastuzumab plus tucatinib as HER2 targeted therapies for the treatment of patients with RAS and BRAF wildtype, HER2 overexpressed/amplified small bowel adenocarcinoma. NCCN recommendation is based on the results of the Phase IIA MyPathway (NCT02091141) trial of trastuzumab plus pertuzumab in 57 patients with HER2-positive metastatic colorectal cancer (HER2 amplification/no overexpression, n=8, HER2 amplification/unknown overexpression, n=22, HER2 amplification+overexpression, n=27). HER2 positive status was defined as FISH/CISH amplification ratio >2.0 or HER2 copy number >6.0, HER2 amplification based on next-generation sequencing and/or immunohistochemistry (IHC) 3+ in patient tissue samples._In the Phase IIA MyPathway (NCT02091141) trial, the overall response rate was 32% (95% CI=20-45), the clinical benefit rate was 44% (95% CI=31-58), the median duration of response was 5.9 months (95% CI=2.8-11.1), the median progression-free survival was 2.9 months (95% CI=1.4-5.3) and the median overall survival was 11.5 months (95% CI=7.7-NE) (PMID: 30857956).Small Bowel CancerSOLIDBowelTrastuzumab + TucatinibLEVEL_2LEVEL_Fda2['41526345']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. The NCCN Small Bowel Adenocarcinoma Guidelines (V1.2026) lists trastuzumab plus pertuzumab and trastuzumab plus tucatinib as HER2 targeted therapies for the treatment of patients with RAS and BRAF wildtype, HER2 overexpressed/amplified small bowel adenocarcinoma. NCCN recommendation is based on the results of the Phase II MOUNTAINEER (NCT03043313) trial of trastuzumab plus tucatinib in patients with RAS wildtype, HER2-positive or HER2-negative unresectable or metastatic colorectal cancer. HER2 positive status was defined as immunohistochemistry (IHC) 3+ or IHC 2+ with FISH amplification while HER2 negative status was defined as IHC 0, IHC 1 or IHC 2+ without FISH amplification in patient tissue samples._In the Phase II MOUNTAINEER (NCT03043313) trial, the HER2 positive cohort (n=60) demonstrated a median progression-free survival (PFS) of 10.1 months (95% CI=4.1-14.5), a median duration of response (DOR) of 16.6 months (95% CI=11.4-25.5) and a confirmed overall response rate (cORR) of 41.7% (95% CI=29.1-55.1), with five complete responses (CR), twenty partial responses (PR), twenty one cases of stable disease (SD) and thirteen cases of progressive disease (PD) (PMID: 41526345). In the HER2 negative cohort (n=10), the median PFS was 2.8 months (95% CI=1.2-6.3) and the cORR was 10.0% (95% CI=0.3-44.5), with one PR, four cases of SD and five cases of PD (PMID: 41526345).Small Bowel CancerSOLIDBowelTucatinib + TrastuzumabLEVEL_2LEVEL_Fda2['37751561']Tucatinib, a small molecule HER2-targeted kinase inhibitor, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of adult patients with RAS wild-type HER2-positive unresectable or metastatic colorectal cancer that has progressed following treatment with fluoropyrimidine-, oxaliplatin- and irinotecan-based chemotherapy. The NCCN Biliary Tract Cancers Guidelines (V2.2024) lists tucatinib plus trastuzumab under "Subsequent-Line Therapy for Biliary Tract Cancers if Disease Progression" for patients with HER2-positive biliary tract cancer. NCCN recommendation was based on the results of the Phase II SGNTUC-019 (NCT04579380) trial of tucatinib plus trastuzumab in 30 patients with HER2-positive metastatic biliary tract cancer. In the Phase II SGNTUC-019 (NCT04579380) trial, the confirmed overall response rate was 46.7% (14/30) (90% CI=30.8-63.0), with a 3.3% (1/30) complete response rate, 43.3% (13/30) partial response rate and 30% (9/30) stable disease rate, the median progression-free survival was 5.5 months (90% CI=3.9-8.1) and the median overall survival was 15.5 months (90% CI=6.5-16.7) (PMID: 37751561).Biliary TractBiliary Tract CancerSOLIDBiliary TractTucatinib + TrastuzumabLEVEL_2LEVEL_Fda2['37751561']Tucatinib, a small molecule HER2-targeted kinase inhibitor, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of adult patients with RAS wild-type HER2-positive unresectable or metastatic colorectal cancer that has progressed following treatment with fluoropyrimidine-, oxaliplatin- and irinotecan-based chemotherapy. The NCCN Biliary Tract Cancers Guidelines (V2.2024) lists tucatinib plus trastuzumab under "Subsequent-Line Therapy for Biliary Tract Cancers if Disease Progression" for patients with HER2-positive biliary tract cancer. NCCN recommendation was based on the results of the Phase II SGNTUC-019 (NCT04579380) trial of tucatinib plus trastuzumab in 30 patients with HER2-positive metastatic biliary tract cancer. In the Phase II SGNTUC-019 (NCT04579380) trial, the confirmed overall response rate was 46.7% (14/30) (90% CI=30.8-63.0), with a 3.3% (1/30) complete response rate, 43.3% (13/30) partial response rate and 30% (9/30) stable disease rate, the median progression-free survival was 5.5 months (90% CI=3.9-8.1) and the median overall survival was 15.5 months (90% CI=6.5-16.7) (PMID: 37751561).Hepatobiliary CancerSOLIDMIXEDTrastuzumab + DocetaxelLEVEL_2LEVEL_Fda2['28006087', '30452336']Trastuzumab is an intravenously infused, anti-HER2 monoclonal antibody that is FDA-approved as a single agent and in combination with docetaxel for the treatment of patients with HER2-overexpressing breast cancer. The NCCN Head and Neck Cancer Guidelines (V3.2024) lists trastuzumab, trastuzumab plus docetaxel, ado-trastuzumab emtansine, trastuzumab deruxtecan and trastuzumab plus pertuzumab as HER2 targeted therapies for the treatment of patients with HER2-positive (defined as immunohistochemistry [IHC] 3+) salivary gland cancer. In a case report of two patients with HER2-positive salivary gland cancer treated with trastuzumab monotherapy, one patient with HER2-positive (IHC 3+) salivary duct carcinoma achieved a complete response (CR) and one patient with HER2-amplified (FISH amplification ratio 5.6) carcinoma ex pleomorphic adenoma demonstrated disease control for over 21 months (PMID: 28006087). In a pooled analysis of a Phase II trial of trastuzumab plus docetaxel in 57 patients with HER2-positive (IHC 3+) advanced salivary duct carcinoma, the overall response rate was 70.2% (95% CI=56.6-81.6), with a 14% (n=8) CR rate and 56.1% (n=32) partial response rate, and the median progression-free survival was 8.9 months (95% CI=7.8-9.9) (PMID: 30452336).Salivary Gland CancerSOLIDHead and NeckTrastuzumab DeruxtecanLEVEL_3ALEVEL_Fda3['37286557', '39102634', '37870536', '38547891']Trastuzumab deruxtecan (T-DXd) is an intravenously infused, HER2-targeted antibody and topoisomerase inhibitor conjugate that is FDA-approved for the treatment of adult patients with unresectable or metastatic HER2-positive (defined as immunohistochemistry (IHC) 3+) solid tumors who have received prior systemic treatment and have no satisfactory alternative treatment options. FDA approval was based on the results of the Phase II DESTINY-PanTumor02 (NCT04482309), DESTINY-Lung01 (NCT03505710) and DESTINY-CRC02 (NCT04744831) trials of T-DXd in patients with HER2-positive (defined by IHC 3+) solid tumors. Since the correlation between ERBB2 amplification and HER2 expression has yet to be defined in many solid tumor types and this FDA approval directly specifies HER2-positivity (IHC 3+) as the patient selection criteria, ERBB2 amplification is considered a Level 3A biomarker for this specific indication. In the Phase II DESTINY-PanTumor02 (NCT04482309) trial of T-DXd in 111 patients with HER2-expressing (IHC 3+/2+ by local or central testing) solid tumors, the overall response rate (ORR) was 51.4% (95% CI=41.7-61.0), with a 2.7% complete response (CR) rate and 48.6% partial response (PR) rate, and the median duration of response (DOR) was 19.4 months (range 1.3 months to 27.9+ months) (PMID: 37870536). In the Phase II DESTINY-Lung01 (NCT03505710) trial of T-DXd in seventeen patients with HER2-overexpressing (IHC 3+/2+) non-small cell lung cancer, the ORR was 52.9% (95% CI=27.8-77.0), with a 5.9% CR rate and 47.1% PR rate, and the median DOR was 6.9 months (range 4.0 months to 11.7+ months) (PMID: 38547891). In the Phase II DESTINY-CRC02 (NCT04744831) trial of T-DXd in 64 patients with HER2-expressing (IHC 3+, IHC 2+/in situ hybridization [ISH]+ or IHC 2+/ISH-) metastatic colorectal cancer, the ORR was 46.9% (95% CI=34.3-59.8), with a 46.9% PR rate, and the median DOR was 5.5 months (range 1.3+ months to 9.7+ months) (PMID: 37286557). In the Phase II HERB trial of T-DXd in 22 patients with HER2-positive (IHC3+ or IHC2+/ISH+) biliary tract cancer, the ORR was 36.4% (95% CI=17.2-59.3), with a 9.1% (n=2) CR rate, 27.3% (n=6) PR rate and 45.5% (n=10) SD rate (PMID: 39102634).All Solid TumorsSOLIDZanidatamabLEVEL_3ALEVEL_Fda3['37276871', '41264278']Zanidatamab is an intravenously infused, bispecific HER2-directed antibody that is FDA-approved for the treatment of adults with previously treated, unresectable or metastatic HER2-positive (defined as immunohistochemistry (IHC) 3+) biliary tract cancer (BTC), as detected by an FDA-approved test. HER2 expression in BTC for treatment with zanidatamab was detected by the VENTANA PATHWAY anti-HER-2/neu (4B5) Rabbit Monoclonal Primary Antibody companion diagnostic device. Since the correlation between ERBB2 amplification and HER2 expression has yet to be defined in many solid tumor types and this FDA approval directly specifies HER2-positivity (IHC 3+) as the patient selection criteria, ERBB2 amplification is considered a Level 3A biomarker for this specific indication. FDA approval was based on the results of the Phase II HERIZON-BTC-01 (NCT04466891) trial of zanidatamab in patients with HER2-positive (IHC 2+ or 3+ by central assessment) unresectable, locally advanced, or metastatic BTC. _In the Phase II HERIZON-BTC-01 (NCT04466891) trial, the HER2-positive cohort (n=80 [n=62, IHC 3+, n=18, IHC2+]) demonstrated an overall response rate (ORR) of 41.3% (95% CI=30.4-52.8), with a 1% (n=1) complete response (CR) rate and a 40% (n=32) partial response (PR) rate, a median duration of response (DOR) of 12.9 months (95% CI=6.0-NE) and a median progression-free survival of 5.5 months (95% CI=3.7-7.2) (PMID: 37276871). _In the final results of the Phase II HERIZON-BTC-01 (NCT04466891) trial, the overall cohort (n=80) demonstrated an ORR of 41% (95% CI=30-53), with a 4% (n=3) CR rate, 38% (n=30) PR rate and 28% (n=22) stable disease (SD) rate, a median DOR of 14.9 months (95% CI=7.4-24.0) and a median PFS of 5.5 months (95% CI=3.7-7.3) (PMID: 41264278). Of the IHC 3+ cohort (n=62), the ORR was 52% (95% CI=39-65), with a 5% (n=3) CR rate, 47% (n=29) PR rate and 27% (n=17) SD rate, the median DOR was 14.9 months (95% CI=7.4-24.0) and the median PFS was 7.2 months (95% CI=5.4-9.4) (PMID: 41264278). Of the IHC 2+ cohort (n=18), the ORR was 6% (95% CI=1-27), with a 6% (n=1) PR rate and 28% (n=5) SD rate, the median DOR was not evaluable and the median PFS was 1.7 months (95% CI=1.1-3.3) (PMID: 41264278).Biliary TractBiliary Tract CancerSOLIDBiliary TractZanidatamabLEVEL_3ALEVEL_Fda3['37276871', '41264278']Zanidatamab is an intravenously infused, bispecific HER2-directed antibody that is FDA-approved for the treatment of adults with previously treated, unresectable or metastatic HER2-positive (defined as immunohistochemistry (IHC) 3+) biliary tract cancer (BTC), as detected by an FDA-approved test. HER2 expression in BTC for treatment with zanidatamab was detected by the VENTANA PATHWAY anti-HER-2/neu (4B5) Rabbit Monoclonal Primary Antibody companion diagnostic device. Since the correlation between ERBB2 amplification and HER2 expression has yet to be defined in many solid tumor types and this FDA approval directly specifies HER2-positivity (IHC 3+) as the patient selection criteria, ERBB2 amplification is considered a Level 3A biomarker for this specific indication. FDA approval was based on the results of the Phase II HERIZON-BTC-01 (NCT04466891) trial of zanidatamab in patients with HER2-positive (IHC 2+ or 3+ by central assessment) unresectable, locally advanced, or metastatic BTC. _In the Phase II HERIZON-BTC-01 (NCT04466891) trial, the HER2-positive cohort (n=80 [n=62, IHC 3+, n=18, IHC2+]) demonstrated an overall response rate (ORR) of 41.3% (95% CI=30.4-52.8), with a 1% (n=1) complete response (CR) rate and a 40% (n=32) partial response (PR) rate, a median duration of response (DOR) of 12.9 months (95% CI=6.0-NE) and a median progression-free survival of 5.5 months (95% CI=3.7-7.2) (PMID: 37276871). _In the final results of the Phase II HERIZON-BTC-01 (NCT04466891) trial, the overall cohort (n=80) demonstrated an ORR of 41% (95% CI=30-53), with a 4% (n=3) CR rate, 38% (n=30) PR rate and 28% (n=22) stable disease (SD) rate, a median DOR of 14.9 months (95% CI=7.4-24.0) and a median PFS of 5.5 months (95% CI=3.7-7.3) (PMID: 41264278). Of the IHC 3+ cohort (n=62), the ORR was 52% (95% CI=39-65), with a 5% (n=3) CR rate, 47% (n=29) PR rate and 27% (n=17) SD rate, the median DOR was 14.9 months (95% CI=7.4-24.0) and the median PFS was 7.2 months (95% CI=5.4-9.4) (PMID: 41264278). Of the IHC 2+ cohort (n=18), the ORR was 6% (95% CI=1-27), with a 6% (n=1) PR rate and 28% (n=5) SD rate, the median DOR was not evaluable and the median PFS was 1.7 months (95% CI=1.1-3.3) (PMID: 41264278).Hepatobiliary CancerSOLIDMIXED30659304;12124352;2885917;10716706;23204226;1157164325,1810,8
TUMORp.S310FENSP00000269571.4:p.Ser310Phechr1739711955CTPASSNM_004448missense_variantMODERATEERBB28/27c.929C>Trs1057519816&COSV54062198&COSV54062802SNVdeleterious(0)probably_damaging(0.984)0.000.000.000.000.5335.1800e-01NC_000017.11:g.39711955C>TOncogeniccriteria_provided&_single_submitter2ERBB2S310F/YCOSM94225✓ Hotspotv7.0.LEVEL_Fda2✓ Hotspot09/11/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicTrastuzumab DeruxtecanAdo-Trastuzumab Emtansine,Neratinib,Neratinib+Trastuzumab+Fulvestrant,ZongertinibNeratinib,Sevabertinib,Trastuzumab+Pertuzumab+DocetaxelLEVEL_1LEVEL_172,580/1S310F/Y0.4461538461538462GRCh38ERBB2CCT39711955ERBB2_S310F.GT:AD:AF:DP0/1:72,58:0.44:130TENSG00000141736TranscriptENST00000269571protein_coding1104929310S/FtCc/tTc1HGNCHGNC:3430YESMANE_SelectNM_004448.41P1CCDS32642.1ENSP00000269571P04626.275X5DNK3.71UPI000003F55FP04626-1Ensembl1PDB-ENSP_mappings:1n8z.C&PDB-ENSP_mappings:1s78.A&PDB-ENSP_mappings:1s78.B&Gene3D:2.10.220.10&PDB-ENSP_mappings:2a91.A&PDB-ENSP_mappings:3be1.A&PDB-ENSP_mappings:3mzw.A&PDB-ENSP_mappings:3n85.A&PDB-ENSP_mappings:3wlw.A&PDB-ENSP_mappings:3wlw.B&PDB-ENSP_mappings:3wsq.A&PDB-ENSP_mappings:5k33.C&PDB-ENSP_mappings:5kwg.C&PDB-ENSP_mappings:5my6.A&PDB-ENSP_mappings:5o4g.C&PDB-ENSP_mappings:6att.A&PDB-ENSP_mappings:6bgt.C&PDB-ENSP_mappings:6j71.A&PDB-ENSP_mappings:6oge.A&PDB-ENSP_mappings:7mn5.B&PDB-ENSP_mappings:7mn6.B&PDB-ENSP_mappings:7mn8.B&PDB-ENSP_mappings:7qvk.AAA&PDB-ENSP_mappings:8ffj.X&PDB-ENSP_mappings:8hgo.B&PDB-ENSP_mappings:8hgp.B&PDB-ENSP_mappings:8pwh.E&PDB-ENSP_mappings:8q6j.E&PDB-ENSP_mappings:8u4k.B&PDB-ENSP_mappings:8u4l.B&AFDB-ENSP_mappings:AF-P04626-F1&Phobius:NON_CYTOPLASMIC_DOMAIN&Pfam:PF00757&PIRSF:PIRSF000619&PANTHER:PTHR24416&Superfamily:SSF57184likely_pathogenic0&1&11&1&126619011&22908275FAIL-2733-334ERBB24539768363068single_nucleotide_variantSO:0001483ERBB2:2064SO:0001583&missense_variant&SO:0001619&non-coding_transcript_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV007129951105751981617:39711955-39711955ERBB2p.S310FTrueThe ERBB2 S310F mutation is located in the extracellular domain of the protein (PMID: 22908275, 24997986). This mutation has been found in bladder, lung, breast and colon cancer (PMID: 28572459). Expression of this mutation in murine fibroblast and B-cell cell lines demonstrated that it is activating as measured by increased protein activation, colony formation in soft agar and cytokine-independent growth compared to wildtype (PMID: 22908275, 24997986). In vitro studies demonstrate that this mutation is sensitive to the ERBB2 inhibitors osimertinib, neratinib, afatinib, lapatinib and trastuzumab when expressed in a murine fibroblast cell line as measured by decreased cell proliferation upon drug treatment (PMID: 22908275, 29967253). Single patients with breast cancer harboring this mutation have demonstrated clinical responses to ERBB2 inhibitor combination therapies, trastuzumab + pertuzumab and lapatinib + trastuzumab (PMID: 26358791, 24516025). Twenty-two patients with cancers harboring this mutation in a neratinib basket trial demonstrated various clinical responses to neratinib, ranging from progressive disease to complete response (PMID: 29420467).ERBB2, a receptor tyrosine kinase, is altered by mutation, amplification and/or overexpression in various cancer types, most frequently in breast, esophagogastric and endometrial cancers.24516025|24997986|28572459|29967253|22908275|26358791|29420467S310F2064ERBB2GRCh38.MUTATION.The ERBB2 S310F mutation is known to be oncogenic.FalseLEVEL_Fda2The ERBB2 S310F mutation is located in the extracellular domain of the protein (PMID: 22908275, 24997986). This mutation has been found in bladder, lung, breast and colon cancer (PMID: 28572459). Expression of this mutation in murine fibroblast and B-cell cell lines demonstrated that it is activating as measured by increased protein activation, colony formation in soft agar and cytokine-independent growth compared to wildtype (PMID: 22908275, 24997986). In vitro studies demonstrate that this mutation is sensitive to the ERBB2 inhibitors osimertinib, neratinib, afatinib, lapatinib and trastuzumab when expressed in a murine fibroblast cell line as measured by decreased cell proliferation upon drug treatment (PMID: 22908275, 29967253). Single patients with breast cancer harboring this mutation have demonstrated clinical responses to ERBB2 inhibitor combination therapies, trastuzumab + pertuzumab and lapatinib + trastuzumab (PMID: 26358791, 24516025). Twenty-two patients with cancers harboring this mutation in a neratinib basket trial demonstrated various clinical responses to neratinib, ranging from progressive disease to complete response (PMID: 29420467).['24516025', '24997986', '28572459', '29967253', '22908275', '26358791', '29420467']Trastuzumab DeruxtecanLEVEL_1LEVEL_Fda3['34534430']Trastuzumab Deruxtecan is a HER2-directed antibody and topoisomerase inhibitor conjugate that is FDA-approved for patients with HER2-mutant non-small cell lung cancer (NSCLC). FDA approval was based on the data from the Phase II dose optimization DESTINY-Lung02 study of trastuzumab deruxtecan in 52 patients with HER2-mutant NSCLC in which the confirmed overall response rate was 57.7% (95% CI= 43.2-71.3), with one of 54 patients having a complete response, 29 of 54 patients having a partial response, and with a median duration of response of 8.7 months (95% CI= 7.1-NE). FDA approval was supported by the Phase II DESTINY-Lung01 trial of trastuzumab deruxtecan in 91 patients with HER2-mutant NSCLC in which the overall response rate was 55% (95% CI=44-65), the median duration of response was 9.3 months (95% CI=5.7-14.7), the median progression-free survival was 8.2 months (95% CI=6.0-11.9), and the median overall survival was 17.8 months (95% CI=13.8-22.1) (PMID: 34534430).Non-Small Cell Lung CancerSOLIDLungAdo-Trastuzumab EmtansineLEVEL_2LEVEL_Fda3['31588020', '29989854', '30206164']Ado-trastuzumab emtansine (T-DM1) is an antibody-drug conjugate in which an ERBB2-directed monoclonal antibody is conjugated to DM1, a microtubule-inhibitory agent. The NCCN lists ado-trastuzumab emtansine as another recommended therapy for patients with NSCLC harboring ERBB2 mutations. In the lung cancer cohort of a Phase II basket trial of T-DM1 in patients with ERBB2-mutant solid tumors, 44% (95% CI=22%-69%) of eighteen patients had a partial response, with a median progression-free survival of five months (95% CI=3-9) (PMID: 29989854). Of the eight patients who had a partial response, four had been treated with prior anti-HER2 therapy, and all eight had one of the following ERBB2 mutations: A775_G776insYVMA, G778_P780dup, G776_V777insVCV, V659E or S310F (PMID: 29989854). Responses to T-DM1 have also been seen in patients with ERBB2-amplified non-small cell lung cancer (NSCLC) (PMID: 30206164). The addition of poziotinib may enhance the response of patients with NSCLC to T-DM1 (PMID: 31588020).Non-Small Cell Lung CancerSOLIDLungNeratinibLEVEL_2LEVEL_Fda2['38211393']Neratinib is an orally available, small-molecule pan-HER targeted inhibitor that is FDA-approved as a single agent for the extended adjuvant treatment of adult patients with early-stage HER2-positive breast cancer following adjuvant trastuzumab-based therapy. The NCCN Cervical Cancer Guidelines (V1.2025) lists neratinib under "Recurrent or Metastatic Disease - Second-line or Subsequent Therapy - Useful in Certain Circumstances" for patients with ERBB2 mutant cervical cancer. NCCN recommendation was based on the results of the Phase II SUMMIT (NCT01953926) trial of neratinib in 22 patients with ERBB2 mutant cervical cancer (n=10, S310F/Y, n=2, S310F/Y + V842I, n=2, R678Q, n=1: S310F + G660D, V697L, D769H, T733I + R678Q, G776V, E695D, G832E, D769N) (PMID: 38211393).__In the Phase II SUMMIT (NCT01953926) trial, the ERBB2 mutant cervical cohort demonstrated an overall response rate (ORR) of 18.2% (n=4) (95% CI=5.2-40.3), with a 4.5% (n=1 [S310F]) complete response rate, 13.6% (n=3 [S310F (2), S310F + V842I]) partial response rate and 27.3% (n=6 [S310F, S310F + G660D, D769H/N, V697L, R678Q]) stable disease rate, a median progression-free survival (PFS) of 5.1 months (95% CI=1.7-7.2) and a median duration of response (DOR) of 7.6 months (95% CI=5.6-12.3) (PMID: 38211393).Cervical CancerSOLIDCervixNeratinib + Trastuzumab + FulvestrantLEVEL_2LEVEL_Fda3['37597578']Neratinib is an orally available, small-molecule pan-HER targeted inhibitor that is FDA-approved as a single agent for the extended adjuvant treatment of adult patients with early-stage HER2-positive breast cancer following adjuvant trastuzumab-based therapy. The NCCN Breast Cancer Guidelines (V3.2025) lists neratinib under "Emerging Biomarkers And Novel Therapies For Patients With Stage IV (M1) Disease" for patients with HER2 activating mutations. NCCN recommendation was based on the results of the Phase I SUMMIT (NCT05372614) basket study of neratinib plus trastuzumab and fulvestrant in patients with HR+/HER2-negative metastatic breast cancer with activating HER2 mutation(s) and prior CDK4/6i therapy._In the Phase I SUMMIT (NCT05372614) trial, patients with HER2 mutant breast cancer (n=48) demonstrated an overall response rate (ORR) of 42% (n=20), with one patient (n=1, multiple ERBB2 mutations) achieving complete response (CR) and 21 patients (n=4, L755S, n=5, exon 20 insertion, n=3, other kinase domain missense, n=5, V777L, n=1, S310F, n=3, multiple ERBB2 mutations) achieving partial response (PR), and a median progression-free survival (PFS) of 10.2 months (95% CI=6.1-18.6) (PMID: 37597578).Breast CancerSOLIDBreastZongertinibLEVEL_2LEVEL_Fda2['40293180']Zongertinib is an orally available, HER2-selective tyrosine kinase inhibitor. Zongertinib is recommended in the NCCN Non-Small Cell Lung Cancer (NSCLC) Guidelines (V8.2025) as a "Molecular and Biomarker-Directed Therapy for Advanced or Metastatic Disease: Subsequent Therapy" treatment option for patients with ERBB2 (HER2) mutations who received prior systemic therapy. NCCN recommendation is based on the results of the Phase I Beamion LUNG-1 (NCT04886804) trial of zongertinib in patients with previously treated ERBB2-mutant NSCLC._In the Phase I Beamion LUNG-1 (NCT04886804), patients with previously treated NSCLC with an ERBB2 mutation in the tyrosine kinase domain (n=75 [ERBB2 mutations include: A775_G776insYVMA (43), P780_Y781insGSP (8), A775_G776insYVMA+other (5), G776>VC (3), L755P (2), G776V (2), other (12)]) demonstrated an overall response rate (ORR) of 71% (95% CI=60-80), with a 7% (n=5) complete response (CR) rate and 64% (n=48) partial response (PR) rate, and a disease control rate (DCR) of 96% (95% CI=89-99) (PMID: 40293180). Of patients who were previously treated with a HER2-directed antibody drug conjugate (ADC) (n=31 [ERBB2 mutations include: A775_G776insYVMA (18), P780_Y781insGSP (3), G776>VC (3), other (7)]), the ORR was 48% (95% CI=32-65), with a 3% (n=1) CR rate and 45% (n=14) PR rate, and the DCR was 97% (95% CI=84-99) (PMID: 40293180). Patients with previously treated NSCLC with an ERBB2 mutation not in the tyrosine kinase domain (n=20 [ERBB2 mutations include: S310F (6), V659E (6), S310Y (4), P1199S (1), D277Y (1), S113F (1), G660D (1)]) demonstrated an ORR of 30% (95% CI=15-52), with a 30% (n=5 [S310F (3), V659E (3)]) PR rate, and a DCR of 65% (95% CI=43-82) (PMID: 40293180).Non-Small Cell Lung CancerSOLIDLungNeratinibLEVEL_3ALEVEL_Fda3['17311002', '23220880', '29420467']Neratinib is a small molecule inhibitor of the ERBB2 and EGFR kinases that is FDA-approved for HER2-positive breast cancer previously treated with adjuvant trastuzumab and is a category 2B NCCN recommendation for patients with HER2-mutant breast cancer. In a Phase II basket trial of patients across multiple tumor types with ERBB2 activating mutations, the overall response rate at eight weeks in patients with HER2 non-amplified breast cancer (N=25) was 32% [95% CI= 15-54%]. ERBB2 mutations associated with a response in breast cancer included the HER2 hotspot extracellular domain mutation S310, HER2 kinase domain hotspot mutations, exon 20 insertions, and the non-hotspot complex insertion/substitution L755_E757delinsS. Responses were observed in patients with estrogen receptor (ER)+ (30%, 6/20) and ER- (40%, 2/5) tumors (PMID: 29420467). In vitro studies of cells engineered to express ERBB2 activating mutations have demonstrated that these mutations are sensitive to neratinib as measured by a decrease in colony formation in soft agar and a decrease in tumor volume in xenograft models (PMID: 23220880, 17311002).Breast CancerSOLIDBreastNeratinibLEVEL_3ALEVEL_Fda3['23220880', '29420467']Neratinib is a small molecule inhibitor of the ERBB2 and EGFR kinases that is FDA-approved for HER2-positive breast cancer previously treated with adjuvant trastuzumab. In a Phase II basket trial of patients across multiple tumor types with ERBB2 activating mutations, clinical benefit was observed in patients with non-small cell lung cancer harboring ERBB2 S310, L755, V777, P780_Y781insGSP, and A775_G776insYVMA mutations (PMID: 29420467). In vitro studies of cells engineered to express ERBB2 activating mutations have demonstrated that these mutations are sensitive to neratinib as measured by a decrease in colony formation in soft agar and a decrease in tumor volume in xenograft models (PMID: 23220880).Non-Small Cell Lung CancerSOLIDLungSevabertinibLEVEL_3ALEVEL_Fda3['41104928']Sevabertinib is an orally available, reversible dual EGFR/HER2-selective tyrosine kinase inhibitor that is FDA-approved for the treatment of adult patients with locally advanced or metastatic non-squamous non-small cell lung cancer (NSCLC) whose tumors have ERBB2 tyrosine kinase domain (TKD) activating mutations, as detected by an FDA-approved test, and who have received a prior systemic therapy. There are promising clinical data that support the use of sevabertinib in patients with ERBB2 non-TKD-mutant NSCLC. _In the Phase I/II SOHO-01 (NCT05099172) trial, cohort D (previously treated patients who had not received ERBB2-targeted therapy) (n=81 [n=73, ERBB2 TKD mutations, n=7, ERBB2 non-TKD mutations, n=1, not applicable]) demonstrated an overall response rate (ORR) of 64% (95% CI=53-75), with a 2% (n=2) complete response (CR) rate, 62% (n=50) partial response (PR) rate and 25% (n=20) stable disease (SD) rate, a median duration of response (DOR) of 9.2 months (95% CI=6.3-13.5) and a median progression-free survival of 8.3 months (95% CI=6.9-12.3) (PMID: 41104928). _Cohort E (patients who had previously received ERBB2-directed antibody drug conjugate treatment) (n=55 [n=52, ERBB2 TKD mutations, n=3, ERBB2 non-TKD mutations]) demonstrated an ORR of 38% (95% CI=25-52), with a 5% (n=3) CR rate, 33% (n=18) PR rate and 42% (n=23) SD rate, a median DOR of 8.5 months (95% CI=5.6-16.4) and a median PFS of 5.5 months (95% CI=4.3-8.3) (PMID: 41104928). _Cohort F (patients who had not previously received treatment) (n=73 [n=71, ERBB2 TKD mutations, n=2, ERBB2 non-TKD mutations]) demonstrated an ORR of 71% (95% CI=59-81), with a 2% (n=2) CR rate, 62% (n=50) PR rate and 25% (n=20) SD rate, a median DOR of 11.0 months (95% CI=8.1-NE) and a median PFS that was not evaluable (95% CI=9.6-NE) (PMID: 41104928).Non-Small Cell Lung CancerSOLIDLungTrastuzumab + Pertuzumab + DocetaxelLEVEL_3ALEVEL_Fda3['15059883', '19934333', '28959366', '35073148']Trastuzumab and pertuzumab are both monoclonal antibodies against ERBB2/HER2 and docetaxel is an antineoplastic agent that acts by disrupting the microtubular network in cells that is essential for mitotic and interphase cellular functions. The triple combination of these therapeutic agents is FDA-approved for the treatment of patients with HER2-positive metastatic breast cancer who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease. In a multicenter, nonrandomized phase II study (FCT 1703-R2D2, NCT03845270) of trastuzumab, pertuzumab and docetaxel in 45 patients with ERBB2-mutated, advanced non-small cell lung cancer who progressed after at least one platinum-based treatment, the objective response rate was 29% (n = 13/45) in which 58% of patients had stable disease (n = 26/45) and the median progression-free survival was 6.8 months (95% CI=4.0 to 8.5) (PMID: 35073148). Preclinical studies in HER2-overexpressing breast cancer cell lines and HER2-positive breast and nonsmall cell lung cancer xenograft models have shown that combining trastuzumab and pertuzumab resulted in greater antitumor activity compared to treatment with either antibody alone due to more comprehensive signaling blockade provided by the antibodies binding to different HER2 epitopes (PMID: 15059883, 19934333). In a separate preclinical study, treatment of a HER2-positive mouse xenograft model of breast cancer with trastuzumab, pertuzumab, and docetaxel resulted in enhanced apoptosis, infiltration of mononuclear cells, a strong reduction in the phosphorylation of HER2, EGFR, HER3, ERK, and AKT, as well as a slower tumor growth rate compared to controls (PMID: 28959366).Non-Small Cell Lung CancerSOLIDLungNeratinibLEVEL_4LEVEL_Fda3['36746967']Neratinib is an orally available, small-molecule pan-HER inhibitor that is FDA-approved as an extended adjuvant treatment of adult patients with early-stage HER2-positive breast cancer, to follow adjuvant trastuzumab-based therapy. There are anecdotal clinical data to support the use of neratinib in patients with ERBB2 mutant biliary tract cancer. _In the Phase II SUMMIT (NCT01953926) trial of neratinib in patients with ERBB2 mutant solid tumors, patients with gallbladder cancer (n=10 [n=5, S310F/Y, n=3, V777L, n=1, T733I, n=1, L755S]), cholangiocarcinoma (n=11 [n=4, S310F, n=2, V842I, n=2, R678Q, n=1, V777L, n=1, V695E, n=1, D769Y]) and ampullary cancer (n=4 [n=1, S310F, n=1, G776C+H878Y, n=1, S310F+V777L, n=1, L755S]) demonstrated an overall response rate of 16.0% (95% CI=4.5-36.1) (PMID: 36746967). In the gallbladder cancer cohort, the median progression-free survival (PFS) was 3.7 months (95% CI=0.8-6.4), the median overall survival (OS) was 9.8 months (95% CI=2.4-NE), three patients achieved partial responses (PR) (S310F, V777L) and four patients demonstrated stable disease (SD) (T733I, L755S, S310Y) (PMID: 36746967). In the cholangiocarcinoma cohort, the median PFS was 1.4 months (95% CI=0.5-9.1), the median OS was 5.4 months (95% CI=0.8-16.2), two patients achieved PR (V659E, V777L) and two patients demonstrated SD (S310F, D769Y) (PMID: 36746967). In the ampullary cancer cohort, the median PFS was 1.1 months (95% CI=1.1-3.8), the median OS was 5.0 months (95% CI=3.7-10.2) and one patient demonstrated SD (G77C+H878Y) (PMID: 36746967).Biliary TractBiliary Tract CancerSOLIDBiliary TractNeratinibLEVEL_4LEVEL_Fda3['36746967']Neratinib is an orally available, small-molecule pan-HER inhibitor that is FDA-approved as an extended adjuvant treatment of adult patients with early-stage HER2-positive breast cancer, to follow adjuvant trastuzumab-based therapy. There are anecdotal clinical data to support the use of neratinib in patients with ERBB2 mutant biliary tract cancer. _In the Phase II SUMMIT (NCT01953926) trial of neratinib in patients with ERBB2 mutant solid tumors, patients with gallbladder cancer (n=10 [n=5, S310F/Y, n=3, V777L, n=1, T733I, n=1, L755S]), cholangiocarcinoma (n=11 [n=4, S310F, n=2, V842I, n=2, R678Q, n=1, V777L, n=1, V695E, n=1, D769Y]) and ampullary cancer (n=4 [n=1, S310F, n=1, G776C+H878Y, n=1, S310F+V777L, n=1, L755S]) demonstrated an overall response rate of 16.0% (95% CI=4.5-36.1) (PMID: 36746967). In the gallbladder cancer cohort, the median progression-free survival (PFS) was 3.7 months (95% CI=0.8-6.4), the median overall survival (OS) was 9.8 months (95% CI=2.4-NE), three patients achieved partial responses (PR) (S310F, V777L) and four patients demonstrated stable disease (SD) (T733I, L755S, S310Y) (PMID: 36746967). In the cholangiocarcinoma cohort, the median PFS was 1.4 months (95% CI=0.5-9.1), the median OS was 5.4 months (95% CI=0.8-16.2), two patients achieved PR (V659E, V777L) and two patients demonstrated SD (S310F, D769Y) (PMID: 36746967). In the ampullary cancer cohort, the median PFS was 1.1 months (95% CI=1.1-3.8), the median OS was 5.0 months (95% CI=3.7-10.2) and one patient demonstrated SD (G77C+H878Y) (PMID: 36746967).Hepatobiliary CancerSOLIDMIXEDPertuzumab + TrastuzumabLEVEL_4LEVEL_Fda3['38748939']Pertuzumab and trastuzumab are intravenously administered, humanized monoclonal HER2-targeted antibodies that are NCCN-compendium listed in combination for the treatment of patients with HER2-positive biliary tract cancers. There are anecdotal clinical data to support the combined use of pertuzumab and trastuzumab in patients with ERBB2 mutant biliary tract cancer. _In the Phase II TAPUR (NCT02693535) trial of pertuzumab plus trastuzumab in seven patients with ERBB2 mutant biliary tract cancer (n=4, S310F, n=1, S310Y, n=1, R678Q, n=1, G776V), two patients achieved partial response (S310Y, S310F) (PMID: 38748939).Biliary TractBiliary Tract CancerSOLIDBiliary TractPertuzumab + TrastuzumabLEVEL_4LEVEL_Fda3['38748939']Pertuzumab and trastuzumab are intravenously administered, humanized monoclonal HER2-targeted antibodies that are NCCN-compendium listed in combination for the treatment of patients with HER2-positive biliary tract cancers. There are anecdotal clinical data to support the combined use of pertuzumab and trastuzumab in patients with ERBB2 mutant biliary tract cancer. _In the Phase II TAPUR (NCT02693535) trial of pertuzumab plus trastuzumab in seven patients with ERBB2 mutant biliary tract cancer (n=4, S310F, n=1, S310Y, n=1, R678Q, n=1, G776V), two patients achieved partial response (S310Y, S310F) (PMID: 38748939).Hepatobiliary CancerSOLIDMIXEDTrastuzumab DeruxtecanLEVEL_4LEVEL_Fda3['38710187']Trastuzumab deruxtecan is an intravenously administered, HER2-targeted antibody that is FDA-approved for patients with unresectable or metastatic HER2-positive breast cancer previously treated with anti-HER2-based regimens in the metastatic setting. There are anecdotal clinical data to support the use of trastuzumab deruxtecan in patients with ERBB2 mutant biliary tract cancer. _In the Phase II DESTINY-PanTumor01 (NCT04639219) trial of trastuzumab deruxtecan in patients with ERBB2 mutant solid tumors, the biliary tract cancer cohort (n=19) demonstrated an overall response rate (ORR) of 10.5% (n=2) (95% CI=5.7-43.7) (PMID: 38710187).Biliary TractBiliary Tract CancerSOLIDBiliary TractTrastuzumab DeruxtecanLEVEL_4LEVEL_Fda3['38710187']Trastuzumab deruxtecan is an intravenously administered, HER2-targeted antibody that is FDA-approved for patients with unresectable or metastatic HER2-positive breast cancer previously treated with anti-HER2-based regimens in the metastatic setting. There are anecdotal clinical data to support the use of trastuzumab deruxtecan in patients with ERBB2 mutant biliary tract cancer. _In the Phase II DESTINY-PanTumor01 (NCT04639219) trial of trastuzumab deruxtecan in patients with ERBB2 mutant solid tumors, the biliary tract cancer cohort (n=19) demonstrated an overall response rate (ORR) of 10.5% (n=2) (95% CI=5.7-43.7) (PMID: 38710187).Hepatobiliary CancerSOLIDMIXED24516025;24997986;28572459;29967253;22908275;26358791;29420467Neratinib,Pertuzumab+Trastuzumab,Trastuzumab Deruxtecan34534430;31588020;29989854;30206164;38211393;37597578;40293180;17311002;23220880;29420467;41104928;15059883;19934333;28959366;35073148;36746967;38748939;38710187130Tmissense_variantERBB22064GeneENST00000269571.5ENST00000269571.5:c.929C>T497https://civicdb.org/links/variants/497ERBB2_S310F/Y493ENST00000269571.5:c.929C>T/NC_000017.10:g.37868208C>T376189/376188

File: Final_result_tier1.maf — Standard MAF format. 1028 columns. First line is the #SMART_VERSION comment; second line is the MAF column-name header (no separate metadata row in MAF format). Designed for cBioPortal, R/Python pipelines, and oncoPrint generators.

Default: 83 core columns shown.
#SMART_VERSION 0.2.0
Tumor_Sample_BarcodeHGVSp_ShortHGVSpChromosomeStart_PositionEnd_PositionREFALTFILTERNM_TranscriptConsequenceIMPACTSYMBOLEXONINTRONHGVScExisting_variationVARIANT_CLASSSIFTPolyPhenAFgnomADe_AFgnomADg_AFMAX_AFMAX_AF_POPSSpliceAI_pred_DS_AGSpliceAI_pred_DS_ALSpliceAI_pred_DS_DGSpliceAI_pred_DS_DLREVELLOEUFClinVar_CLNDNClinVar_CLNHGVSClinVar_CLNREVSTATClinVar_CLNSIGClinVar_ONCClinVar_ONCREVSTATClinVar_ORIGINClinVar_SCIREVSTATClinVar_SCICIViC_GNCIViC_VTCancerHotspotsCancerHotspots_HOTSPOTONCOKB_DATA_VERSIONONCOKB_DIAG_LVLONCOKB_FDA_LVLONCOKB_HOTSPOTONCOKB_LAST_UPDATEONCOKB_SENS_LVLSVLENSVTYPEANNOTATEDGENE_IN_ONCOKBVARIANT_IN_ONCOKBMUTATION_EFFECTONCOGENICLEVEL_1LEVEL_2LEVEL_3ALEVEL_R1HIGHEST_LEVELHIGHEST_SENSITIVE_LEVELHIGHEST_RESISTANCE_LEVELHIGHEST_DX_LEVELHIGHEST_PX_LEVELADGTCIViC_CSQ_CIViC Variant NameCIViC_CSQ_CIViC Entity SignificanceCIViC_CSQ_CIViC Entity DirectionCIViC_CSQ_CIViC Entity DiseaseCIViC_CSQ_CIViC Entity TherapiesCIViC_CSQ_CIViC Evidence LevelCIViC_CSQ_CIViC Assertion AMP CategoryCIViC_CSQ_CIViC Assertion Regulatory ApprovalVAFNCBI_BuildHugo_SymbolReference_AlleleTumor_Seq_Allele2Variant_ClassificationVariant_TypeTumor_Seq_Allele1POSIDQUALFORMATFORMAT_DATAAlleleGeneFeature_typeFeatureBIOTYPEcDNA_positionCDS_positionProtein_positionAmino_acidsCodonsDISTANCESTRANDFLAGSSYMBOL_SOURCEHGNC_IDCANONICALMANEMANE_SELECTMANE_PLUS_CLINICALTSLAPPRISCCDSENSPSWISSPROTTREMBLUNIPARCUNIPROT_ISOFORMREFSEQ_MATCHSOURCEREFSEQ_OFFSETGIVEN_REFUSED_REFBAM_EDITGENE_PHENODOMAINSmiRNAHGVS_OFFSETAFR_AFAMR_AFEAS_AFEUR_AFSAS_AFgnomADe_AFR_AFgnomADe_AMR_AFgnomADe_ASJ_AFgnomADe_EAS_AFgnomADe_FIN_AFgnomADe_MID_AFgnomADe_NFE_AFgnomADe_REMAINING_AFgnomADe_SAS_AFgnomADg_AFR_AFgnomADg_AMI_AFgnomADg_AMR_AFgnomADg_ASJ_AFgnomADg_EAS_AFgnomADg_FIN_AFgnomADg_MID_AFgnomADg_NFE_AFgnomADg_REMAINING_AFgnomADg_SAS_AFCLIN_SIGSOMATICPHENOPUBMEDMOTIF_NAMEMOTIF_POSHIGH_INF_POSMOTIF_SCORE_CHANGETRANSCRIPTION_FACTORSSpliceAI_cutoffSpliceAI_pred_DP_AGSpliceAI_pred_DP_ALSpliceAI_pred_DP_DGSpliceAI_pred_DP_DLSpliceAI_pred_SYMBOLClinVarClinVar_AF_ESPClinVar_AF_EXACClinVar_AF_TGPClinVar_ALLELEIDClinVar_CLNDNINCLClinVar_CLNDISDBClinVar_CLNDISDBINCLClinVar_CLNSIGCONFClinVar_CLNSIGINCLClinVar_CLNSIGSCVClinVar_CLNVCClinVar_CLNVCSOClinVar_CLNVIClinVar_DBVARIDClinVar_GENEINFOClinVar_MCClinVar_ONCDNClinVar_ONCDNINCLClinVar_ONCDISDBClinVar_ONCDISDBINCLClinVar_ONCINCLClinVar_ONCSCVClinVar_ONCCONFClinVar_RSClinVar_SCIDNClinVar_SCIDNINCLClinVar_SCIDISDBClinVar_SCIDISDBINCLClinVar_SCIINCLClinVar_SCISCVCIViCCancerHotspots_HOTSPOT_GENECancerHotspots_HOTSPOT_HGVSpCancerHotspots_HOTSPOT3DCancerHotspots_HOTSPOT3D_GENECancerHotspots_HOTSPOT3D_HGVSpCancerHotspots_HOTSPOTNCCancerHotspots_HOTSPOTNC_GENECancerHotspots_HOTSPOTNC_HGVScCIENDCIPOSENDONCOKB_ABSTRACTSONCOKB_ALLELE_EXISTONCOKB_DIAG_SUMMARYONCOKB_EFFECT_DESCONCOKB_EXONONCOKB_GENE_SUMMARYONCOKB_OTHER_RESIST_LVLSONCOKB_OTHER_SENS_LVLSONCOKB_PMIDSONCOKB_PROG_LVLONCOKB_PROG_SUMMARYONCOKB_QUERY_ALTERATIONONCOKB_QUERY_ENTREZ_GENE_IDONCOKB_QUERY_HUGO_SYMBOLONCOKB_QUERY_REF_GENOMEONCOKB_QUERY_TUMOR_TYPEONCOKB_QUERY_TYPEONCOKB_RESIST_LVLONCOKB_TUMOR_TYPE_SUMMARYONCOKB_VARIANT_SUMMARYONCOKB_VUSONCOKB_highestFdaLevelONCOKB_otherSignificantSensitiveLevelsONCOKB_otherSignificantResistanceLevelsONCOKB_prognosticSummaryONCOKB_diagnosticSummaryONCOKB_mutationEffect.descriptionONCOKB_mutationEffect.citations.pmidsONCOKB_mutationEffect.citations.abstractsONCOKB_DIAG_0_levelOfEvidenceONCOKB_DIAG_0_alterationsONCOKB_DIAG_0_pmidsONCOKB_DIAG_0_abstractsONCOKB_DIAG_0_descriptionONCOKB_DIAG_0_tumorType.idONCOKB_DIAG_0_tumorType.codeONCOKB_DIAG_0_tumorType.colorONCOKB_DIAG_0_tumorType.nameONCOKB_DIAG_0_tumorType.mainType.idONCOKB_DIAG_0_tumorType.mainType.nameONCOKB_DIAG_0_tumorType.mainType.tumorFormONCOKB_DIAG_0_tumorType.tissueONCOKB_DIAG_0_tumorType.parentONCOKB_DIAG_0_tumorType.levelONCOKB_DIAG_0_tumorType.tumorFormONCOKB_DIAG_1_levelOfEvidenceONCOKB_DIAG_1_alterationsONCOKB_DIAG_1_pmidsONCOKB_DIAG_1_abstractsONCOKB_DIAG_1_descriptionONCOKB_DIAG_1_tumorType.idONCOKB_DIAG_1_tumorType.codeONCOKB_DIAG_1_tumorType.colorONCOKB_DIAG_1_tumorType.nameONCOKB_DIAG_1_tumorType.mainType.idONCOKB_DIAG_1_tumorType.mainType.nameONCOKB_DIAG_1_tumorType.mainType.tumorFormONCOKB_DIAG_1_tumorType.tissueONCOKB_DIAG_1_tumorType.parentONCOKB_DIAG_1_tumorType.levelONCOKB_DIAG_1_tumorType.tumorFormONCOKB_DIAG_2_levelOfEvidenceONCOKB_DIAG_2_alterationsONCOKB_DIAG_2_pmidsONCOKB_DIAG_2_abstractsONCOKB_DIAG_2_descriptionONCOKB_DIAG_2_tumorType.idONCOKB_DIAG_2_tumorType.codeONCOKB_DIAG_2_tumorType.colorONCOKB_DIAG_2_tumorType.nameONCOKB_DIAG_2_tumorType.mainType.idONCOKB_DIAG_2_tumorType.mainType.nameONCOKB_DIAG_2_tumorType.mainType.tumorFormONCOKB_DIAG_2_tumorType.tissueONCOKB_DIAG_2_tumorType.parentONCOKB_DIAG_2_tumorType.levelONCOKB_DIAG_2_tumorType.tumorFormONCOKB_DIAG_3_levelOfEvidenceONCOKB_DIAG_3_alterationsONCOKB_DIAG_3_pmidsONCOKB_DIAG_3_abstractsONCOKB_DIAG_3_descriptionONCOKB_DIAG_3_tumorType.idONCOKB_DIAG_3_tumorType.codeONCOKB_DIAG_3_tumorType.colorONCOKB_DIAG_3_tumorType.nameONCOKB_DIAG_3_tumorType.mainType.idONCOKB_DIAG_3_tumorType.mainType.nameONCOKB_DIAG_3_tumorType.mainType.tumorFormONCOKB_DIAG_3_tumorType.tissueONCOKB_DIAG_3_tumorType.parentONCOKB_DIAG_3_tumorType.levelONCOKB_DIAG_3_tumorType.tumorFormONCOKB_TX_0_alterationsONCOKB_TX_0_drugsONCOKB_TX_0_approvedIndicationsONCOKB_TX_0_levelONCOKB_TX_0_fdaLevelONCOKB_TX_0_levelExcludedCancerTypesONCOKB_TX_0_pmidsONCOKB_TX_0_abstractsONCOKB_TX_0_descriptionONCOKB_TX_0_levelAssociatedCancerType.idONCOKB_TX_0_levelAssociatedCancerType.codeONCOKB_TX_0_levelAssociatedCancerType.colorONCOKB_TX_0_levelAssociatedCancerType.nameONCOKB_TX_0_levelAssociatedCancerType.mainType.idONCOKB_TX_0_levelAssociatedCancerType.mainType.nameONCOKB_TX_0_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_0_levelAssociatedCancerType.tissueONCOKB_TX_0_levelAssociatedCancerType.parentONCOKB_TX_0_levelAssociatedCancerType.levelONCOKB_TX_0_levelAssociatedCancerType.tumorFormONCOKB_TX_1_alterationsONCOKB_TX_1_drugsONCOKB_TX_1_approvedIndicationsONCOKB_TX_1_levelONCOKB_TX_1_fdaLevelONCOKB_TX_1_levelExcludedCancerTypesONCOKB_TX_1_pmidsONCOKB_TX_1_abstractsONCOKB_TX_1_descriptionONCOKB_TX_1_levelAssociatedCancerType.idONCOKB_TX_1_levelAssociatedCancerType.codeONCOKB_TX_1_levelAssociatedCancerType.colorONCOKB_TX_1_levelAssociatedCancerType.nameONCOKB_TX_1_levelAssociatedCancerType.mainType.idONCOKB_TX_1_levelAssociatedCancerType.mainType.nameONCOKB_TX_1_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_1_levelAssociatedCancerType.tissueONCOKB_TX_1_levelAssociatedCancerType.parentONCOKB_TX_1_levelAssociatedCancerType.levelONCOKB_TX_1_levelAssociatedCancerType.tumorFormONCOKB_TX_2_alterationsONCOKB_TX_2_drugsONCOKB_TX_2_approvedIndicationsONCOKB_TX_2_levelONCOKB_TX_2_fdaLevelONCOKB_TX_2_levelExcludedCancerTypesONCOKB_TX_2_pmidsONCOKB_TX_2_abstractsONCOKB_TX_2_descriptionONCOKB_TX_2_levelAssociatedCancerType.idONCOKB_TX_2_levelAssociatedCancerType.codeONCOKB_TX_2_levelAssociatedCancerType.colorONCOKB_TX_2_levelAssociatedCancerType.nameONCOKB_TX_2_levelAssociatedCancerType.mainType.idONCOKB_TX_2_levelAssociatedCancerType.mainType.nameONCOKB_TX_2_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_2_levelAssociatedCancerType.tissueONCOKB_TX_2_levelAssociatedCancerType.parentONCOKB_TX_2_levelAssociatedCancerType.levelONCOKB_TX_2_levelAssociatedCancerType.tumorFormONCOKB_TX_3_alterationsONCOKB_TX_3_drugsONCOKB_TX_3_approvedIndicationsONCOKB_TX_3_levelONCOKB_TX_3_fdaLevelONCOKB_TX_3_levelExcludedCancerTypesONCOKB_TX_3_pmidsONCOKB_TX_3_abstractsONCOKB_TX_3_descriptionONCOKB_TX_3_levelAssociatedCancerType.idONCOKB_TX_3_levelAssociatedCancerType.codeONCOKB_TX_3_levelAssociatedCancerType.colorONCOKB_TX_3_levelAssociatedCancerType.nameONCOKB_TX_3_levelAssociatedCancerType.mainType.idONCOKB_TX_3_levelAssociatedCancerType.mainType.nameONCOKB_TX_3_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_3_levelAssociatedCancerType.tissueONCOKB_TX_3_levelAssociatedCancerType.parentONCOKB_TX_3_levelAssociatedCancerType.levelONCOKB_TX_3_levelAssociatedCancerType.tumorFormONCOKB_TX_4_alterationsONCOKB_TX_4_drugsONCOKB_TX_4_approvedIndicationsONCOKB_TX_4_levelONCOKB_TX_4_fdaLevelONCOKB_TX_4_levelExcludedCancerTypesONCOKB_TX_4_pmidsONCOKB_TX_4_abstractsONCOKB_TX_4_descriptionONCOKB_TX_4_levelAssociatedCancerType.idONCOKB_TX_4_levelAssociatedCancerType.codeONCOKB_TX_4_levelAssociatedCancerType.colorONCOKB_TX_4_levelAssociatedCancerType.nameONCOKB_TX_4_levelAssociatedCancerType.mainType.idONCOKB_TX_4_levelAssociatedCancerType.mainType.nameONCOKB_TX_4_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_4_levelAssociatedCancerType.tissueONCOKB_TX_4_levelAssociatedCancerType.parentONCOKB_TX_4_levelAssociatedCancerType.levelONCOKB_TX_4_levelAssociatedCancerType.tumorFormONCOKB_TX_5_alterationsONCOKB_TX_5_drugsONCOKB_TX_5_approvedIndicationsONCOKB_TX_5_levelONCOKB_TX_5_fdaLevelONCOKB_TX_5_levelExcludedCancerTypesONCOKB_TX_5_pmidsONCOKB_TX_5_abstractsONCOKB_TX_5_descriptionONCOKB_TX_5_levelAssociatedCancerType.idONCOKB_TX_5_levelAssociatedCancerType.codeONCOKB_TX_5_levelAssociatedCancerType.colorONCOKB_TX_5_levelAssociatedCancerType.nameONCOKB_TX_5_levelAssociatedCancerType.mainType.idONCOKB_TX_5_levelAssociatedCancerType.mainType.nameONCOKB_TX_5_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_5_levelAssociatedCancerType.tissueONCOKB_TX_5_levelAssociatedCancerType.parentONCOKB_TX_5_levelAssociatedCancerType.levelONCOKB_TX_5_levelAssociatedCancerType.tumorFormONCOKB_TX_6_alterationsONCOKB_TX_6_drugsONCOKB_TX_6_approvedIndicationsONCOKB_TX_6_levelONCOKB_TX_6_fdaLevelONCOKB_TX_6_levelExcludedCancerTypesONCOKB_TX_6_pmidsONCOKB_TX_6_abstractsONCOKB_TX_6_descriptionONCOKB_TX_6_levelAssociatedCancerType.idONCOKB_TX_6_levelAssociatedCancerType.codeONCOKB_TX_6_levelAssociatedCancerType.colorONCOKB_TX_6_levelAssociatedCancerType.nameONCOKB_TX_6_levelAssociatedCancerType.mainType.idONCOKB_TX_6_levelAssociatedCancerType.mainType.nameONCOKB_TX_6_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_6_levelAssociatedCancerType.tissueONCOKB_TX_6_levelAssociatedCancerType.parentONCOKB_TX_6_levelAssociatedCancerType.levelONCOKB_TX_6_levelAssociatedCancerType.tumorFormONCOKB_TX_7_alterationsONCOKB_TX_7_drugsONCOKB_TX_7_approvedIndicationsONCOKB_TX_7_levelONCOKB_TX_7_fdaLevelONCOKB_TX_7_levelExcludedCancerTypesONCOKB_TX_7_pmidsONCOKB_TX_7_abstractsONCOKB_TX_7_descriptionONCOKB_TX_7_levelAssociatedCancerType.idONCOKB_TX_7_levelAssociatedCancerType.codeONCOKB_TX_7_levelAssociatedCancerType.colorONCOKB_TX_7_levelAssociatedCancerType.nameONCOKB_TX_7_levelAssociatedCancerType.mainType.idONCOKB_TX_7_levelAssociatedCancerType.mainType.nameONCOKB_TX_7_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_7_levelAssociatedCancerType.tissueONCOKB_TX_7_levelAssociatedCancerType.parentONCOKB_TX_7_levelAssociatedCancerType.levelONCOKB_TX_7_levelAssociatedCancerType.tumorFormONCOKB_TX_8_alterationsONCOKB_TX_8_drugsONCOKB_TX_8_approvedIndicationsONCOKB_TX_8_levelONCOKB_TX_8_fdaLevelONCOKB_TX_8_levelExcludedCancerTypesONCOKB_TX_8_pmidsONCOKB_TX_8_abstractsONCOKB_TX_8_descriptionONCOKB_TX_8_levelAssociatedCancerType.idONCOKB_TX_8_levelAssociatedCancerType.codeONCOKB_TX_8_levelAssociatedCancerType.colorONCOKB_TX_8_levelAssociatedCancerType.nameONCOKB_TX_8_levelAssociatedCancerType.mainType.idONCOKB_TX_8_levelAssociatedCancerType.mainType.nameONCOKB_TX_8_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_8_levelAssociatedCancerType.tissueONCOKB_TX_8_levelAssociatedCancerType.parentONCOKB_TX_8_levelAssociatedCancerType.levelONCOKB_TX_8_levelAssociatedCancerType.tumorFormONCOKB_TX_9_alterationsONCOKB_TX_9_drugsONCOKB_TX_9_approvedIndicationsONCOKB_TX_9_levelONCOKB_TX_9_fdaLevelONCOKB_TX_9_levelExcludedCancerTypesONCOKB_TX_9_pmidsONCOKB_TX_9_abstractsONCOKB_TX_9_descriptionONCOKB_TX_9_levelAssociatedCancerType.idONCOKB_TX_9_levelAssociatedCancerType.codeONCOKB_TX_9_levelAssociatedCancerType.colorONCOKB_TX_9_levelAssociatedCancerType.nameONCOKB_TX_9_levelAssociatedCancerType.mainType.idONCOKB_TX_9_levelAssociatedCancerType.mainType.nameONCOKB_TX_9_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_9_levelAssociatedCancerType.tissueONCOKB_TX_9_levelAssociatedCancerType.parentONCOKB_TX_9_levelAssociatedCancerType.levelONCOKB_TX_9_levelAssociatedCancerType.tumorFormONCOKB_TX_10_alterationsONCOKB_TX_10_drugsONCOKB_TX_10_approvedIndicationsONCOKB_TX_10_levelONCOKB_TX_10_fdaLevelONCOKB_TX_10_levelExcludedCancerTypesONCOKB_TX_10_pmidsONCOKB_TX_10_abstractsONCOKB_TX_10_descriptionONCOKB_TX_10_levelAssociatedCancerType.idONCOKB_TX_10_levelAssociatedCancerType.codeONCOKB_TX_10_levelAssociatedCancerType.colorONCOKB_TX_10_levelAssociatedCancerType.nameONCOKB_TX_10_levelAssociatedCancerType.mainType.idONCOKB_TX_10_levelAssociatedCancerType.mainType.nameONCOKB_TX_10_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_10_levelAssociatedCancerType.tissueONCOKB_TX_10_levelAssociatedCancerType.parentONCOKB_TX_10_levelAssociatedCancerType.levelONCOKB_TX_10_levelAssociatedCancerType.tumorFormONCOKB_TX_11_alterationsONCOKB_TX_11_drugsONCOKB_TX_11_approvedIndicationsONCOKB_TX_11_levelONCOKB_TX_11_fdaLevelONCOKB_TX_11_levelExcludedCancerTypesONCOKB_TX_11_pmidsONCOKB_TX_11_abstractsONCOKB_TX_11_descriptionONCOKB_TX_11_levelAssociatedCancerType.idONCOKB_TX_11_levelAssociatedCancerType.codeONCOKB_TX_11_levelAssociatedCancerType.colorONCOKB_TX_11_levelAssociatedCancerType.nameONCOKB_TX_11_levelAssociatedCancerType.mainType.idONCOKB_TX_11_levelAssociatedCancerType.mainType.nameONCOKB_TX_11_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_11_levelAssociatedCancerType.tissueONCOKB_TX_11_levelAssociatedCancerType.parentONCOKB_TX_11_levelAssociatedCancerType.levelONCOKB_TX_11_levelAssociatedCancerType.tumorFormONCOKB_TX_12_alterationsONCOKB_TX_12_drugsONCOKB_TX_12_approvedIndicationsONCOKB_TX_12_levelONCOKB_TX_12_fdaLevelONCOKB_TX_12_levelExcludedCancerTypesONCOKB_TX_12_pmidsONCOKB_TX_12_abstractsONCOKB_TX_12_descriptionONCOKB_TX_12_levelAssociatedCancerType.idONCOKB_TX_12_levelAssociatedCancerType.codeONCOKB_TX_12_levelAssociatedCancerType.colorONCOKB_TX_12_levelAssociatedCancerType.nameONCOKB_TX_12_levelAssociatedCancerType.mainType.idONCOKB_TX_12_levelAssociatedCancerType.mainType.nameONCOKB_TX_12_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_12_levelAssociatedCancerType.tissueONCOKB_TX_12_levelAssociatedCancerType.parentONCOKB_TX_12_levelAssociatedCancerType.levelONCOKB_TX_12_levelAssociatedCancerType.tumorFormONCOKB_TX_13_alterationsONCOKB_TX_13_drugsONCOKB_TX_13_approvedIndicationsONCOKB_TX_13_levelONCOKB_TX_13_fdaLevelONCOKB_TX_13_levelExcludedCancerTypesONCOKB_TX_13_pmidsONCOKB_TX_13_abstractsONCOKB_TX_13_descriptionONCOKB_TX_13_levelAssociatedCancerType.idONCOKB_TX_13_levelAssociatedCancerType.codeONCOKB_TX_13_levelAssociatedCancerType.colorONCOKB_TX_13_levelAssociatedCancerType.nameONCOKB_TX_13_levelAssociatedCancerType.mainType.idONCOKB_TX_13_levelAssociatedCancerType.mainType.nameONCOKB_TX_13_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_13_levelAssociatedCancerType.tissueONCOKB_TX_13_levelAssociatedCancerType.parentONCOKB_TX_13_levelAssociatedCancerType.levelONCOKB_TX_13_levelAssociatedCancerType.tumorFormONCOKB_TX_14_alterationsONCOKB_TX_14_drugsONCOKB_TX_14_approvedIndicationsONCOKB_TX_14_levelONCOKB_TX_14_fdaLevelONCOKB_TX_14_levelExcludedCancerTypesONCOKB_TX_14_pmidsONCOKB_TX_14_abstractsONCOKB_TX_14_descriptionONCOKB_TX_14_levelAssociatedCancerType.idONCOKB_TX_14_levelAssociatedCancerType.codeONCOKB_TX_14_levelAssociatedCancerType.colorONCOKB_TX_14_levelAssociatedCancerType.nameONCOKB_TX_14_levelAssociatedCancerType.mainType.idONCOKB_TX_14_levelAssociatedCancerType.mainType.nameONCOKB_TX_14_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_14_levelAssociatedCancerType.tissueONCOKB_TX_14_levelAssociatedCancerType.parentONCOKB_TX_14_levelAssociatedCancerType.levelONCOKB_TX_14_levelAssociatedCancerType.tumorFormONCOKB_TX_15_alterationsONCOKB_TX_15_drugsONCOKB_TX_15_approvedIndicationsONCOKB_TX_15_levelONCOKB_TX_15_fdaLevelONCOKB_TX_15_levelExcludedCancerTypesONCOKB_TX_15_pmidsONCOKB_TX_15_abstractsONCOKB_TX_15_descriptionONCOKB_TX_15_levelAssociatedCancerType.idONCOKB_TX_15_levelAssociatedCancerType.codeONCOKB_TX_15_levelAssociatedCancerType.colorONCOKB_TX_15_levelAssociatedCancerType.nameONCOKB_TX_15_levelAssociatedCancerType.mainType.idONCOKB_TX_15_levelAssociatedCancerType.mainType.nameONCOKB_TX_15_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_15_levelAssociatedCancerType.tissueONCOKB_TX_15_levelAssociatedCancerType.parentONCOKB_TX_15_levelAssociatedCancerType.levelONCOKB_TX_15_levelAssociatedCancerType.tumorFormONCOKB_TX_16_alterationsONCOKB_TX_16_drugsONCOKB_TX_16_approvedIndicationsONCOKB_TX_16_levelONCOKB_TX_16_fdaLevelONCOKB_TX_16_levelExcludedCancerTypesONCOKB_TX_16_pmidsONCOKB_TX_16_abstractsONCOKB_TX_16_descriptionONCOKB_TX_16_levelAssociatedCancerType.idONCOKB_TX_16_levelAssociatedCancerType.codeONCOKB_TX_16_levelAssociatedCancerType.colorONCOKB_TX_16_levelAssociatedCancerType.nameONCOKB_TX_16_levelAssociatedCancerType.mainType.idONCOKB_TX_16_levelAssociatedCancerType.mainType.nameONCOKB_TX_16_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_16_levelAssociatedCancerType.tissueONCOKB_TX_16_levelAssociatedCancerType.parentONCOKB_TX_16_levelAssociatedCancerType.levelONCOKB_TX_16_levelAssociatedCancerType.tumorFormONCOKB_TX_17_alterationsONCOKB_TX_17_drugsONCOKB_TX_17_approvedIndicationsONCOKB_TX_17_levelONCOKB_TX_17_fdaLevelONCOKB_TX_17_levelExcludedCancerTypesONCOKB_TX_17_pmidsONCOKB_TX_17_abstractsONCOKB_TX_17_descriptionONCOKB_TX_17_levelAssociatedCancerType.idONCOKB_TX_17_levelAssociatedCancerType.codeONCOKB_TX_17_levelAssociatedCancerType.colorONCOKB_TX_17_levelAssociatedCancerType.nameONCOKB_TX_17_levelAssociatedCancerType.mainType.idONCOKB_TX_17_levelAssociatedCancerType.mainType.nameONCOKB_TX_17_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_17_levelAssociatedCancerType.tissueONCOKB_TX_17_levelAssociatedCancerType.parentONCOKB_TX_17_levelAssociatedCancerType.levelONCOKB_TX_17_levelAssociatedCancerType.tumorFormONCOKB_TX_18_alterationsONCOKB_TX_18_drugsONCOKB_TX_18_approvedIndicationsONCOKB_TX_18_levelONCOKB_TX_18_fdaLevelONCOKB_TX_18_levelExcludedCancerTypesONCOKB_TX_18_pmidsONCOKB_TX_18_abstractsONCOKB_TX_18_descriptionONCOKB_TX_18_levelAssociatedCancerType.idONCOKB_TX_18_levelAssociatedCancerType.codeONCOKB_TX_18_levelAssociatedCancerType.colorONCOKB_TX_18_levelAssociatedCancerType.nameONCOKB_TX_18_levelAssociatedCancerType.mainType.idONCOKB_TX_18_levelAssociatedCancerType.mainType.nameONCOKB_TX_18_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_18_levelAssociatedCancerType.tissueONCOKB_TX_18_levelAssociatedCancerType.parentONCOKB_TX_18_levelAssociatedCancerType.levelONCOKB_TX_18_levelAssociatedCancerType.tumorFormONCOKB_TX_19_alterationsONCOKB_TX_19_drugsONCOKB_TX_19_approvedIndicationsONCOKB_TX_19_levelONCOKB_TX_19_fdaLevelONCOKB_TX_19_levelExcludedCancerTypesONCOKB_TX_19_pmidsONCOKB_TX_19_abstractsONCOKB_TX_19_descriptionONCOKB_TX_19_levelAssociatedCancerType.idONCOKB_TX_19_levelAssociatedCancerType.codeONCOKB_TX_19_levelAssociatedCancerType.colorONCOKB_TX_19_levelAssociatedCancerType.nameONCOKB_TX_19_levelAssociatedCancerType.mainType.idONCOKB_TX_19_levelAssociatedCancerType.mainType.nameONCOKB_TX_19_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_19_levelAssociatedCancerType.tissueONCOKB_TX_19_levelAssociatedCancerType.parentONCOKB_TX_19_levelAssociatedCancerType.levelONCOKB_TX_19_levelAssociatedCancerType.tumorFormONCOKB_TX_20_alterationsONCOKB_TX_20_drugsONCOKB_TX_20_approvedIndicationsONCOKB_TX_20_levelONCOKB_TX_20_fdaLevelONCOKB_TX_20_levelExcludedCancerTypesONCOKB_TX_20_pmidsONCOKB_TX_20_abstractsONCOKB_TX_20_descriptionONCOKB_TX_20_levelAssociatedCancerType.idONCOKB_TX_20_levelAssociatedCancerType.codeONCOKB_TX_20_levelAssociatedCancerType.colorONCOKB_TX_20_levelAssociatedCancerType.nameONCOKB_TX_20_levelAssociatedCancerType.mainType.idONCOKB_TX_20_levelAssociatedCancerType.mainType.nameONCOKB_TX_20_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_20_levelAssociatedCancerType.tissueONCOKB_TX_20_levelAssociatedCancerType.parentONCOKB_TX_20_levelAssociatedCancerType.levelONCOKB_TX_20_levelAssociatedCancerType.tumorFormONCOKB_TX_21_alterationsONCOKB_TX_21_drugsONCOKB_TX_21_approvedIndicationsONCOKB_TX_21_levelONCOKB_TX_21_fdaLevelONCOKB_TX_21_levelExcludedCancerTypesONCOKB_TX_21_pmidsONCOKB_TX_21_abstractsONCOKB_TX_21_descriptionONCOKB_TX_21_levelAssociatedCancerType.idONCOKB_TX_21_levelAssociatedCancerType.codeONCOKB_TX_21_levelAssociatedCancerType.colorONCOKB_TX_21_levelAssociatedCancerType.nameONCOKB_TX_21_levelAssociatedCancerType.mainType.idONCOKB_TX_21_levelAssociatedCancerType.mainType.nameONCOKB_TX_21_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_21_levelAssociatedCancerType.tissueONCOKB_TX_21_levelAssociatedCancerType.parentONCOKB_TX_21_levelAssociatedCancerType.levelONCOKB_TX_21_levelAssociatedCancerType.tumorFormONCOKB_TX_22_alterationsONCOKB_TX_22_drugsONCOKB_TX_22_approvedIndicationsONCOKB_TX_22_levelONCOKB_TX_22_fdaLevelONCOKB_TX_22_levelExcludedCancerTypesONCOKB_TX_22_pmidsONCOKB_TX_22_abstractsONCOKB_TX_22_descriptionONCOKB_TX_22_levelAssociatedCancerType.idONCOKB_TX_22_levelAssociatedCancerType.codeONCOKB_TX_22_levelAssociatedCancerType.colorONCOKB_TX_22_levelAssociatedCancerType.nameONCOKB_TX_22_levelAssociatedCancerType.mainType.idONCOKB_TX_22_levelAssociatedCancerType.mainType.nameONCOKB_TX_22_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_22_levelAssociatedCancerType.tissueONCOKB_TX_22_levelAssociatedCancerType.parentONCOKB_TX_22_levelAssociatedCancerType.levelONCOKB_TX_22_levelAssociatedCancerType.tumorFormONCOKB_TX_23_alterationsONCOKB_TX_23_drugsONCOKB_TX_23_approvedIndicationsONCOKB_TX_23_levelONCOKB_TX_23_fdaLevelONCOKB_TX_23_levelExcludedCancerTypesONCOKB_TX_23_pmidsONCOKB_TX_23_abstractsONCOKB_TX_23_descriptionONCOKB_TX_23_levelAssociatedCancerType.idONCOKB_TX_23_levelAssociatedCancerType.codeONCOKB_TX_23_levelAssociatedCancerType.colorONCOKB_TX_23_levelAssociatedCancerType.nameONCOKB_TX_23_levelAssociatedCancerType.mainType.idONCOKB_TX_23_levelAssociatedCancerType.mainType.nameONCOKB_TX_23_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_23_levelAssociatedCancerType.tissueONCOKB_TX_23_levelAssociatedCancerType.parentONCOKB_TX_23_levelAssociatedCancerType.levelONCOKB_TX_23_levelAssociatedCancerType.tumorFormONCOKB_TX_24_alterationsONCOKB_TX_24_drugsONCOKB_TX_24_approvedIndicationsONCOKB_TX_24_levelONCOKB_TX_24_fdaLevelONCOKB_TX_24_levelExcludedCancerTypesONCOKB_TX_24_pmidsONCOKB_TX_24_abstractsONCOKB_TX_24_descriptionONCOKB_TX_24_levelAssociatedCancerType.idONCOKB_TX_24_levelAssociatedCancerType.codeONCOKB_TX_24_levelAssociatedCancerType.colorONCOKB_TX_24_levelAssociatedCancerType.nameONCOKB_TX_24_levelAssociatedCancerType.mainType.idONCOKB_TX_24_levelAssociatedCancerType.mainType.nameONCOKB_TX_24_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_24_levelAssociatedCancerType.tissueONCOKB_TX_24_levelAssociatedCancerType.parentONCOKB_TX_24_levelAssociatedCancerType.levelONCOKB_TX_24_levelAssociatedCancerType.tumorFormONCOKB_TX_25_alterationsONCOKB_TX_25_drugsONCOKB_TX_25_approvedIndicationsONCOKB_TX_25_levelONCOKB_TX_25_fdaLevelONCOKB_TX_25_levelExcludedCancerTypesONCOKB_TX_25_pmidsONCOKB_TX_25_abstractsONCOKB_TX_25_descriptionONCOKB_TX_25_levelAssociatedCancerType.idONCOKB_TX_25_levelAssociatedCancerType.codeONCOKB_TX_25_levelAssociatedCancerType.colorONCOKB_TX_25_levelAssociatedCancerType.nameONCOKB_TX_25_levelAssociatedCancerType.mainType.idONCOKB_TX_25_levelAssociatedCancerType.mainType.nameONCOKB_TX_25_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_25_levelAssociatedCancerType.tissueONCOKB_TX_25_levelAssociatedCancerType.parentONCOKB_TX_25_levelAssociatedCancerType.levelONCOKB_TX_25_levelAssociatedCancerType.tumorFormONCOKB_TX_26_alterationsONCOKB_TX_26_drugsONCOKB_TX_26_approvedIndicationsONCOKB_TX_26_levelONCOKB_TX_26_fdaLevelONCOKB_TX_26_levelExcludedCancerTypesONCOKB_TX_26_pmidsONCOKB_TX_26_abstractsONCOKB_TX_26_descriptionONCOKB_TX_26_levelAssociatedCancerType.idONCOKB_TX_26_levelAssociatedCancerType.codeONCOKB_TX_26_levelAssociatedCancerType.colorONCOKB_TX_26_levelAssociatedCancerType.nameONCOKB_TX_26_levelAssociatedCancerType.mainType.idONCOKB_TX_26_levelAssociatedCancerType.mainType.nameONCOKB_TX_26_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_26_levelAssociatedCancerType.tissueONCOKB_TX_26_levelAssociatedCancerType.parentONCOKB_TX_26_levelAssociatedCancerType.levelONCOKB_TX_26_levelAssociatedCancerType.tumorFormONCOKB_TX_27_alterationsONCOKB_TX_27_drugsONCOKB_TX_27_approvedIndicationsONCOKB_TX_27_levelONCOKB_TX_27_fdaLevelONCOKB_TX_27_levelExcludedCancerTypesONCOKB_TX_27_pmidsONCOKB_TX_27_abstractsONCOKB_TX_27_descriptionONCOKB_TX_27_levelAssociatedCancerType.idONCOKB_TX_27_levelAssociatedCancerType.codeONCOKB_TX_27_levelAssociatedCancerType.colorONCOKB_TX_27_levelAssociatedCancerType.nameONCOKB_TX_27_levelAssociatedCancerType.mainType.idONCOKB_TX_27_levelAssociatedCancerType.mainType.nameONCOKB_TX_27_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_27_levelAssociatedCancerType.tissueONCOKB_TX_27_levelAssociatedCancerType.parentONCOKB_TX_27_levelAssociatedCancerType.levelONCOKB_TX_27_levelAssociatedCancerType.tumorFormONCOKB_TX_28_alterationsONCOKB_TX_28_drugsONCOKB_TX_28_approvedIndicationsONCOKB_TX_28_levelONCOKB_TX_28_fdaLevelONCOKB_TX_28_levelExcludedCancerTypesONCOKB_TX_28_pmidsONCOKB_TX_28_abstractsONCOKB_TX_28_descriptionONCOKB_TX_28_levelAssociatedCancerType.idONCOKB_TX_28_levelAssociatedCancerType.codeONCOKB_TX_28_levelAssociatedCancerType.colorONCOKB_TX_28_levelAssociatedCancerType.nameONCOKB_TX_28_levelAssociatedCancerType.mainType.idONCOKB_TX_28_levelAssociatedCancerType.mainType.nameONCOKB_TX_28_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_28_levelAssociatedCancerType.tissueONCOKB_TX_28_levelAssociatedCancerType.parentONCOKB_TX_28_levelAssociatedCancerType.levelONCOKB_TX_28_levelAssociatedCancerType.tumorFormONCOKB_TX_29_alterationsONCOKB_TX_29_drugsONCOKB_TX_29_approvedIndicationsONCOKB_TX_29_levelONCOKB_TX_29_fdaLevelONCOKB_TX_29_levelExcludedCancerTypesONCOKB_TX_29_pmidsONCOKB_TX_29_abstractsONCOKB_TX_29_descriptionONCOKB_TX_29_levelAssociatedCancerType.idONCOKB_TX_29_levelAssociatedCancerType.codeONCOKB_TX_29_levelAssociatedCancerType.colorONCOKB_TX_29_levelAssociatedCancerType.nameONCOKB_TX_29_levelAssociatedCancerType.mainType.idONCOKB_TX_29_levelAssociatedCancerType.mainType.nameONCOKB_TX_29_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_29_levelAssociatedCancerType.tissueONCOKB_TX_29_levelAssociatedCancerType.parentONCOKB_TX_29_levelAssociatedCancerType.levelONCOKB_TX_29_levelAssociatedCancerType.tumorFormONCOKB_TX_30_alterationsONCOKB_TX_30_drugsONCOKB_TX_30_approvedIndicationsONCOKB_TX_30_levelONCOKB_TX_30_fdaLevelONCOKB_TX_30_levelExcludedCancerTypesONCOKB_TX_30_pmidsONCOKB_TX_30_abstractsONCOKB_TX_30_descriptionONCOKB_TX_30_levelAssociatedCancerType.idONCOKB_TX_30_levelAssociatedCancerType.codeONCOKB_TX_30_levelAssociatedCancerType.colorONCOKB_TX_30_levelAssociatedCancerType.nameONCOKB_TX_30_levelAssociatedCancerType.mainType.idONCOKB_TX_30_levelAssociatedCancerType.mainType.nameONCOKB_TX_30_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_30_levelAssociatedCancerType.tissueONCOKB_TX_30_levelAssociatedCancerType.parentONCOKB_TX_30_levelAssociatedCancerType.levelONCOKB_TX_30_levelAssociatedCancerType.tumorFormONCOKB_TX_31_alterationsONCOKB_TX_31_drugsONCOKB_TX_31_approvedIndicationsONCOKB_TX_31_levelONCOKB_TX_31_fdaLevelONCOKB_TX_31_levelExcludedCancerTypesONCOKB_TX_31_pmidsONCOKB_TX_31_abstractsONCOKB_TX_31_descriptionONCOKB_TX_31_levelAssociatedCancerType.idONCOKB_TX_31_levelAssociatedCancerType.codeONCOKB_TX_31_levelAssociatedCancerType.colorONCOKB_TX_31_levelAssociatedCancerType.nameONCOKB_TX_31_levelAssociatedCancerType.mainType.idONCOKB_TX_31_levelAssociatedCancerType.mainType.nameONCOKB_TX_31_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_31_levelAssociatedCancerType.tissueONCOKB_TX_31_levelAssociatedCancerType.parentONCOKB_TX_31_levelAssociatedCancerType.levelONCOKB_TX_31_levelAssociatedCancerType.tumorFormONCOKB_TX_32_alterationsONCOKB_TX_32_drugsONCOKB_TX_32_approvedIndicationsONCOKB_TX_32_levelONCOKB_TX_32_fdaLevelONCOKB_TX_32_levelExcludedCancerTypesONCOKB_TX_32_pmidsONCOKB_TX_32_abstractsONCOKB_TX_32_descriptionONCOKB_TX_32_levelAssociatedCancerType.idONCOKB_TX_32_levelAssociatedCancerType.codeONCOKB_TX_32_levelAssociatedCancerType.colorONCOKB_TX_32_levelAssociatedCancerType.nameONCOKB_TX_32_levelAssociatedCancerType.mainType.idONCOKB_TX_32_levelAssociatedCancerType.mainType.nameONCOKB_TX_32_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_32_levelAssociatedCancerType.tissueONCOKB_TX_32_levelAssociatedCancerType.parentONCOKB_TX_32_levelAssociatedCancerType.levelONCOKB_TX_32_levelAssociatedCancerType.tumorFormONCOKB_TX_33_alterationsONCOKB_TX_33_drugsONCOKB_TX_33_approvedIndicationsONCOKB_TX_33_levelONCOKB_TX_33_fdaLevelONCOKB_TX_33_levelExcludedCancerTypesONCOKB_TX_33_pmidsONCOKB_TX_33_abstractsONCOKB_TX_33_descriptionONCOKB_TX_33_levelAssociatedCancerType.idONCOKB_TX_33_levelAssociatedCancerType.codeONCOKB_TX_33_levelAssociatedCancerType.colorONCOKB_TX_33_levelAssociatedCancerType.nameONCOKB_TX_33_levelAssociatedCancerType.mainType.idONCOKB_TX_33_levelAssociatedCancerType.mainType.nameONCOKB_TX_33_levelAssociatedCancerType.mainType.tumorFormONCOKB_TX_33_levelAssociatedCancerType.tissueONCOKB_TX_33_levelAssociatedCancerType.parentONCOKB_TX_33_levelAssociatedCancerType.levelONCOKB_TX_33_levelAssociatedCancerType.tumorFormMUTATION_EFFECT_CITATIONSLEVEL_3BLEVEL_4LEVEL_R2TX_CITATIONSLEVEL_Dx1LEVEL_Dx2LEVEL_Dx3DX_CITATIONSLEVEL_Px1LEVEL_Px2LEVEL_Px3PX_CITATIONSDPPRSRCIViC_CSQ_AlleleCIViC_CSQ_ConsequenceCIViC_CSQ_SYMBOLCIViC_CSQ_Entrez Gene IDCIViC_CSQ_Feature_typeCIViC_CSQ_FeatureCIViC_CSQ_HGVScCIViC_CSQ_HGVSpCIViC_CSQ_CIViC Variant IDCIViC_CSQ_CIViC Variant AliasesCIViC_CSQ_CIViC Variant URLCIViC_CSQ_CIViC Molecular Profile NameCIViC_CSQ_CIViC Molecular Profile IDCIViC_CSQ_CIViC Molecular Profile AliasesCIViC_CSQ_CIViC Molecular Profile URLCIViC_CSQ_CIViC HGVSCIViC_CSQ_Allele Registry IDCIViC_CSQ_ClinVar IDsCIViC_CSQ_CIViC Molecular Profile ScoreCIViC_CSQ_CIViC Entity TypeCIViC_CSQ_CIViC Entity IDCIViC_CSQ_CIViC Entity URLCIViC_CSQ_CIViC Entity SourceCIViC_CSQ_CIViC Entity Variant OriginCIViC_CSQ_CIViC Entity StatusCIViC_CSQ_CIViC Entity Therapy Interaction TypeCIViC_CSQ_CIViC Evidence PhenotypesCIViC_CSQ_CIViC Evidence RatingCIViC_CSQ_CIViC Assertion ACMG CodesCIViC_CSQ_CIViC Assertion NCCN GuidelineCIViC_CSQ_CIViC Assertion FDA Companion Test
TUMORp.Q61RENSP00000358548.4:p.Gln61Argchr1114713908TCPASSNM_002524missense_variantMODERATENRAS3/7c.182A>Grs11554290&COSV54736340&COSV54736624&COSV54738969&COSV54747786SNVdeleterious_low_confidence(0.02)0.000.000.000.000.8885.5000e-01Vascular_malformation&Large_congenital_melanocytic_nevus&Colorectal_cancer&Neurocutaneous_melanocytosis&not_provided&Linear_nevus_sebaceous_syndrome&Epidermal_nevus&Non-small_cell_lung_carcinoma&Noonan_syndrome_6&Thyroid_cancer&_nonmedullary&_2NC_000001.11:g.114713908T>Ccriteria_provided&_multiple_submitters&_no_conflictsPathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongNRASQ61Rchr1:114713908-114713908v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot11/08/2024LEVEL_2TrueTrueTrueGain-of-functionOncogenicCobimetinib,TrametinibBinimetinib,Cobimetinib,Selumetinib+Iodine I 131-6-Beta-Iodomethyl-19-Norcholesterol,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_2LEVEL_R1LEVEL_Dx2LEVEL_Px155,230/1Q61R0.2948717948717949GRCh38NRASTCMissense_MutationSNPT114713908NRAS_Q61R.GT:AD:AF:DP0/1:55,23:0.29:78CENSG00000213281TranscriptENST00000369535protein_coding31318261Q/RcAa/cGa-1HGNCHGNC:7989YESMANE_SelectNM_002524.51P1CCDS877.1ENSP00000358548P01111.251Q5U091.171UPI0000001254EnsemblTT1PDB-ENSP_mappings:3con.A&PDB-ENSP_mappings:5uhv.A&PDB-ENSP_mappings:6e6h.A&PDB-ENSP_mappings:6mpp.B&PDB-ENSP_mappings:6wgh.A&PDB-ENSP_mappings:6wgh.B&PDB-ENSP_mappings:6zio.A&PDB-ENSP_mappings:6zio.B&PDB-ENSP_mappings:6zir.A&PDB-ENSP_mappings:6ziz.A&PDB-ENSP_mappings:6ziz.B&PDB-ENSP_mappings:7f68.A&PDB-ENSP_mappings:8tbi.A&PDB-ENSP_mappings:8tbi.B&PDB-ENSP_mappings:8vm2.A&PDB-ENSP_mappings:8vm2.B&PDB-ENSP_mappings:8vm2.C&SMART:SM00173&SMART:SM00175&SMART:SM00174&Superfamily:SSF52540&CDD:cd04138&PANTHER:PTHR24070&PROSITE_profiles:PS51419&PROSITE_profiles:PS51420&PROSITE_profiles:PS51421&Pfam:PF00071&NCBIFAM:TIGR00231&Gene3D:3.40.50.300&Prints:PR00449&AFDB-ENSP_mappings:AF-P01111-F1likely_pathogenic&pathogenic&uncertain_significance0&1&1&1&11&1&1&1&124033266&1654209&2278970&2674680&3122217&6587382&8120410&12460918&12727991&14508525&16273091&16291983&16434492&17699718&18390968&18633438&18948947&19075190&19880792&20130576&20149136&20179705&20406486&20619739&20736745&21107323&21305640&21576590&21729679&21829508&22407852&22499344&22761467&22773810&23392294&23414587&23515407&23538902&23569304&23614898&24006476&24370118&25032700&25157968&26619011&29525983&31752122&35117297&29721857&38684670FAIL6-42-6-1NRAS1390028939MONDO:MONDO:0024291&MedGen:C0158570&Human_Phenotype_Ontology:HP:0005600&Human_Phenotype_Ontology:HP:0005604&MONDO:MONDO:0044792&MedGen:C1842036&OMIM:137550&Orphanet:626&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500&MONDO:MONDO:0009578&MedGen:C0544862&OMIM:249400&Orphanet:2481&MedGen:C3661900&Human_Phenotype_Ontology:HP:0010817&MONDO:MONDO:0008097&MedGen:C4552097&OMIM:163200&Orphanet:2612&Human_Phenotype_Ontology:HP:0010816&MONDO:MONDO:0008093&MedGen:C0334082&OMIM:162900&Orphanet:79414&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&MONDO:MONDO:0013186&MedGen:C2750732&OMIM:613224&Orphanet:648&MONDO:MONDO:0008566&MedGen:C4225426&OMIM:188470SCV000061232&SCV000490986&SCV002525697&SCV004810324&SCV005902174&SCV006279548single_nucleotide_variantSO:0001483ClinGen:CA123618&OMIM:164790.0002&UniProtKB:P01111#VAR_006847NRAS:4893SO:0001583&missense_variantNodal_T-follicular_helper_cell_lymphoma&Neoplasm.&Human_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV00509416511554290Melanoma&Follicular_thyroid_carcinoma&Embryonal_rhabdomyosarcoma&Diffuse_midline_glioma&_H3_K27M-mutant&GerminomaHuman_Phenotype_Ontology:HP:0002861&Human_Phenotype_Ontology:HP:0002887&Human_Phenotype_Ontology:HP:0006777&Human_Phenotype_Ontology:HP:0007474&MONDO:MONDO:0005105&MeSH:D008545&MedGen:C0025202&Human_Phenotype_Ontology:HP:0006731&MONDO:MONDO:0005034&MedGen:C0206682&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0957196&MedGen:C4289688&Human_Phenotype_Ontology:HP:0100620&MONDO:MONDO:0002598&MedGen:C0206660SCV007104959&SCV007104971&SCV007104972&SCV0071055111:114713908-1147139081NRASp.Q61R.True.The NRAS Q61R mutation is located in the switch II region of the catalytic domain of the protein. This mutation has been found in melanoma and lung cancer and is a statistically significant hotspot (PMID:23515407, 30552700, 26619011). Knockdown of this endogenously expressed mutation in lung cancer and melanoma cell lines demonstrates that it is activating as measured by decreased cell proliferation, decreased tumor volume in xenograft models and decreased pathway activation compared to control knockdown (PMID: 23515407). Structural analysis of the Q61 residue demonstrates that it is crucial for NRAS GTP hydrolyzing activity suggesting that any mutation at Q61 would render the protein constitutively active (PMID: 10574788, 20194776, 9219684). In vitro studies have demonstrated that this mutation was resistant to the EGFR tyrosine kinase inhibitor, erlotinib, the ALK/MET/RON/ROS1 inhibitor, crizotinib, and the insulin-like growth factor-1 receptor inhibitor, linsitinib, and sensitive to two different MEK inhibitors, selumetinib and trametinib in lung cancer cell line models as measured by decreased cell viability and inhibited pathway activation in the presence of the drug (PMID: 23515407). In a basket trial of refractory solid tumors treated with a single-agent MEK inhibitor, binimetinib, eight patients with codon 61 NRAS-mutated colorectal cancer (n = 1 patient with Q61R) had a significantly longer OS and PFS compared to sixteen patients with colorectal cancer harboring a mutation in codon 12/13 (PMID: 33637626)..NRAS, a GTPase, is mutated in a diverse range of cancers, most frequently in melanoma and thyroid cancer...10574788|9219684|20194776|33637626|23515407|26619011|30552700LEVEL_Px1.Q61R4893NRASGRCh38.MUTATIONLEVEL_R1.The NRAS Q61R mutation is known to be oncogenic.FalseLEVEL_Fda2The NRAS Q61R mutation is located in the switch II region of the catalytic domain of the protein. This mutation has been found in melanoma and lung cancer and is a statistically significant hotspot (PMID:23515407, 30552700, 26619011). Knockdown of this endogenously expressed mutation in lung cancer and melanoma cell lines demonstrates that it is activating as measured by decreased cell proliferation, decreased tumor volume in xenograft models and decreased pathway activation compared to control knockdown (PMID: 23515407). Structural analysis of the Q61 residue demonstrates that it is crucial for NRAS GTP hydrolyzing activity suggesting that any mutation at Q61 would render the protein constitutively active (PMID: 10574788, 20194776, 9219684). In vitro studies have demonstrated that this mutation was resistant to the EGFR tyrosine kinase inhibitor, erlotinib, the ALK/MET/RON/ROS1 inhibitor, crizotinib, and the insulin-like growth factor-1 receptor inhibitor, linsitinib, and sensitive to two different MEK inhibitors, selumetinib and trametinib in lung cancer cell line models as measured by decreased cell viability and inhibited pathway activation in the presence of the drug (PMID: 23515407). In a basket trial of refractory solid tumors treated with a single-agent MEK inhibitor, binimetinib, eight patients with codon 61 NRAS-mutated colorectal cancer (n = 1 patient with Q61R) had a significantly longer OS and PFS compared to sixteen patients with colorectal cancer harboring a mutation in codon 12/13 (PMID: 33637626).['10574788', '9219684', '20194776', '33637626', '23515407', '26619011', '30552700']LEVEL_Dx2['Oncogenic Mutations']['26341525', '23690417'][{'abstract': 'Patel, B. et al., Abstract# Blood 124:1893, 2014.', 'link': 'http://www.bloodjournal.org/content/124/21/1893?sso-checked=true'}]This assertion is supported by (PMID: 23690417, 26341525, Abstract: Patel, B. et al., Abstract# Blood 124:1893, 2014. http://www.bloodjournal.org/content/124/21/1893?sso-checked=true).867.0CMMLLightSalmonChronic Myelomonocytic LeukemiaMyelodysplastic/Myeloproliferative NeoplasmsLIQUIDMyeloidMDS/MPN4.0LIQUIDLEVEL_Dx2['Oncogenic Mutations']['29146900', '24881041', '24030381', '21714648', '24220272']This assertion is supported by (PMID: 24881041, 21714648, 24220272, 24030381, 29146900).505.0MDSLightSalmonMyelodysplastic SyndromesMyelodysplastic SyndromesLIQUIDMyeloidMNM3.0LIQUIDLEVEL_Dx3['Oncogenic Mutations']['22237106']This assertion is supported by (PMID: 22237106).757.0ETPLLLimeGreenEarly T-Cell Precursor Lymphoblastic LeukemiaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidTLL4.0LIQUIDLEVEL_Dx2['Oncogenic Mutations']['10049057', '23832011', '25691160', '26457647', '12717436']This assertion is supported by (PMID: 23832011, 26457647, 12717436, 10049057, PMID: 25691160).813.0JMMLLightSalmonJuvenile Myelomonocytic LeukemiaMyelodysplastic/Myeloproliferative NeoplasmsLIQUIDMyeloidMDS/MPN4.0LIQUID['Oncogenic Mutations']CetuximabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR-expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring NRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']Tucatinib + TrastuzumabLEVEL_R1LEVEL_Fda2['30857956']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Patients with metastatic colorectal cancer harboring RAS mutations do not respond favorably to trastuzumab as seen in the MyPath trial. In the multiple basket MyPath Phase IIa trial of pertuzumab and trastuzumab in which 56 metastatic colorectal cancer patients with HER2 amplification received combination therapy, the objective response rate for patients with RAS wildtype colorectal cancer (43/56 patients) compared to RAS mutated colorectal cancer (13/56 patients) was 40% (17/43, 95% CI, 25%56%) versus 8% (1/13, 95% CI 0.2%36%), respectively (PMID: 30857956).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']PanitumumabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR-expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring NRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 0/12 patients with NRAS mutations), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).854.0ECDLightSalmonErdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase I trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with NRAS G12D), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MAP2K1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).855.0RDDLightSalmonRosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 0/12 patients with NRAS mutations), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).854.0ECDLightSalmonErdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase I trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with NRAS G12D), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MAP2K1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).855.0RDDLightSalmonRosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']BinimetinibLEVEL_3ALEVEL_Fda3['28284557', '16273091']Binimetinib is a small molecule inhibitor of MEK1/2 kinases. In the Phase III NEMO trial of binimetinib versus dacarbazine in melanoma harboring NRAS mutation, though there was no difference in median overall survival between the treatment arms (11.0 versus 10.1 months, respectively, HR = 1.0, p=0.5), median progression-free survival was longer with binimetinib than dacarbazine (3.0 months versus 1.8 months, respectively, HR = 0.63, p<0.001) and binimetinib treatment was associated with a higher number of patients with overall response and disease control than dacarbazine treatment (PMID: 28284557). Melanoma cell lines harboring NRAS activating mutations, such as NRAS Q61R, are sensitive to MEK inhibition in vitro, showing decreased RAS pathway signaling and decreased cell proliferation upon treatment with a MEK inhibitor (PMID: 16273091).257.0MELBlackMelanomaMelanomaSOLIDSkinSKIN2.0SOLID['Oncogenic Mutations']CobimetinibLEVEL_3ALEVEL_Fda3['30361829']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).38.0LightSalmonHistiocytosisLIQUIDMyeloid0.0LIQUID['Oncogenic Mutations']Selumetinib + Iodine I 131-6-Beta-Iodomethyl-19-NorcholesterolLEVEL_3ALEVEL_Fda3['22105174', '23406027']Selumetinib is a small molecule inhibitor of MEK1/2 kinases. In a clinical study of selumetinib in combination with radioiodine uptake therapy, five of five patients with radioiodine-refractory metastatic thyroid cancer harboring activating NRAS mutations (Q61R or Q61K) achieved dosimetry threshold for radioiodine uptake after selumetinib treatment, with four of five patients and one of five patients achieving partial response or stable disease, respectively (PMID: 23406027). Mouse models of dedifferentiated, radioiodine-refractory thyroid cancer harboring MAPK-activating mutations (such as BRAF V600E) showed re-expression of thyroid-specific genes and increased response to radioiodine after administration of a MEK inhibitor (PMID: 22105174).77.0TealThyroid CancerSOLIDThyroid0.0SOLID['Oncogenic Mutations']TrametinibLEVEL_3ALEVEL_Fda3['30361829']Trametinib and cobimetinib are small-molecule inhibitors of MEK1/2 kinases that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).38.0LightSalmonHistiocytosisLIQUIDMyeloid0.0LIQUID['Oncogenic Mutations']Binimetinib + RibociclibLEVEL_4LEVEL_Fda3['30819666', '29496665', '22983396'][{'abstract': 'Schuler et al. Abstract #9519, ASCO 2017.', 'link': 'http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.9519'}]Binimetinib is a small molecule inhibitor of MEK1/2 kinases. Ribociclib is a selective inhibitor of CDK4/6. In a Phase Ib/II trial of binimetinib in combination with ribociclib in melanoma harboring activating NRAS mutation, four of sixteen patients had partial responses and seven of sixteen patients had stable disease in response to combined drug treatment (Abstract: Schuler et al. Abstract #9519, ASCO 2017. http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.9519). A patient with melanoma harboring an NRAS G13R mutation had a partial response to binimetinib + ribociclib for four months before developing a PIK3CA resistance mutation and progressing (PMID: 29496665). Mouse allograft studies of melanoma harboring the NRAS Q61K mutation demonstrated synergistically decreased cell proliferation and tumor shrinkage in response to combined MEK1/2 and CDK4/6 inhibition compared to inhibition of either target alone (PMID: 22983396). In vitro studies have shown that resistance to combined MEK1/2 and CDK4/6 inhibition may occur through the reactivation of RAS and/or PI3K signaling (PMID: 30819666).257.0MELBlackMelanomaMelanomaSOLIDSkinSKIN2.0SOLID10574788;9219684;20194776;33637626;23515407;26619011;30552700Binimetinib+Ribociclib20921465;21228335;20619739;24024839;18316791;30857956;30867592;32991018;29236635;28284557;16273091;30361829;22105174;23406027;30819666;29496665;22983396;Schuler et al. Abstract #9519, ASCO 2017.(http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.9519)CMML,MDS,JMMLETPLL26341525;23690417;Patel, B. et al., Abstract# Blood 124:1893, 2014.(http://www.bloodjournal.org/content/124/21/1893?sso-checked=true);29146900;24881041;24030381;21714648;24220272;22237106;10049057;23832011;25691160;26457647;12717436MDS24881041;21714648;8329714;2422027278Cmissense_variantNRAS4893GeneENST00000369535.4ENST00000369535.4:c.182A>GNP_002515.1:p.Gln61Arg96GLN61ARG/RS11554290https://civicdb.org/links/variants/96NRAS_Q61R96NM_002524.4:c.182A>G/NP_002515.1:p.Gln61Arg/NC_000001.10:g.115256529T>C/ENST00000369535.4:c.182A>GCA12361813900
TUMORp.R132HENSP00000260985.2:p.Arg132Hischr2208248388CTPASSNM_005896missense_variantMODERATEIDH14/10c.395G>Ars121913500&CM1310533&COSV61615239&COSV61615420SNVtolerated_low_confidence(0.07)benign(0.009)9.578e-061.317e-053.826e-05gnomADe_ASJ0.000.000.040.020.8528.2900e-01Metaphyseal_chondromatosis&Metaphyseal_chondromatosis_with_D-2-hydroxyglutaric_aciduria&Enchondromatosis&Glioblastoma_multiforme&_somatic&not_provided&Glioma_susceptibility_1NC_000002.12:g.208248388C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenicOncogeniccriteria_provided&_single_submitter35criteria_provided&_single_submitterTier_I_-_StrongIDH1R132Hrs121913500✓ Hotspotv7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot08/10/2024LEVEL_1TrueTrueTrueSwitch-of-functionOncogenicIvosidenib,Olutasidenib,VorasidenibIvosidenibIvosidenibLEVEL_1LEVEL_1LEVEL_Dx2LEVEL_Px262,300/1R132H0.32608695652173914GRCh38IDH1CTMissense_MutationSNPC208248388IDH1_R132H.GT:AD:AF:DP0/1:62,30:0.33:92TENSG00000138413TranscriptENST00000345146protein_coding618395132R/HcGt/cAt-1HGNCHGNC:5382YESMANE_SelectNM_005896.41P1CCDS2381.1ENSP00000260985O75874.233A0A024R3Y6.24UPI000012D1B4EnsemblCC1PDB-ENSP_mappings:1t09.A&PDB-ENSP_mappings:1t09.B&PDB-ENSP_mappings:1t0l.A&PDB-ENSP_mappings:1t0l.B&PDB-ENSP_mappings:1t0l.C&PDB-ENSP_mappings:1t0l.D&Gene3D:3.40.718.10&PDB-ENSP_mappings:3inm.A&PDB-ENSP_mappings:3inm.B&PDB-ENSP_mappings:3inm.C&PDB-ENSP_mappings:3map.A&PDB-ENSP_mappings:3map.B&PDB-ENSP_mappings:3mar.A&PDB-ENSP_mappings:3mar.B&PDB-ENSP_mappings:3mas.A&PDB-ENSP_mappings:3mas.B&PDB-ENSP_mappings:4i3k.A&PDB-ENSP_mappings:4i3k.B&PDB-ENSP_mappings:4i3l.A&PDB-ENSP_mappings:4i3l.B&PDB-ENSP_mappings:4kzo.A&PDB-ENSP_mappings:4kzo.B&PDB-ENSP_mappings:4kzo.C&PDB-ENSP_mappings:4l03.A&PDB-ENSP_mappings:4l03.B&PDB-ENSP_mappings:4l03.C&PDB-ENSP_mappings:4l04.A&PDB-ENSP_mappings:4l04.B&PDB-ENSP_mappings:4l04.C&PDB-ENSP_mappings:4l04.D&PDB-ENSP_mappings:4l04.E&PDB-ENSP_mappings:4l04.F&PDB-ENSP_mappings:4l06.A&PDB-ENSP_mappings:4l06.B&PDB-ENSP_mappings:4l06.C&PDB-ENSP_mappings:4l06.D&PDB-ENSP_mappings:4l06.E&PDB-ENSP_mappings:4l06.F&PDB-ENSP_mappings:4umx.A&PDB-ENSP_mappings:4umx.B&PDB-ENSP_mappings:4umy.A&PDB-ENSP_mappings:4umy.B&PDB-ENSP_mappings:4xrx.A&PDB-ENSP_mappings:4xrx.B&PDB-ENSP_mappings:4xs3.A&PDB-ENSP_mappings:4xs3.B&PDB-ENSP_mappings:5de1.A&PDB-ENSP_mappings:5de1.B&PDB-ENSP_mappings:5gir.C&PDB-ENSP_mappings:5gir.D&PDB-ENSP_mappings:5k10.A&PDB-ENSP_mappings:5k10.B&PDB-ENSP_mappings:5k11.A&PDB-ENSP_mappings:5k11.B&PDB-ENSP_mappings:5l57.A&PDB-ENSP_mappings:5l58.A&PDB-ENSP_mappings:5lge.A&PDB-ENSP_mappings:5lge.B&PDB-ENSP_mappings:5lge.C&PDB-ENSP_mappings:5lge.D&PDB-ENSP_mappings:5sun.A&PDB-ENSP_mappings:5sun.B&PDB-ENSP_mappings:5svf.A&PDB-ENSP_mappings:5svf.B&PDB-ENSP_mappings:5svf.C&PDB-ENSP_mappings:5svf.D&PDB-ENSP_mappings:5tqh.A&PDB-ENSP_mappings:5tqh.B&PDB-ENSP_mappings:5tqh.C&PDB-ENSP_mappings:5tqh.D&PDB-ENSP_mappings:5yfm.A&PDB-ENSP_mappings:5yfm.B&PDB-ENSP_mappings:5yfm.C&PDB-ENSP_mappings:5yfn.A&PDB-ENSP_mappings:5yfn.B&PDB-ENSP_mappings:6adg.A&PDB-ENSP_mappings:6adg.B&PDB-ENSP_mappings:6adg.C&PDB-ENSP_mappings:6b0z.A&PDB-ENSP_mappings:6b0z.B&PDB-ENSP_mappings:6b0z.C&PDB-ENSP_mappings:6b0z.D&PDB-ENSP_mappings:6bkx.A&PDB-ENSP_mappings:6bkx.B&PDB-ENSP_mappings:6bkx.C&PDB-ENSP_mappings:6bky.A&PDB-ENSP_mappings:6bky.B&PDB-ENSP_mappings:6bky.C&PDB-ENSP_mappings:6bky.D&PDB-ENSP_mappings:6bky.E&PDB-ENSP_mappings:6bky.F&PDB-ENSP_mappings:6bkz.A&PDB-ENSP_mappings:6bkz.B&PDB-ENSP_mappings:6bl0.A&PDB-ENSP_mappings:6bl0.B&PDB-ENSP_mappings:6bl0.C&PDB-ENSP_mappings:6bl1.A&PDB-ENSP_mappings:6bl1.B&PDB-ENSP_mappings:6bl1.C&PDB-ENSP_mappings:6bl2.A&PDB-ENSP_mappings:6bl2.B&PDB-ENSP_mappings:6bl2.C&PDB-ENSP_mappings:6io0.A&PDB-ENSP_mappings:6io0.B&PDB-ENSP_mappings:6o2y.A&PDB-ENSP_mappings:6o2y.B&PDB-ENSP_mappings:6o2y.C&PDB-ENSP_mappings:6o2z.A&PDB-ENSP_mappings:6o2z.B&PDB-ENSP_mappings:6pay.A&PDB-ENSP_mappings:6pay.B&PDB-ENSP_mappings:6pay.C&PDB-ENSP_mappings:6pay.D&PDB-ENSP_mappings:6q6f.A&PDB-ENSP_mappings:6q6f.B&PDB-ENSP_mappings:6u4j.A&PDB-ENSP_mappings:6u4j.B&PDB-ENSP_mappings:6vei.A&PDB-ENSP_mappings:6vei.B&PDB-ENSP_mappings:6vg0.A&PDB-ENSP_mappings:6vg0.B&PDB-ENSP_mappings:6vg0.C&PDB-ENSP_mappings:7pjm.A&PDB-ENSP_mappings:7pjm.B&PDB-ENSP_mappings:7pjm.C&PDB-ENSP_mappings:7pjn.A&PDB-ENSP_mappings:7pjn.B&PDB-ENSP_mappings:7pjn.C&PDB-ENSP_mappings:7pjn.D&PDB-ENSP_mappings:8bay.A&PDB-ENSP_mappings:8bay.B&PDB-ENSP_mappings:8bay.C&PDB-ENSP_mappings:8hb9.AAA&PDB-ENSP_mappings:8hb9.BBB&PDB-ENSP_mappings:8hb9.CCC&PDB-ENSP_mappings:8hb9.DDD&PDB-ENSP_mappings:8t7d.A&PDB-ENSP_mappings:8t7d.B&PDB-ENSP_mappings:8t7d.C&PDB-ENSP_mappings:8t7d.D&PDB-ENSP_mappings:8t7n.A&PDB-ENSP_mappings:8t7n.B&PDB-ENSP_mappings:8t7o.A&PDB-ENSP_mappings:8t7o.B&PDB-ENSP_mappings:8vh9.A&PDB-ENSP_mappings:8vh9.B&PDB-ENSP_mappings:8vha.A&PDB-ENSP_mappings:8vha.B&PDB-ENSP_mappings:8vha.C&PDB-ENSP_mappings:8vha.D&PDB-ENSP_mappings:8vhb.A&PDB-ENSP_mappings:8vhb.B&PDB-ENSP_mappings:8vhb.C&PDB-ENSP_mappings:8vhb.D&PDB-ENSP_mappings:8vhc.A&PDB-ENSP_mappings:8vhc.B&PDB-ENSP_mappings:8vhd.A&PDB-ENSP_mappings:8vhd.B&PDB-ENSP_mappings:8vhd.C&PDB-ENSP_mappings:8vhd.D&PDB-ENSP_mappings:8vhe.A&PDB-ENSP_mappings:8vhe.B&PDB-ENSP_mappings:8vhe.C&PDB-ENSP_mappings:8vhe.D&AFDB-ENSP_mappings:AF-O75874-F1&Pfam:PF00180&PIRSF:PIRSF000108&PANTHER:PTHR11822&SMART:SM01329&Superfamily:SSF53659&NCBIFAM:TIGR0012702.236e-053.826e-052.519e-053.744e-0507.195e-0601.159e-0500000002.942e-0500pathogenic&not_provided&pathogenic/likely_pathogenic&likely_pathogenic0&1&1&11&1&1&132069381&25157968&26619011&19657110&32326111&22160010&22397365&22417203&22898539&18772396&19798509&19818334&21446021&23558169&24606448&25043048&31371350&34854890&36061173&29066617&36233525&35509721&33106175&34946913&36201590&37478088&37774069&38409772&39110525&39165999FAIL35335-19IDH11564440.00002166215.&MONDO:MONDO:0013941&MedGen:C3553958&OMIM:614875&Orphanet:99646&Human_Phenotype_Ontology:HP:0005701&MONDO:MONDO:0008145&MedGen:C0014084&OMIM:166000&Orphanet:296&MedGen:C4016231&MedGen:C3661900&MONDO:MONDO:0024498&MedGen:C2750850&OMIM:137800SCV000996209&SCV001449548&SCV002507195&SCV002764259&SCV004011290&SCV004099007&SCV005438530&SCV005685410single_nucleotide_variantSO:0001483ClinGen:CA170874&OMIM:147700.0001&UniProtKB:O75874#VAR_055455IDH1:3417SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094442121913500Acute_myeloid_leukemia_with_NPM1_somatic_mutations&Astrocytoma_IDH-mutant&OligodendrogliomaMONDO:MONDO:0018437&MedGen:C4706386&Orphanet:402026&MedGen:C5669733&Human_Phenotype_Ontology:HP:0033681&MONDO:MONDO:0016695&MeSH:D009837&MedGen:C0028945&Orphanet:251627SCV007105305&SCV007105307&SCV0071053112:208248388-208248388IDH1p.R132H.True.The IDH1 R132H mutation is located in the catalytic site of the IDH1 protein. This mutation has been found in acute myeloid leukemia and gliomas, among others (PMID: 19935646, 29860938). In vitro and in vivo studies have demonstrated that this mutation changes IDH1 enzymatic activity, allowing for the conversion of -ketoglutarate (-KG) to the "oncometabolite" D-2-hydroxyglutarate (2-HG), and leads to oncogenic activity, as evidenced by aberrant changes in DNA methylation, cytokine independence, dedifferentiation and in vivo increases in early hematopoietic progenitors compared to wildtype IDH1 (PMID: 19935646, 22763442, 23393090). IDH1 mutations at the R132 residue, including R132H, are sensitive to inhibition by AG-120 (Ivosidenib), a small-molecule inhibitor of mutant IDH1, as measured by a decrease in 2-HG level, an increase in the proportion of mature myeloid cells and increased levels of cell surface differentiation markers in treated cells compared to untreated cells (PMID: 29670690). A Phase I clinical trial for ivosidenib involving 268 patients with relapsed or refractory AML harboring IDH1 R132 mutations, including 59 with IDH1 R132H mutation, achieved an overall response rate of 41.6% and a reduction in the percentage of bone marrow blasts in treated patients (PMID: 29860938)..IDH1, a cell metabolism enzyme, is recurrently mutated in various cancer types including acute myeloid leukemia and gliomas...23393090|22763442|29670690|19935646|29860938LEVEL_Px2.R132H3417IDH1GRCh38.MUTATION..The IDH1 R132H mutation is known to be oncogenic.FalseLEVEL_Fda2The IDH1 R132H mutation is located in the catalytic site of the IDH1 protein. This mutation has been found in acute myeloid leukemia and gliomas, among others (PMID: 19935646, 29860938). In vitro and in vivo studies have demonstrated that this mutation changes IDH1 enzymatic activity, allowing for the conversion of -ketoglutarate (-KG) to the "oncometabolite" D-2-hydroxyglutarate (2-HG), and leads to oncogenic activity, as evidenced by aberrant changes in DNA methylation, cytokine independence, dedifferentiation and in vivo increases in early hematopoietic progenitors compared to wildtype IDH1 (PMID: 19935646, 22763442, 23393090). IDH1 mutations at the R132 residue, including R132H, are sensitive to inhibition by AG-120 (Ivosidenib), a small-molecule inhibitor of mutant IDH1, as measured by a decrease in 2-HG level, an increase in the proportion of mature myeloid cells and increased levels of cell surface differentiation markers in treated cells compared to untreated cells (PMID: 29670690). A Phase I clinical trial for ivosidenib involving 268 patients with relapsed or refractory AML harboring IDH1 R132 mutations, including 59 with IDH1 R132H mutation, achieved an overall response rate of 41.6% and a reduction in the percentage of bone marrow blasts in treated patients (PMID: 29860938).['23393090', '22763442', '29670690', '19935646', '29860938']LEVEL_Dx2['R132']['22389253', '25465125', '20962861', '24220272', '24030381', '21714648', '26228814']This assertion is supported by (PMID: 21714648, 24220272, 24030381, 22389253, 25465125, 26228814, 20962861).505.0MDSLightSalmonMyelodysplastic SyndromesMyelodysplastic SyndromesLIQUIDMyeloidMNM3.0LIQUIDLEVEL_Dx2['Oncogenic Mutations']['22417203', '20538800', '22397365', '19657110', '20097881', '20368543', '20567020']This assertion is supported by (PMID: 22417203, 20538800, 22397365, 20097881, 20368543, 19657110, 20567020).654.0AMLLightSalmonAcute Myeloid LeukemiaLeukemiaLIQUIDMyeloidMNM3.0LIQUIDLEVEL_Dx3['Oncogenic Mutations']['23349305', '25573287']This assertion is supported by (PMID: 25573287, 23349305).767.0TMNLightSalmonTherapy-Related Myeloid NeoplasmsLeukemiaLIQUIDMyeloidAML4.0LIQUID['R132C', 'R132H', 'R132G', 'R132S', 'R132L']IvosidenibLEVEL_1LEVEL_Fda2['23393090', '29860938', '23558169'][{'abstract': 'Smith et al. Abstract# 971, 2023 ASH Annual Meeting & Exposition.', 'link': 'https://ash.confex.com/ash/2023/webprogram/Paper173033.html'}, {'abstract': 'Hansen et al. Abstract# 3734, ASH 2014.', 'link': 'http://www.bloodjournal.org/content/124/21/3734?sso-checked=true'}, {'abstract': 'Dohner et al. Abstract# 7042, ASCO 2022.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.16_suppl.7042'}]Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation. FDA approval was based on the results from a Phase I dose escalation and expansion study of ivosidenib in IDH1-mutant AML in which 27 and eleven of 125 patients who received ivosidenib achieved complete remission and complete remission with partial hematologic recovery, respectfully, yielding a complete response rate of 30.4% (PMID: 29860938). In the multicenter, double-blind, randomized, placebo-controlled Phase III AGILE study of combination treatment of ivosidenib and azacitidine in 146 patients with newly diagnosed, untreated IDH1-mutant AML (ivosidenib plus azacitidine treatment, n=72, placebo and azacitidine treatment, n=72), 46.2% maintained red blood cell transfusion independence in the ivosidenib plus azacitidine group and 17.5% in the placebo plus azacitidine group (Abstract: Dohner et al. Abstract# 7042, ASCO 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.16_suppl.7042). In a real-world retrospective study of ivosidenib plus hypomethylating agent versus venetoclax plus hypomethylating agent in 283 patients with IDH1-mutant AML, the ivosidenib cohort (n=182) demonstrated a complete response of 42.9% and a median time to best response of 3.3 months versus 26.7% (p=0.007) and 4.1 months (p=0.02), respectively, in the venetoclax cohort (n=101) (Abstract: Smith et al. Abstract# 971, 2023 ASH Annual Meeting & Exposition. https://ash.confex.com/ash/2023/webprogram/Paper173033.html). Preclinical studies in glioma and acute myeloid leukemia (AML) models demonstrated that ivosidenib promotes cellular differentiation by inhibiting the production of the mutant IDH1 "oncometabolite," 2-hydroxyglutarate (2-HG), which can inhibit cell growth in vitro (PMID: 23558169, 23393090) (Abstract: Hansen et al. Abstract# 3734, ASH 2014. http://www.bloodjournal.org/content/124/21/3734?sso-checked=true).654.0AMLLightSalmonAcute Myeloid LeukemiaLeukemiaLIQUIDMyeloidMNM3.0LIQUID['R132C', 'R132H', 'R132G', 'R132S', 'R132L']IvosidenibLEVEL_1LEVEL_Fda2['32416072', '34554208']Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for the treatment of IDH1-mutant cholangiocarcinoma as detected by an FDA-approved test. FDA approval was based on the results of the Phase III ClarIDHy trial of ivosidenib versus placebo in 185 patients with IDH1-mutant cholangiocarcinoma in which the median progression-free survival was 2.7 months in the patients treated with ivosidenib compared to 1.4 months in the patients receiving placebo, with six- and twelve-month progression-free survival rates in the ivosidenib group of 32% and 21.9%, respectively (HR= 0.37, 95% CI= 0.25-0.54, p < 0.001) (PMID: 32416072). Overall survival was 10.8 months in the ivosidenib group versus six months (adjusted for crossover) for the placebo group (HR= 0.46, p = 0.0008) (PMID: 32416072). Final results demonstrated a mean overall survival of 10.3 months (95% CI= 7.8-12.4 months) with ivosidenib vs 7.5 months (95% CI= 4.8-11.1 months) with placebo (HR= 0.79 [95% CI, 0.56-1.12], p = .09) (PMID: 34554208).641.0CHOLGreenCholangiocarcinomaHepatobiliary CancerSOLIDBiliary TractIPN3.0SOLID['R132C', 'R132H', 'R132G', 'R132S', 'R132L']IvosidenibLEVEL_1LEVEL_Fda2['32416072', '34554208']Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for the treatment of IDH1-mutant cholangiocarcinoma as detected by an FDA-approved test. FDA approval was based on the results of the Phase III ClarIDHy trial of ivosidenib versus placebo in 185 patients with IDH1-mutant cholangiocarcinoma in which the median progression-free survival was 2.7 months in the patients treated with ivosidenib compared to 1.4 months in the patients receiving placebo, with six- and twelve-month progression-free survival rates in the ivosidenib group of 32% and 21.9%, respectively (HR= 0.37, 95% CI= 0.25-0.54, p < 0.001) (PMID: 32416072). Overall survival was 10.8 months in the ivosidenib group versus six months (adjusted for crossover) for the placebo group (HR= 0.46, p = 0.0008) (PMID: 32416072). Final results demonstrated a mean overall survival of 10.3 months (95% CI= 7.8-12.4 months) with ivosidenib vs 7.5 months (95% CI= 4.8-11.1 months) with placebo (HR= 0.79 [95% CI, 0.56-1.12], p = .09) (PMID: 34554208).862.0IHCHGreenIntrahepatic CholangiocarcinomaHepatobiliary CancerSOLIDBiliary TractCHOL4.0SOLID['R132C', 'R132H', 'R132G', 'R132S', 'R132L']IvosidenibLEVEL_1LEVEL_Fda2[{'abstract': 'DiNardo et al. Abstract# MDS-457, Clinical Lymphoma, Myeloma and Leukemia Vol 23, Supplement 1.', 'link': 'https://www.sciencedirect.com/science/article/pii/S2152265023011898'}]Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for the treatment of IDH1 R132-mutant myelodysplastic syndromes. FDA approval was based on the results of the AG120-C-001 trial of ivosidenib in 18 patients with IDH1-mutant myelodysplastic syndrome in which 7 patients demonstrated complete remission (38.9%, 95% CI = 17.3, 64.3) with a non-evaluable (range = 1.9, 80.8 months) median complete remission duration (Abstract: DiNardo et al. Abstract# MDS-457, Clinical Lymphoma, Myeloma and Leukemia Vol 23, Supplement 1. https://www.sciencedirect.com/science/article/pii/S2152265023011898).107.0LightSalmonMyelodysplastic SyndromesLIQUIDMyeloid0.0LIQUID['R132C', 'R132H', 'R132G', 'R132S', 'R132L']OlutasidenibLEVEL_1LEVEL_Fda2[{'abstract': 'Cortes et al. Abstract #6193, ASH 2022.', 'link': 'https://ashpublications.org/blood/article/140/Supplement%201/6193/487212'}]Olutasidenib is a small-molecule inhibitor of mutant IDH1 that is FDA-approved in patients with acute myeloid leukemia (AML) with a susceptible IDH1 mutation. FDA approval was based on the results of the Phase II cohort of the phase I/II trial (Study 2102-HEM-101) of olutasidenib in 147 evaluable IDH1 inhibitor-nave patients with relapsed/refractory IDH1 R132-mutant AML in which the complete remission (CR) plus complete remission with partial hematologic recovery (CRh) rate was 35% (n=51, 95%CI= 27, 43), with a median duration of CR + CRh of 25.9 months (95% CI= 13.5, NR). The median duration of CR alone was 28.1 months (95% CI= 13.8, NR), and the observed duration of CRh (n=4) was 1.8, 5.6, 13.5 and 28.5+ months, respectively (Abstract: Cortes et al. Abstract #6193, ASH 2022. https://ashpublications.org/blood/article/140/Supplement%201/6193/487212).654.0AMLLightSalmonAcute Myeloid LeukemiaLeukemiaLIQUIDMyeloidMNM3.0LIQUID['R132C', 'R132H', 'R132G', 'R132S', 'R132L']VorasidenibLEVEL_1LEVEL_Fda2['37272516']Vorasidenib is an orally available, small molecule inhibitor of IDH1/2 that is FDA approved for the treatment of adult and pediatric patients twelve years and older with grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation, following surgery including biopsy, sub-total resection, or gross total resection. FDA approval is based on the results of the Phase III INDIGO (NCT04164901) trial of vorasidenib versus placebo in 331 patients with IDH1/2-mutant low-grade glioma. In the Phase III INDIGO (NCT04164901) trial, the vorasidenib cohort (n=168 [n=163, IDH1 mutant, n=5, IDH2 mutant]) demonstrated a median imaging-based progression-free survival (PFS) of 27.7 months (95% CI=17.0-NE) and the time to next intervention (TTNT) was 85.6% (95% CI=77.8-90.8) at eighteen months and 83.4% (95% CI=74.0-89.6) at 24 months while the placebo cohort (n=163 [n=152, IDH1 mutant, n=11, IDH2 mutant]) demonstrated a median imaging-based PFS of 11.1 months (95% CI=11.0-13.7) (HR=0.39 [95% CI=0.27-0.56], p<0.001) and the TTNT was 47.4% (95% CI=35.8-58.2) at eighteen months and 27.0% (95% CI=7.9-50.8) at 24 months (PMID: 37272516).868.0ASTRGrayAstrocytoma, IDH-MutantGliomaSOLIDCNS/BrainADIFG4.0SOLID['R132C', 'R132H', 'R132G', 'R132S', 'R132L']VorasidenibLEVEL_1LEVEL_Fda2['37272516']Vorasidenib is an orally available, small molecule inhibitor of IDH1/2 that is FDA approved for the treatment of adult and pediatric patients twelve years and older with grade 2 astrocytoma or oligodendroglioma with a susceptible IDH1 or IDH2 mutation, following surgery including biopsy, sub-total resection, or gross total resection. FDA approval is based on the results of the Phase III INDIGO (NCT04164901) trial of vorasidenib versus placebo in 331 patients with IDH1/2-mutant low-grade glioma. In the Phase III INDIGO (NCT04164901) trial, the vorasidenib cohort (n=168 [n=163, IDH1 mutant, n=5, IDH2 mutant]) demonstrated a median imaging-based progression-free survival (PFS) of 27.7 months (95% CI=17.0-NE) and the time to next intervention (TTNT) was 85.6% (95% CI=77.8-90.8) at eighteen months and 83.4% (95% CI=74.0-89.6) at 24 months while the placebo cohort (n=163 [n=152, IDH1 mutant, n=11, IDH2 mutant]) demonstrated a median imaging-based PFS of 11.1 months (95% CI=11.0-13.7) (HR=0.39 [95% CI=0.27-0.56], p<0.001) and the TTNT was 47.4% (95% CI=35.8-58.2) at eighteen months and 27.0% (95% CI=7.9-50.8) at 24 months (PMID: 37272516).790.0ODGGrayOligodendroglioma, IDH-mutant, and 1p/19q-CodeletedGliomaSOLIDCNS/BrainADIFG4.0SOLID['Oncogenic Mutations']IvosidenibLEVEL_2LEVEL_Fda2['32530764']Ivosidenib is an orally available, small-molecule IDH1 inhibitor that is FDA-approved for adult patients with a susceptible IDH1 mutation, as detected by an FDA-approved test, with acute myeloid leukemia or locally advanced or metastatic cholangiocarcinoma. Ivosidenib is also recommended in the NCCN Central Nervous System Cancers Guidelines (V1.2024) as an adjuvant treatment option that is "Useful in Certain Circumstances" for patients with IDH1-mutant grade 2 oligodendroglioma or astrocytoma. NCCN recommendation is based on the results of the Phase I AG120-C-002 (NCT02073994) trial of ivosidenib in 66 patients with IDH1-mutant advanced glioma (n=35, non-enhancing glioma, n=31, enhancing glioma). In the Phase I AG120-C-002 (NCT02073994) trial, the nonenhancing glioma cohort demonstrated a 2.9% (n=1) partial response rate, an 85.7% (n=30) stable disease (SD) rate and a median progression-free survival (PFS) of 13.6 months (95% CI=9.2-33.2), while the enhancing glioma cohort demonstrated a 45.2% SD rate and a median PFS of 1.4 months (95% CI=1.0-1.9) (PMID: 32530764).868.0ASTRGrayAstrocytoma, IDH-MutantGliomaSOLIDCNS/BrainADIFG4.0SOLID['Oncogenic Mutations']IvosidenibLEVEL_2LEVEL_Fda2['32530764']Ivosidenib is an orally available, small-molecule IDH1 inhibitor that is FDA-approved for adult patients with a susceptible IDH1 mutation, as detected by an FDA-approved test, with acute myeloid leukemia or locally advanced or metastatic cholangiocarcinoma. Ivosidenib is also recommended in the NCCN Central Nervous System Cancers Guidelines (V1.2024) as an adjuvant treatment option that is "Useful in Certain Circumstances" for patients with IDH1-mutant grade 2 oligodendroglioma or astrocytoma. NCCN recommendation is based on the results of the Phase I AG120-C-002 (NCT02073994) trial of ivosidenib in 66 patients with IDH1-mutant advanced glioma (n=35, non-enhancing glioma, n=31, enhancing glioma). In the Phase I AG120-C-002 (NCT02073994) trial, the nonenhancing glioma cohort demonstrated a 2.9% (n=1) partial response rate, an 85.7% (n=30) stable disease (SD) rate and a median progression-free survival (PFS) of 13.6 months (95% CI=9.2-33.2), while the enhancing glioma cohort demonstrated a 45.2% SD rate and a median PFS of 1.4 months (95% CI=1.0-1.9) (PMID: 32530764).790.0ODGGrayOligodendroglioma, IDH-mutant, and 1p/19q-CodeletedGliomaSOLIDCNS/BrainADIFG4.0SOLID['Oncogenic Mutations']IvosidenibLEVEL_2LEVEL_Fda2['32208957']Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation. Ivosidenib is listed in the Bone Cancer NCCN (v1.2021) as a category 2A recommendation for patients with IDH1-mutant chondrosarcoma. In a Phase I study of ivosidenib in 21 patients with IDH1-mutant chondrosarcoma, the median progression-free survival was 5.6 months (95%CI= 1.9 to 7.4 mos) with eleven of 21 patients having stable disease (PMID: 32208957).346.0CHSWhiteChondrosarcomaBone CancerSOLIDBoneBONE2.0SOLID['R132']IvosidenibLEVEL_3ALEVEL_Fda3['29670690', '32530764']Ivosidenib is a small molecule inhibitor of mutant IDH1 that is FDA-approved for adult patients with relapsed or refractory acute myeloid leukemia (AML) with a susceptible IDH1 mutation. In a clinical trial of ivosidenib in 66 patients with IDH1-mutant glioma, one patient with non-enhancing glioma (n= 1 of 35) had a partial response and 30 patients (n= 30 of 35) had stable disease, with an objective response rate in the cohort of 2.9% and a median progression-free survival of 13.6 months (95% CI= 9.2 to 33.2 months)(PMID: 29670690). Preclinical studies have demonstrated the efficacy of ivosidenib in reducing 2-HG levels in IDH1-mutant tumor models (PMID: 32530764).87.0GrayGliomaSOLIDCNS/Brain0.0SOLID23393090;22763442;29670690;19935646;2986093823393090;29860938;23558169;Smith et al. Abstract# 971, 2023 ASH Annual Meeting & Exposition.(https://ash.confex.com/ash/2023/webprogram/Paper173033.html);Hansen et al. Abstract# 3734, ASH 2014.(http://www.bloodjournal.org/content/124/21/3734?sso-checked=true);Dohner et al. Abstract# 7042, ASCO 2022.(https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.16_suppl.7042);32416072;34554208;DiNardo et al. Abstract# MDS-457, Clinical Lymphoma, Myeloma and Leukemia Vol 23, Supplement 1.(https://www.sciencedirect.com/science/article/pii/S2152265023011898);Cortes et al. Abstract #6193, ASH 2022.(https://ashpublications.org/blood/article/140/Supplement%201/6193/487212);37272516;32530764;32208957;29670690MDS,AMLTMN22389253;25465125;20962861;24220272;24030381;21714648;26228814;22417203;20538800;22397365;19657110;20097881;20368543;20567020;23349305;25573287PMF23619563;2666868092Tmissense_variantIDH13417GeneENST00000415913.1ENST00000415913.1:c.395G>ANP_005887.2:p.Arg132His420ARG132HIS/RS121913500https://civicdb.org/links/variants/420IDH1_R132H416NM_001282386.1:c.395G>A/NP_005887.2:p.Arg132His/NC_000002.11:g.209113112C>T/ENST00000415913.1:c.395G>ACA170874156444
TUMORp.E545KENSP00000263967.3:p.Glu545Lyschr3179218303GAPASSNM_006218missense_variantMODERATEPIK3CA10/21c.1633G>Ars104886003&CM126692&COSV55873239&COSV55878227SNVdeleterious(0)probably_damaging(0.912)0.000.000.000.000.6542.2100e-01HEMIFACIAL_MYOHYPERPLASIA&_SOMATIC&PIK3CA_overgrowth_syndrome&Rare_combined_vascular_malformation&Rare_venous_malformation&Eccrine_angiomatous_hamartoma&Cerebrofacial_Vascular_Metameric_Syndrome_(CVMS)&PIK3CA-related_disorder&Gallbladder_cancer&Gastric_cancer&Sarcoma&PIK3CA_related_overgrowth_syndrome&Angioosteohypertrophic_syndrome&not_provided&Megalencephaly-capillary_malformation-polymicrogyria_syndrome&CLOVES_syndrome&Ovarian_neoplasm&Seborrheic_keratosis&OVARIAN_CANCER&_EPITHELIAL&_SOMATIC&Non-small_cell_lung_carcinoma&Carcinoma_of_colon&Breast_adenocarcinoma&Abnormal_cardiovascular_system_morphology&Segmental_undergrowth_associated_with_lymphatic_malformationNC_000003.12:g.179218303G>Acriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongPIK3CAE545Kchr3:179218303-179218303v7.0.LEVEL_Fda2✓ Hotspot10/16/2024LEVEL_1TrueTrueTrueGain-of-functionOncogenicAlpelisib+Fulvestrant,Capivasertib+Fulvestrant,Inavolisib+Palbociclib+FulvestrantLEVEL_1LEVEL_158,320/1E545K0.35555555555555557GRCh38PIK3CAGAMissense_MutationSNPG179218303PIK3CA_E545K.GT:AD:AF:DP0/1:58,32:0.35:90AENSG00000121879TranscriptENST00000263967protein_coding19561633545E/KGag/Aag1HGNCHGNC:8975YESMANE_SelectNM_006218.42P1CCDS43171.1ENSP00000263967P42336.236UPI000013D494EnsemblGG1Gene3D:1.25.40.70&PDB-ENSP_mappings:2rd0.A&PDB-ENSP_mappings:3hhm.A&PDB-ENSP_mappings:3hiz.A&PDB-ENSP_mappings:3zim.A&PDB-ENSP_mappings:4jps.A&PDB-ENSP_mappings:4l1b.A&PDB-ENSP_mappings:4l23.A&PDB-ENSP_mappings:4l2y.A&PDB-ENSP_mappings:4ovu.A&PDB-ENSP_mappings:4ovv.A&PDB-ENSP_mappings:4tuu.A&PDB-ENSP_mappings:4tv3.A&PDB-ENSP_mappings:4waf.A&PDB-ENSP_mappings:4ykn.A&PDB-ENSP_mappings:4zop.A&PDB-ENSP_mappings:5dxh.A&PDB-ENSP_mappings:5dxh.D&PDB-ENSP_mappings:5dxt.A&PDB-ENSP_mappings:5fi4.A&PDB-ENSP_mappings:5itd.A&PDB-ENSP_mappings:5sw8.A&PDB-ENSP_mappings:5swg.A&PDB-ENSP_mappings:5swo.A&PDB-ENSP_mappings:5swp.A&PDB-ENSP_mappings:5swr.A&PDB-ENSP_mappings:5swt.A&PDB-ENSP_mappings:5sx8.A&PDB-ENSP_mappings:5sx9.A&PDB-ENSP_mappings:5sxa.A&PDB-ENSP_mappings:5sxb.A&PDB-ENSP_mappings:5sxc.A&PDB-ENSP_mappings:5sxd.A&PDB-ENSP_mappings:5sxe.A&PDB-ENSP_mappings:5sxf.A&PDB-ENSP_mappings:5sxi.A&PDB-ENSP_mappings:5sxj.A&PDB-ENSP_mappings:5sxk.A&PDB-ENSP_mappings:5ubr.A&PDB-ENSP_mappings:5uk8.A&PDB-ENSP_mappings:5ukj.A&PDB-ENSP_mappings:5ul1.A&PDB-ENSP_mappings:5xgh.A&PDB-ENSP_mappings:5xgi.A&PDB-ENSP_mappings:5xgj.A&PDB-ENSP_mappings:6gvf.A&PDB-ENSP_mappings:6gvg.A&PDB-ENSP_mappings:6gvh.A&PDB-ENSP_mappings:6gvi.A&PDB-ENSP_mappings:6nct.A&PDB-ENSP_mappings:6oac.A&PDB-ENSP_mappings:6pys.A&PDB-ENSP_mappings:7jiu.A&PDB-ENSP_mappings:7k6m.A&PDB-ENSP_mappings:7k6n.A&PDB-ENSP_mappings:7k6o.A&PDB-ENSP_mappings:7k71.A&PDB-ENSP_mappings:7mlk.A&PDB-ENSP_mappings:7myn.A&PDB-ENSP_mappings:7myo.A&PDB-ENSP_mappings:7pg5.A&PDB-ENSP_mappings:7pg6.A&PDB-ENSP_mappings:7r9v.A&PDB-ENSP_mappings:7r9y.A&PDB-ENSP_mappings:7tz7.A&PDB-ENSP_mappings:8am0.A&PDB-ENSP_mappings:8bfu.A&PDB-ENSP_mappings:8dcp.A&PDB-ENSP_mappings:8dcx.A&PDB-ENSP_mappings:8dd4.A&PDB-ENSP_mappings:8dd8.A&PDB-ENSP_mappings:8exl.A&PDB-ENSP_mappings:8exo.A&PDB-ENSP_mappings:8exu.A&PDB-ENSP_mappings:8exv.A&PDB-ENSP_mappings:8gua.A&PDB-ENSP_mappings:8gub.A&PDB-ENSP_mappings:8gud.A&PDB-ENSP_mappings:8ilr.A&PDB-ENSP_mappings:8ils.A&PDB-ENSP_mappings:8ilv.A&PDB-ENSP_mappings:8ow2.A&PDB-ENSP_mappings:8sbc.A&PDB-ENSP_mappings:8sbj.A&PDB-ENSP_mappings:8tdu.A&PDB-ENSP_mappings:8tdu.C&PDB-ENSP_mappings:8tgd.A&PDB-ENSP_mappings:8tgd.C&PDB-ENSP_mappings:8ts7.A&PDB-ENSP_mappings:8ts8.A&PDB-ENSP_mappings:8ts9.A&PDB-ENSP_mappings:8tsa.A&PDB-ENSP_mappings:8tsb.A&PDB-ENSP_mappings:8tsc.A&PDB-ENSP_mappings:8tsd.A&PDB-ENSP_mappings:8tu6.A&PDB-ENSP_mappings:8twy.A&PDB-ENSP_mappings:8v8h.A&PDB-ENSP_mappings:8v8h.C&PDB-ENSP_mappings:8v8i.A&PDB-ENSP_mappings:8v8i.C&PDB-ENSP_mappings:8v8j.A&PDB-ENSP_mappings:8v8j.C&PDB-ENSP_mappings:8v8u.A&PDB-ENSP_mappings:8v8u.C&PDB-ENSP_mappings:8v8v.A&PDB-ENSP_mappings:8v8v.C&PDB-ENSP_mappings:8w9a.A&PDB-ENSP_mappings:8w9b.A&AFDB-ENSP_mappings:AF-P42336-F1&Pfam:PF00613&PROSITE_profiles:PS51545&PANTHER:PTHR10048&SMART:SM00145&Superfamily:SSF48371&CDD:cd00872pathogenic&pathogenic/likely_pathogenic&not_provided&likely_pathogenic0&1&1&11&1&1&125741868&30089490&26900293&20619739&25157968&26619011&25307848&22729224&22729223&35127508&31188922&15016963&15254419&15520168&15608678&15647370&15805248&16906227&17673550&18676830&18725974&19029981&19223544&19366826&19513541&19903786&20453058&21430269&22162582&22162589&22271473&23408298&23888070&23946963&22658544&21264207&25599672&34776939&31949278&33105631&31749428&32422573&28708103&37195967&33795829&36866106&36765720&34058070&32934698&37712948FAIL363531PIK3CA136550.0000128694.&.&MedGen:C5681115&Orphanet:458837&MedGen:C0265950&Orphanet:211252&MONDO:MONDO:0975755&MedGen:C0406801&Orphanet:673568&.&.&MONDO:MONDO:0005411&MedGen:C0153452&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&Human_Phenotype_Ontology:HP:0100242&MONDO:MONDO:0005089&MedGen:C1261473&MONDO:MONDO:1040002&MedGen:C4728213&Orphanet:530313&MONDO:MONDO:0007864&MeSH:D007715&MedGen:C0022739&OMIM:149000&Orphanet:2346&MedGen:C3661900&MONDO:MONDO:0011240&MedGen:C1865285&OMIM:602501&Orphanet:60040&MONDO:MONDO:0013038&MedGen:C2752042&OMIM:612918&Orphanet:140944&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&Human_Phenotype_Ontology:HP:0031287&MONDO:MONDO:0008420&MedGen:C0022603&OMIM:182000&MedGen:C1868358&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&MONDO:MONDO:0002032&MedGen:C0699790&MONDO:MONDO:0004988&MedGen:C0858252&Human_Phenotype_Ontology:HP:0001632&Human_Phenotype_Ontology:HP:0002564&Human_Phenotype_Ontology:HP:0002565&Human_Phenotype_Ontology:HP:0030680&MedGen:C4049796&.SCV001248954&SCV001440692&SCV001478679&SCV001737090&SCV001772130&SCV001934208&SCV002028353&SCV002525703&SCV004176947&SCV006583190single_nucleotide_variantSO:0001483ClinGen:CA123334&OMIM:171834.0003&UniProtKB:P42336#VAR_026178PIK3CA:5290SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094533104886003Medulloblastoma_WNT_activated&Adenocarcinoma_of_the_large_intestine&Cervical_squamous_cell_carcinoma&IDH-wildtype_glioblastoma&Rosette-forming_glioneuronal_tumor&Embryonal_rhabdomyosarcoma&Congenital_fibrosarcoma&Lymphatic_malformation&Cerebral_cavernous_malformationMONDO:MONDO:0850196&MedGen:C4331965&Human_Phenotype_Ontology:HP:0040275&MONDO:MONDO:0005008&MedGen:C1319315&MONDO:MONDO:0006143&MedGen:C0279671&Orphanet:213767&MONDO:MONDO:0850335&MedGen:CN372125&Human_Phenotype_Ontology:HP:0025171&MONDO:MONDO:0016736&MedGen:C4331262&Orphanet:251975&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0004557&MedGen:C0334459&MONDO:MONDO:0019313&MedGen:C0398368&OMIM:PS153100&Human_Phenotype_Ontology:HP:0033522&MONDO:MONDO:0000820&MedGen:C2919945&OMIM:116860&Orphanet:221061SCV007104438&SCV007104441&SCV007104449&SCV007104453&SCV007104454&SCV007104475&SCV0071045143:179218303-1792183031PIK3CAp.E545K{'abstract': 'Varkaris et al. Abstract# CT017, AACR 2023.', 'link': 'https://www.abstractsonline.com/pp8/#!/10828/presentation/10256'}True.The PIK3CA E545K mutation is located in the helical domain in exon 10 of the protein. This mutation has been found in breast and colon cancer and glioblastoma (PMID: 17376864, 31996845). Expression of this mutation in chicken embryonic fibroblasts, Ba/F3 cells, MCF10A breast cells and in a transgenic mouse model demonstrated that it is activating as measured by increased kinase activity, downstream pathway activation, factor-independent proliferation, anchorage-independent colony formation, in vivo tumor growth in xenograft models, and in vivo glioblastoma formation compared to wildtype PIK3CA (PMID: 17376864, 26627007, 16432179, 16322248, 31996845). Mutations at this position are predicted to abrogate p85-mediated inhibition of catalytic activity, thus likely resulting in constitutive activation of PIK3CA enzymatic activity (PMID: 20593314). In a phase III trial for ER+, HER2 advanced breast cancer that had previously progressed on endocrine therapy, patients were given either palbociclib (CDK4/6 inhibitor) plus fulvestrant (ESR1 antagonist) or placebo plus fulvestrant. PIK3CA alterations, including the E545K mutation, were found at a significantly higher percentage in end-of-treatment samples as compared to pre-treatment samples in patients from both treatment arms, suggesting that PIK3CA alterations may play a role in resistance to fulvestrant (PMID: 30206110). Expression of this mutation in a patient-derived xenograft model of lung squamous cell carcinoma demonstrated that it was sensitive to the pan-PIK3CA inhibitor BKM120 and the PIK3CAalpha-specific inhibitor BYL719 compared to PDX models expressing wildtype PIK3CA (PMID: 30093452). Preclinical studies with mice expressing PIK3CA E545K demonstrated sensitivity to treatment with RLY-2608 as measured by reduced tumor volume following treatment (Abstract: Varkaris et al. Abstract# CT017, AACR 2023. https://www.abstractsonline.com/pp8/#!/10828/presentation/10256)..PIK3CA, the catalytic subunit of PI3-kinase, is frequently mutated in a diverse range of cancers including breast, endometrial and cervical cancers...16322248|30206110|20593314|16432179|26627007|17376864|30093452|31996845..E545K5290PIK3CAGRCh38.MUTATION..The PIK3CA E545K mutation is known to be oncogenic.FalseLEVEL_Fda2The PIK3CA E545K mutation is located in the helical domain in exon 10 of the protein. This mutation has been found in breast and colon cancer and glioblastoma (PMID: 17376864, 31996845). Expression of this mutation in chicken embryonic fibroblasts, Ba/F3 cells, MCF10A breast cells and in a transgenic mouse model demonstrated that it is activating as measured by increased kinase activity, downstream pathway activation, factor-independent proliferation, anchorage-independent colony formation, in vivo tumor growth in xenograft models, and in vivo glioblastoma formation compared to wildtype PIK3CA (PMID: 17376864, 26627007, 16432179, 16322248, 31996845). Mutations at this position are predicted to abrogate p85-mediated inhibition of catalytic activity, thus likely resulting in constitutive activation of PIK3CA enzymatic activity (PMID: 20593314). In a phase III trial for ER+, HER2 advanced breast cancer that had previously progressed on endocrine therapy, patients were given either palbociclib (CDK4/6 inhibitor) plus fulvestrant (ESR1 antagonist) or placebo plus fulvestrant. PIK3CA alterations, including the E545K mutation, were found at a significantly higher percentage in end-of-treatment samples as compared to pre-treatment samples in patients from both treatment arms, suggesting that PIK3CA alterations may play a role in resistance to fulvestrant (PMID: 30206110). Expression of this mutation in a patient-derived xenograft model of lung squamous cell carcinoma demonstrated that it was sensitive to the pan-PIK3CA inhibitor BKM120 and the PIK3CAalpha-specific inhibitor BYL719 compared to PDX models expressing wildtype PIK3CA (PMID: 30093452). Preclinical studies with mice expressing PIK3CA E545K demonstrated sensitivity to treatment with RLY-2608 as measured by reduced tumor volume following treatment (Abstract: Varkaris et al. Abstract# CT017, AACR 2023. https://www.abstractsonline.com/pp8/#!/10828/presentation/10256).['16322248', '30206110', '20593314', '16432179', '26627007', '17376864', '30093452', '31996845'][{'abstract': 'Varkaris et al. Abstract# CT017, AACR 2023.', 'link': 'https://www.abstractsonline.com/pp8/#!/10828/presentation/10256'}]['E545K', 'H1047L', 'H1047R', 'Q546E', 'C420R', 'E545G', 'E545D', 'E545A', 'Q546R', 'H1047Y', 'E542K']Alpelisib + FulvestrantLEVEL_1LEVEL_Fda2['25877889', '31091374', '30543347']Alpelisib is a selective inhibitor of the alpha form of PI3K (PI3K) that is FDA-approved in combination with the selective estrogen receptor (ER) degrader fulvestrant for the treatment of postmenopausal patients with ER+ HER2- PIK3CA-mutated, advanced or metastatic breast cancer. FDA approval is based on data from the Phase III randomized, double-blind, placebo-controlled SOLAR-1 trial of alpelisib plus fulvestrant versus placebo plus fulvestrant in 572 patients with breast cancer in which the progression-free survival in patients with PIK3CA mutation (n=341) was eleven months (95% CI= 7.5-14.5) with alpelisib plus fulvestrant versus 5.7 months (95% CI= 3.7-7.4) with placebo plus fulvestrant (HR= 0.65, 95% CI= 0.5-0.85, p= 0.0013) compared to PIK3CA-wildtype patients in which the hazard ratio was 0.85 (95% CI= 0.58-1.25) (PMID: 31091374). Overall response in the PIK3CA-mutant population was 35.7 months (95% CI= 27.4-44.7, n=126) with alpelisib plus fulvestrant versus 16.2 months (95% CI= 10.4-23.5, n=136) with placebo plus fulvestrant (PMID: 31091374). Previous studies, including in vivo xenograft studies and a phase I trial, also demonstrated that treatment of ER+ PIK3CA-mutant breast cancer with the combination of fulvestrant and alpelisib results in greater tumor shrinkage than either drug alone, with fulvestrant inhibiting the induction of ER-dependent gene transcription resulting from PI3K inhibition with alpelisib (PMID: 25877889, 30543347).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['E545K', 'H1047L', 'H1047R', 'Q546E', 'C420R', 'E545G', 'E545D', 'E545A', 'Q546R', 'H1047Y', 'E542K']Capivasertib + FulvestrantLEVEL_1LEVEL_Fda2['37256976']Capivasertib is an orally available, ATP-competitive pan-AKT small molecule inhibitor that is FDA-approved with fulvestrant for adult patients with ER+/HER2- locally advanced or metastatic breast cancer with one or more PIK3CA/AKT1/PTEN-alterations, as detected by an FDA-approved test, following progression on at least one endocrine-based regimen in the metastatic setting or recurrence on or within twelve months of completing adjuvant therapy. Eligible PIK3CA/AKT1/PTEN-alterations (PIK3CA R88Q, N345K, C420R, E542K, E545A, E545D, E545Q, E545K, E545G, Q546E, Q546K, Q546R, Q546P, M1043V, M1043I, H1047Y, H1047R, H1047L and G1049R, AKT1 E17K, all PTEN oncogenic mutations) for treatment with capivasertib plus fulvestrant were detected by the FoundationOne CDx assay. FDA approval was based on the results from the Phase III CAPItello-291 (NCT04305496) trial of capivasertib plus fulvestrant versus placebo plus fulvestrant in 708 adult patients with ER+/HER2- locally advanced or metastatic breast cancer (n=289, patients with eligible PIK3CA/AKT1/PTEN alterations). In the Phase III CAPItello-291 (NCT04305496) trial, the capivasertib plus fulvestrant cohort with PIK3CA/AKT1/PTEN-altered tumors (n=155) demonstrated an objective response rate (ORR) of 26% (95% CI=19-34), with a 2.3% complete response (CR) rate, 23% partial response (PR) rate, and a median progression-free survival (PFS) of 7.3 months (95% CI=5.5-9.0)(PMID: 37256976). The placebo plus fulvestrant cohort with PIK3CA/AKT1/PTEN-altered tumors (n=134) demonstrated an ORR of 8% (95% CI=4-14), with an 8% PR rate and a median PFS of 3.1 months (95% CI=2.0-3.7) (HR=0.50 [95% CI=0.38-0.65], p<0.0001) (PMID: 37256976).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Oncogenic Mutations']Inavolisib + Palbociclib + FulvestrantLEVEL_1LEVEL_Fda2['39476340']Inavolisib is an orally available, small molecule PI3K inhibitor that is FDA-approved in combination with palbociclib and fulvestrant for the treatment of adults with endocrine-resistant, PIK3CA-mutated, HR-positive, HER2-negative, locally advanced or metastatic breast cancer, as detected by an FDA-approved test following recurrence on or after completing adjuvant endocrine therapy. PIK3CA oncogenic mutations for treatment with inavolisib plus palbociclib and fulvestrant were detected by the FoundationOne Liquid CDx. FDA approval was based on the results of the Phase III INAVO120 (NCT04191499) trial of inavolisib plus palbociclib and fulvestrant versus palbociclib plus fulvestrant in 325 patients with PIK3CA-mutated, HR+/HER2- breast cancer. In the Phase III INAVO120 (NCT04191499) trial, the inavolisib cohort (n=161) demonstrated an overall response rate (ORR) of 58.4%, with seven complete responses (CR) and 87 partial responses (PR), a median progression-free survival (PFS) of 15.0 months (95% CI=11.3-20.5), median overall survival (OS) was not evaluable (95% CI=0.43-0.97) and a median duration of response (DOR) of 18.4 months (95% CI=10.4-22.2) (PMID: 39476340). In contrast, the palbociclib plus fulvestrant only cohort (n=164) demonstrated an ORR of 25.0%, with one CR and 40 PRs, a median PFS of 7.3 months (95% CI=5.6-9.3) (HR=0.43 [95% CI=0.32-0.59], p<0.0001), a median OS of 31.1 months (95% CI=22.3-NE) (HR=0.64 [95% CI=0.43-0.97], p=0.0338) and a median DOR of 9.6 months (95% CI=7.4-16.6) (PMID: 39476340).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Oncogenic Mutations']RLY-2608LEVEL_4LEVEL_Fda3['37916956'][{'abstract': 'Pazolli et al. Abstract# P5-16-10, SABCS 2021.', 'link': 'https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459'}, {'abstract': 'Pazolli et al. Abstract# P251, TARG 2021.', 'link': 'https://aacrjournals.org/mct/article/20/12_Supplement/P251/676005/Abstract-P251-Discovery-and-characterization-of'}]RLY-2608 is an orally available, small-molecule, allosteric PI3K inhibitor. There are promising laboratory and anecdotal clinical data to support use of RLY-2608 in patients with PIK3CA-mutated solid tumors. In the Phase I ReDiscover (NCT05216432) trial of RLY-2608, one patient with HER2-low breast cancer harboring PIK3CA H1047R and E453K was treated with RLY-2608 and one patient with HER2-negative breast cancer harboring PIK3CA E542K was treated with RLY-2608 plus fulvestrant and both patients demonstrated partial responses (PMID: 37916956). Biochemical assays have demonstrated that RLY-2608 inhibits PI3K activity in kinase and helical domain mutants with high isoform selectivity (Abstract: Pazolli et al. Abstract# P251, TARG 2021. https://aacrjournals.org/mct/article/20/12_Supplement/P251/676005/Abstract-P251-Discovery-and-characterization-of). In vivo xenograft models harboring PIK3CA E545K and H1047R mutations demonstrated sensitivity to RLY-2608 as measured by dose-dependent tumor regression and anti-tumor activity (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vitro studies with MCF10A cells expressing PIK3CA E545K or H1047R demonstrate sensitivity to RLY-2608 as measured by inhibition of cellular signaling and proliferation (PMID: 37916956).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']RLY-2608 + FulvestrantLEVEL_4LEVEL_Fda3['37916956'][{'abstract': 'Pazolli et al. Abstract# P5-16-10, SABCS 2021.', 'link': 'https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459'}]RLY-2608 is an orally available, small-molecule, allosteric PI3K inhibitor, and fulvestrant is an FDA-approved estrogen receptor antagonist indicated for the treatment of patients with hormone receptor (HR)-positive, HER2-negative metastatic breast cancer. There are promising laboratory and anecdotal clinical data to support use of RLY-2608 plus fulvestrant in patients with PIK3CA-mutated breast cancer. In the Phase I ReDiscover (NCT05216432) trial of RLY-2608, one patient with HER2-low breast cancer harboring PIK3CA H1047R and E453K was treated with RLY-2608 and one patient with HER2-negative breast cancer harboring PIK3CA E542K was treated with RLY-2608 plus fulvestrant and both patients demonstrated partial responses (PMID: 37916956). In vitro studies with HR+ PI3K mutant cell lines demonstrated synergistic sensitivity to treatment with RLY-2608 in combination with fulvestrant (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vivo cell-derived xenograft models harboring the PIK3CA E545K mutation demonstrated sensitivity to RLY-2608 + fulvestrant treatment as measured by dose-dependent tumor regression (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vitro studies with MCF10A cells expressing PIK3CA E545K or H1047R demonstrate sensitivity to RLY-2608 as measured by inhibition of cellular signaling and proliferation (PMID: 37916956).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID16322248;30206110;20593314;16432179;26627007;17376864;30093452;31996845;Varkaris et al. Abstract# CT017, AACR 2023.(https://www.abstractsonline.com/pp8/#!/10828/presentation/10256)RLY-2608,RLY-2608+Fulvestrant25877889;31091374;30543347;37256976;39476340;37916956;Pazolli et al. Abstract# P5-16-10, SABCS 2021.(https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459);Pazolli et al. Abstract# P251, TARG 2021.(https://aacrjournals.org/mct/article/20/12_Supplement/P251/676005/Abstract-P251-Discovery-and-characterization-of)90Amissense_variantPIK3CA5290GeneENST00000263967.3ENST00000263967.3:c.1633G>ANP_006209.2:p.Glu545Lys104GLU545LYS/RS104886003https://civicdb.org/links/variants/104PIK3CA_E545K104NM_006218.3:c.1633G>A/NP_006209.2:p.Glu545Lys/ENST00000263967.3:c.1633G>A/NC_000003.11:g.178936091G>ACA12333413655
TUMORp.H1047RENSP00000263967.3:p.His1047Argchr3179234297AGPASSNM_006218missense_variantMODERATEPIK3CA21/21c.3140A>Grs121913279&CM153086&COSV55873195&COSV55873401&COSV55888015SNVdeleterious(0)benign(0.088)0.000.000.000.000.4552.2100e-01Rare_venous_malformation&Rare_combined_vascular_malformation&Klippel-Trenaunay-like-Syndrome&CEREBRAL_CAVERNOUS_MALFORMATIONS_4&_SOMATIC&Cerebrofacial_Vascular_Metameric_Syndrome_(CVMS)&Overgrowth_syndrome_and/or_cerebral_malformations_due_to_abnormalities_in_MTOR_pathway_genes&Rosette-forming_glioneuronal_tumor&PIK3CA-Related_Overgrowth_Spectrum_Disorders&PIK3CA-related_disorder&MACRODACTYLY&_SOMATIC&Congenital_macrodactylia&CLAPO_syndrome&Lip_and_oral_cavity_carcinoma&Gastric_cancer&PIK3CA_related_overgrowth_syndrome&Megalencephaly-capillary_malformation-polymicrogyria_syndrome&not_provided&CLOVES_syndrome&Ovarian_neoplasm&Hepatocellular_carcinoma&Seborrheic_keratosis&OVARIAN_CANCER&_EPITHELIAL&_SOMATIC&Non-small_cell_lung_carcinoma&Carcinoma_of_colon&Breast_adenocarcinoma&Abnormal_cardiovascular_system_morphology&Breast_carcinoma&Segmental_undergrowth_associated_with_mainly_venous_malformation_with_capillary_component&Segmental_undergrowth_associated_with_lymphatic_malformationNC_000003.12:g.179234297A>Greviewed_by_expert_panelPathogenicOncogeniccriteria_provided&_single_submitter39criteria_provided&_single_submitterTier_I_-_StrongPIK3CAH1047Rrs121913279✓ Hotspotv7.0.LEVEL_Fda2✓ Hotspot10/16/2024LEVEL_1TrueTrueTrueGain-of-functionOncogenicAlpelisib+Fulvestrant,Capivasertib+Fulvestrant,Inavolisib+Palbociclib+FulvestrantLEVEL_1LEVEL_155,400/1H1047R0.42105263157894735GRCh38PIK3CAAGMissense_MutationSNPA179234297PIK3CA_H1047R.GT:AD:AF:DP0/1:55,40:0.42:95GENSG00000121879TranscriptENST00000263967protein_coding346331401047H/RcAt/cGt1HGNCHGNC:8975YESMANE_SelectNM_006218.42P1CCDS43171.1ENSP00000263967P42336.236UPI000013D494EnsemblAA1Gene3D:1.10.1070.11&PDB-ENSP_mappings:2rd0.A&PDB-ENSP_mappings:3hhm.A&PDB-ENSP_mappings:3hiz.A&PDB-ENSP_mappings:4jps.A&PDB-ENSP_mappings:4l1b.A&PDB-ENSP_mappings:4l23.A&PDB-ENSP_mappings:4l2y.A&PDB-ENSP_mappings:4ovu.A&PDB-ENSP_mappings:4ovv.A&PDB-ENSP_mappings:4tuu.A&PDB-ENSP_mappings:4tv3.A&PDB-ENSP_mappings:4waf.A&PDB-ENSP_mappings:4ykn.A&PDB-ENSP_mappings:4zop.A&PDB-ENSP_mappings:5dxh.A&PDB-ENSP_mappings:5dxh.D&PDB-ENSP_mappings:5dxt.A&PDB-ENSP_mappings:5fi4.A&PDB-ENSP_mappings:5itd.A&PDB-ENSP_mappings:5sw8.A&PDB-ENSP_mappings:5swg.A&PDB-ENSP_mappings:5swo.A&PDB-ENSP_mappings:5swp.A&PDB-ENSP_mappings:5swr.A&PDB-ENSP_mappings:5swt.A&PDB-ENSP_mappings:5sx8.A&PDB-ENSP_mappings:5sx9.A&PDB-ENSP_mappings:5sxa.A&PDB-ENSP_mappings:5sxb.A&PDB-ENSP_mappings:5sxc.A&PDB-ENSP_mappings:5sxd.A&PDB-ENSP_mappings:5sxe.A&PDB-ENSP_mappings:5sxf.A&PDB-ENSP_mappings:5sxi.A&PDB-ENSP_mappings:5sxj.A&PDB-ENSP_mappings:5sxk.A&PDB-ENSP_mappings:5ubr.A&PDB-ENSP_mappings:5uk8.A&PDB-ENSP_mappings:5ukj.A&PDB-ENSP_mappings:5ul1.A&PDB-ENSP_mappings:5xgh.A&PDB-ENSP_mappings:5xgi.A&PDB-ENSP_mappings:5xgj.A&PDB-ENSP_mappings:6gvf.A&PDB-ENSP_mappings:6gvg.A&PDB-ENSP_mappings:6gvh.A&PDB-ENSP_mappings:6gvi.A&PDB-ENSP_mappings:6nct.A&PDB-ENSP_mappings:6oac.A&PDB-ENSP_mappings:6pys.A&PDB-ENSP_mappings:7jiu.A&PDB-ENSP_mappings:7k6m.A&PDB-ENSP_mappings:7k6n.A&PDB-ENSP_mappings:7k6o.A&PDB-ENSP_mappings:7k71.A&PDB-ENSP_mappings:7l1b.C&PDB-ENSP_mappings:7l1c.C&PDB-ENSP_mappings:7l1d.C&PDB-ENSP_mappings:7mlk.A&PDB-ENSP_mappings:7myn.A&PDB-ENSP_mappings:7myo.A&PDB-ENSP_mappings:7pg5.A&PDB-ENSP_mappings:7pg6.A&PDB-ENSP_mappings:7r9v.A&PDB-ENSP_mappings:7r9y.A&PDB-ENSP_mappings:7rrg.C&PDB-ENSP_mappings:7tz7.A&PDB-ENSP_mappings:8am0.A&PDB-ENSP_mappings:8bfu.A&PDB-ENSP_mappings:8dcp.A&PDB-ENSP_mappings:8dcx.A&PDB-ENSP_mappings:8dd4.A&PDB-ENSP_mappings:8dd8.A&PDB-ENSP_mappings:8exl.A&PDB-ENSP_mappings:8exo.A&PDB-ENSP_mappings:8exu.A&PDB-ENSP_mappings:8exv.A&PDB-ENSP_mappings:8gua.A&PDB-ENSP_mappings:8gub.A&PDB-ENSP_mappings:8gud.A&PDB-ENSP_mappings:8ilr.A&PDB-ENSP_mappings:8ils.A&PDB-ENSP_mappings:8ilv.A&PDB-ENSP_mappings:8ow2.A&PDB-ENSP_mappings:8sbc.A&PDB-ENSP_mappings:8sbj.A&PDB-ENSP_mappings:8tdu.A&PDB-ENSP_mappings:8tdu.C&PDB-ENSP_mappings:8tgd.A&PDB-ENSP_mappings:8tgd.C&PDB-ENSP_mappings:8ts7.A&PDB-ENSP_mappings:8ts8.A&PDB-ENSP_mappings:8ts9.A&PDB-ENSP_mappings:8tsa.A&PDB-ENSP_mappings:8tsb.A&PDB-ENSP_mappings:8tsc.A&PDB-ENSP_mappings:8tsd.A&PDB-ENSP_mappings:8tu6.A&PDB-ENSP_mappings:8twy.A&PDB-ENSP_mappings:8v8h.A&PDB-ENSP_mappings:8v8h.C&PDB-ENSP_mappings:8v8i.A&PDB-ENSP_mappings:8v8i.C&PDB-ENSP_mappings:8v8j.A&PDB-ENSP_mappings:8v8j.C&PDB-ENSP_mappings:8v8u.A&PDB-ENSP_mappings:8v8u.C&PDB-ENSP_mappings:8v8v.A&PDB-ENSP_mappings:8v8v.C&PDB-ENSP_mappings:8w9a.A&PDB-ENSP_mappings:8w9b.A&AFDB-ENSP_mappings:AF-P42336-F1&PROSITE_profiles:PS50290&PANTHER:PTHR10048&SMART:SM00146&Superfamily:SSF56112&CDD:cd05175pathogenic/likely_pathogenic&pathogenic&likely_pathogenic0&1&1&1&11&1&1&1&125710561&26900293&20619739&25157968&26619011&35127508&26822237&30867801&15016963&15254419&15520168&15608678&15647370&15805248&16906227&17673550&18676830&18725974&19029981&19223544&19366826&19513541&19903786&20453058&21430269&22162582&22162589&22271473&23946963&22658544&21558396&22729222&26266975&26266985&27626068&34203389&33076847&25599672&31949278&33917394&34804623&33105631&33335011&28347348&36010895&28708103&35117297&35768433&31371346&28163917&34791601&33106175&34667073&36765720&28611940&29446767&34496175&23100325&37435187FAIL02-55PIK3CA1365228691MedGen:C0265950&Orphanet:211252&MedGen:C5681115&Orphanet:458837&.&.&.&MONDO:MONDO:0100283&MedGen:CN300503&Human_Phenotype_Ontology:HP:0025171&MONDO:MONDO:0016736&MedGen:C4331262&Orphanet:251975&.&.&.&Human_Phenotype_Ontology:HP:0004099&MONDO:MONDO:0007962&MedGen:C0265552&OMIM:155500&MONDO:MONDO:0013125&MedGen:C2751313&OMIM:613089&Orphanet:168984&MONDO:MONDO:0023644&MedGen:C0220641&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&MONDO:MONDO:1040002&MedGen:C4728213&Orphanet:530313&MONDO:MONDO:0011240&MedGen:C1865285&OMIM:602501&Orphanet:60040&MedGen:C3661900&MONDO:MONDO:0013038&MedGen:C2752042&OMIM:612918&Orphanet:140944&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&Human_Phenotype_Ontology:HP:0001402&Human_Phenotype_Ontology:HP:0002899&Human_Phenotype_Ontology:HP:0003007&Human_Phenotype_Ontology:HP:0006750&MONDO:MONDO:0007256&MedGen:C2239176&OMIM:114550&Orphanet:88673&Human_Phenotype_Ontology:HP:0031287&MONDO:MONDO:0008420&MedGen:C0022603&OMIM:182000&MedGen:C1868358&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&MONDO:MONDO:0002032&MedGen:C0699790&MONDO:MONDO:0004988&MedGen:C0858252&Human_Phenotype_Ontology:HP:0001632&Human_Phenotype_Ontology:HP:0002564&Human_Phenotype_Ontology:HP:0002565&Human_Phenotype_Ontology:HP:0030680&MedGen:C4049796&Human_Phenotype_Ontology:HP:0003002&MONDO:MONDO:0004989&MedGen:C0678222&.&.SCV001949970single_nucleotide_variantSO:0001483ClinGen:CA123326&OMIM:171834.0001&UniProtKB:P42336#VAR_026192PIK3CA:5290SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094537121913279Cervical_squamous_cell_carcinoma&Diffuse_midline_glioma&_H3_K27M-mutant&Diffuse_glioma&_H3_G34_mutant&Cavernous_lymphangioma&Diffuse_pediatric-type_high-grade_glioma&_H3-wildtype_and_IDH-wildtype&Rosette-forming_glioneuronal_tumor&Embryonal_rhabdomyosarcoma&Adenoid_cystic_carcinoma&Colorectal_cancer&Glioma&Nasopharyngeal_carcinoma&NeuroblastomaMONDO:MONDO:0006143&MedGen:C0279671&Orphanet:213767&MONDO:MONDO:0957196&MedGen:C4289688&MONDO:MONDO:0957197&MedGen:CN377580&MONDO:MONDO:0019328&MedGen:C0205828&Orphanet:79489&MONDO:MONDO:0858939&MedGen:C5669918&Human_Phenotype_Ontology:HP:0025171&MONDO:MONDO:0016736&MedGen:C4331262&Orphanet:251975&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0004971&MeSH:D003528&MedGen:C0010606&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500&Human_Phenotype_Ontology:HP:0009733&MONDO:MONDO:0021042&MeSH:D005910&MedGen:C0017638&Orphanet:182067&MONDO:MONDO:0015459&MedGen:C2931822&OMIM:607107&Orphanet:150&Human_Phenotype_Ontology:HP:0003006&Human_Phenotype_Ontology:HP:0006738&MONDO:MONDO:0005072&MeSH:D009447&MedGen:C0027819&Orphanet:635SCV007104431&SCV007104433&SCV007104434&SCV007104444&SCV007104452&SCV007104470&SCV007104495&SCV007104500&SCV0071045103:179234297-179234297PIK3CAp.H1047R{'abstract': 'Varkaris et al. Abstract# CT017, AACR 2023.', 'link': 'https://www.abstractsonline.com/pp8/#!/10828/presentation/10256'}True.The PIK3CA H1047R mutation is located in the kinase domain in exon 21 of the protein (PMID: 16341083,17376864, 22120714). This mutation has been found in various cancers, including breast, head and neck, lung, colorectal and endometrial cancers (PMID: 27126994, 25631445, 23787421, 25079552, 22960745, 22941189, 17376864, 23636398). Expression of this mutation in chicken embryonic fibroblasts, Ba/F3 cells and MCF10A breast cells and in a transgenic mouse model demonstrated that it is activating as measured by increased kinase activity, downstream pathway activation, cytokine- and factor-independent proliferation, colony growth in soft agar, invasion and in vivo glioblastoma tumor burden compared to wildtype PIK3CA (PMID: 17376864, 26627007, 16432179, 16322248, 31996845). Genetically engineered mouse models have shown that the PIK3CA H1047R mutation promotes tumor formation in breast, colon, ovarian and lung cancer and malignant mesothelioma (PMID: 22370636, 23940356, 22214849, 21822287, 21324922, 19029981, 31911549). Mutations at this position are predicted to constitutively activate the catalytic subunit of PI3K (p110) by exposing the catalytic loop towards the plasma membrane where its substrate, PIP2, is found (PMID: 17376864, 20593314). Patients with breast cancer harboring this mutation achieved partial response (n=2) or stable disease (n=1) following treatment with the PI3K inhibitor, alpelisib (PMID: 27126994). In a phase III trial of palbociclib/fulvestrant for ER+, HER2 advanced breast cancer that had previously progressed on endocrine therapy, patients with PIK3CA alterations, including the H1047R mutation, were found at a significantly higher percentage in end-of-treatment samples as compared to pre-treatment samples, suggesting that this mutation may play a role in resistance to fulvestrant (PMID: 30206110). Preclinical studies with mice expressing PIK3CA H1047R demonstrated sensitivity to treatment with RLY-2608 as measured by reduced tumor volume following treatment (Abstract: Varkaris et al. Abstract# CT017, AACR 2023. https://www.abstractsonline.com/pp8/#!/10828/presentation/10256)..PIK3CA, the catalytic subunit of PI3-kinase, is frequently mutated in a diverse range of cancers including breast, endometrial and cervical cancers...16322248|30206110|19029981|22960745|31911549|16341083|22214849|16432179|26627007|21822287|27126994|25079552|22120714|21324922|31996845|23940356|25631445|20593314|22941189|22370636|23787421|23636398|17376864..H1047R5290PIK3CAGRCh38.MUTATION..The PIK3CA H1047R mutation is known to be oncogenic.FalseLEVEL_Fda2The PIK3CA H1047R mutation is located in the kinase domain in exon 21 of the protein (PMID: 16341083,17376864, 22120714). This mutation has been found in various cancers, including breast, head and neck, lung, colorectal and endometrial cancers (PMID: 27126994, 25631445, 23787421, 25079552, 22960745, 22941189, 17376864, 23636398). Expression of this mutation in chicken embryonic fibroblasts, Ba/F3 cells and MCF10A breast cells and in a transgenic mouse model demonstrated that it is activating as measured by increased kinase activity, downstream pathway activation, cytokine- and factor-independent proliferation, colony growth in soft agar, invasion and in vivo glioblastoma tumor burden compared to wildtype PIK3CA (PMID: 17376864, 26627007, 16432179, 16322248, 31996845). Genetically engineered mouse models have shown that the PIK3CA H1047R mutation promotes tumor formation in breast, colon, ovarian and lung cancer and malignant mesothelioma (PMID: 22370636, 23940356, 22214849, 21822287, 21324922, 19029981, 31911549). Mutations at this position are predicted to constitutively activate the catalytic subunit of PI3K (p110) by exposing the catalytic loop towards the plasma membrane where its substrate, PIP2, is found (PMID: 17376864, 20593314). Patients with breast cancer harboring this mutation achieved partial response (n=2) or stable disease (n=1) following treatment with the PI3K inhibitor, alpelisib (PMID: 27126994). In a phase III trial of palbociclib/fulvestrant for ER+, HER2 advanced breast cancer that had previously progressed on endocrine therapy, patients with PIK3CA alterations, including the H1047R mutation, were found at a significantly higher percentage in end-of-treatment samples as compared to pre-treatment samples, suggesting that this mutation may play a role in resistance to fulvestrant (PMID: 30206110). Preclinical studies with mice expressing PIK3CA H1047R demonstrated sensitivity to treatment with RLY-2608 as measured by reduced tumor volume following treatment (Abstract: Varkaris et al. Abstract# CT017, AACR 2023. https://www.abstractsonline.com/pp8/#!/10828/presentation/10256).['16322248', '30206110', '19029981', '22960745', '31911549', '16341083', '22214849', '16432179', '26627007', '21822287', '27126994', '25079552', '22120714', '21324922', '31996845', '23940356', '25631445', '20593314', '22941189', '22370636', '23787421', '23636398', '17376864'][{'abstract': 'Varkaris et al. Abstract# CT017, AACR 2023.', 'link': 'https://www.abstractsonline.com/pp8/#!/10828/presentation/10256'}]['E545K', 'H1047L', 'H1047R', 'Q546E', 'C420R', 'E545G', 'E545D', 'E545A', 'Q546R', 'H1047Y', 'E542K']Alpelisib + FulvestrantLEVEL_1LEVEL_Fda2['25877889', '31091374', '30543347']Alpelisib is a selective inhibitor of the alpha form of PI3K (PI3K) that is FDA-approved in combination with the selective estrogen receptor (ER) degrader fulvestrant for the treatment of postmenopausal patients with ER+ HER2- PIK3CA-mutated, advanced or metastatic breast cancer. FDA approval is based on data from the Phase III randomized, double-blind, placebo-controlled SOLAR-1 trial of alpelisib plus fulvestrant versus placebo plus fulvestrant in 572 patients with breast cancer in which the progression-free survival in patients with PIK3CA mutation (n=341) was eleven months (95% CI= 7.5-14.5) with alpelisib plus fulvestrant versus 5.7 months (95% CI= 3.7-7.4) with placebo plus fulvestrant (HR= 0.65, 95% CI= 0.5-0.85, p= 0.0013) compared to PIK3CA-wildtype patients in which the hazard ratio was 0.85 (95% CI= 0.58-1.25) (PMID: 31091374). Overall response in the PIK3CA-mutant population was 35.7 months (95% CI= 27.4-44.7, n=126) with alpelisib plus fulvestrant versus 16.2 months (95% CI= 10.4-23.5, n=136) with placebo plus fulvestrant (PMID: 31091374). Previous studies, including in vivo xenograft studies and a phase I trial, also demonstrated that treatment of ER+ PIK3CA-mutant breast cancer with the combination of fulvestrant and alpelisib results in greater tumor shrinkage than either drug alone, with fulvestrant inhibiting the induction of ER-dependent gene transcription resulting from PI3K inhibition with alpelisib (PMID: 25877889, 30543347).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['E545K', 'H1047L', 'H1047R', 'Q546E', 'C420R', 'E545G', 'E545D', 'E545A', 'Q546R', 'H1047Y', 'E542K']Capivasertib + FulvestrantLEVEL_1LEVEL_Fda2['37256976']Capivasertib is an orally available, ATP-competitive pan-AKT small molecule inhibitor that is FDA-approved with fulvestrant for adult patients with ER+/HER2- locally advanced or metastatic breast cancer with one or more PIK3CA/AKT1/PTEN-alterations, as detected by an FDA-approved test, following progression on at least one endocrine-based regimen in the metastatic setting or recurrence on or within twelve months of completing adjuvant therapy. Eligible PIK3CA/AKT1/PTEN-alterations (PIK3CA R88Q, N345K, C420R, E542K, E545A, E545D, E545Q, E545K, E545G, Q546E, Q546K, Q546R, Q546P, M1043V, M1043I, H1047Y, H1047R, H1047L and G1049R, AKT1 E17K, all PTEN oncogenic mutations) for treatment with capivasertib plus fulvestrant were detected by the FoundationOne CDx assay. FDA approval was based on the results from the Phase III CAPItello-291 (NCT04305496) trial of capivasertib plus fulvestrant versus placebo plus fulvestrant in 708 adult patients with ER+/HER2- locally advanced or metastatic breast cancer (n=289, patients with eligible PIK3CA/AKT1/PTEN alterations). In the Phase III CAPItello-291 (NCT04305496) trial, the capivasertib plus fulvestrant cohort with PIK3CA/AKT1/PTEN-altered tumors (n=155) demonstrated an objective response rate (ORR) of 26% (95% CI=19-34), with a 2.3% complete response (CR) rate, 23% partial response (PR) rate, and a median progression-free survival (PFS) of 7.3 months (95% CI=5.5-9.0)(PMID: 37256976). The placebo plus fulvestrant cohort with PIK3CA/AKT1/PTEN-altered tumors (n=134) demonstrated an ORR of 8% (95% CI=4-14), with an 8% PR rate and a median PFS of 3.1 months (95% CI=2.0-3.7) (HR=0.50 [95% CI=0.38-0.65], p<0.0001) (PMID: 37256976).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Oncogenic Mutations']Inavolisib + Palbociclib + FulvestrantLEVEL_1LEVEL_Fda2['39476340']Inavolisib is an orally available, small molecule PI3K inhibitor that is FDA-approved in combination with palbociclib and fulvestrant for the treatment of adults with endocrine-resistant, PIK3CA-mutated, HR-positive, HER2-negative, locally advanced or metastatic breast cancer, as detected by an FDA-approved test following recurrence on or after completing adjuvant endocrine therapy. PIK3CA oncogenic mutations for treatment with inavolisib plus palbociclib and fulvestrant were detected by the FoundationOne Liquid CDx. FDA approval was based on the results of the Phase III INAVO120 (NCT04191499) trial of inavolisib plus palbociclib and fulvestrant versus palbociclib plus fulvestrant in 325 patients with PIK3CA-mutated, HR+/HER2- breast cancer. In the Phase III INAVO120 (NCT04191499) trial, the inavolisib cohort (n=161) demonstrated an overall response rate (ORR) of 58.4%, with seven complete responses (CR) and 87 partial responses (PR), a median progression-free survival (PFS) of 15.0 months (95% CI=11.3-20.5), median overall survival (OS) was not evaluable (95% CI=0.43-0.97) and a median duration of response (DOR) of 18.4 months (95% CI=10.4-22.2) (PMID: 39476340). In contrast, the palbociclib plus fulvestrant only cohort (n=164) demonstrated an ORR of 25.0%, with one CR and 40 PRs, a median PFS of 7.3 months (95% CI=5.6-9.3) (HR=0.43 [95% CI=0.32-0.59], p<0.0001), a median OS of 31.1 months (95% CI=22.3-NE) (HR=0.64 [95% CI=0.43-0.97], p=0.0338) and a median DOR of 9.6 months (95% CI=7.4-16.6) (PMID: 39476340).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Oncogenic Mutations']RLY-2608LEVEL_4LEVEL_Fda3['37916956'][{'abstract': 'Pazolli et al. Abstract# P5-16-10, SABCS 2021.', 'link': 'https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459'}, {'abstract': 'Pazolli et al. Abstract# P251, TARG 2021.', 'link': 'https://aacrjournals.org/mct/article/20/12_Supplement/P251/676005/Abstract-P251-Discovery-and-characterization-of'}]RLY-2608 is an orally available, small-molecule, allosteric PI3K inhibitor. There are promising laboratory and anecdotal clinical data to support use of RLY-2608 in patients with PIK3CA-mutated solid tumors. In the Phase I ReDiscover (NCT05216432) trial of RLY-2608, one patient with HER2-low breast cancer harboring PIK3CA H1047R and E453K was treated with RLY-2608 and one patient with HER2-negative breast cancer harboring PIK3CA E542K was treated with RLY-2608 plus fulvestrant and both patients demonstrated partial responses (PMID: 37916956). Biochemical assays have demonstrated that RLY-2608 inhibits PI3K activity in kinase and helical domain mutants with high isoform selectivity (Abstract: Pazolli et al. Abstract# P251, TARG 2021. https://aacrjournals.org/mct/article/20/12_Supplement/P251/676005/Abstract-P251-Discovery-and-characterization-of). In vivo xenograft models harboring PIK3CA E545K and H1047R mutations demonstrated sensitivity to RLY-2608 as measured by dose-dependent tumor regression and anti-tumor activity (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vitro studies with MCF10A cells expressing PIK3CA E545K or H1047R demonstrate sensitivity to RLY-2608 as measured by inhibition of cellular signaling and proliferation (PMID: 37916956).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']RLY-2608 + FulvestrantLEVEL_4LEVEL_Fda3['37916956'][{'abstract': 'Pazolli et al. Abstract# P5-16-10, SABCS 2021.', 'link': 'https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459'}]RLY-2608 is an orally available, small-molecule, allosteric PI3K inhibitor, and fulvestrant is an FDA-approved estrogen receptor antagonist indicated for the treatment of patients with hormone receptor (HR)-positive, HER2-negative metastatic breast cancer. There are promising laboratory and anecdotal clinical data to support use of RLY-2608 plus fulvestrant in patients with PIK3CA-mutated breast cancer. In the Phase I ReDiscover (NCT05216432) trial of RLY-2608, one patient with HER2-low breast cancer harboring PIK3CA H1047R and E453K was treated with RLY-2608 and one patient with HER2-negative breast cancer harboring PIK3CA E542K was treated with RLY-2608 plus fulvestrant and both patients demonstrated partial responses (PMID: 37916956). In vitro studies with HR+ PI3K mutant cell lines demonstrated synergistic sensitivity to treatment with RLY-2608 in combination with fulvestrant (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vivo cell-derived xenograft models harboring the PIK3CA E545K mutation demonstrated sensitivity to RLY-2608 + fulvestrant treatment as measured by dose-dependent tumor regression (Abstract: Pazolli et al. Abstract# P5-16-10, SABCS 2021. https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459). In vitro studies with MCF10A cells expressing PIK3CA E545K or H1047R demonstrate sensitivity to RLY-2608 as measured by inhibition of cellular signaling and proliferation (PMID: 37916956).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID16322248;30206110;19029981;22960745;31911549;16341083;22214849;16432179;26627007;21822287;27126994;25079552;22120714;21324922;31996845;23940356;25631445;20593314;22941189;22370636;23787421;23636398;17376864;Varkaris et al. Abstract# CT017, AACR 2023.(https://www.abstractsonline.com/pp8/#!/10828/presentation/10256)RLY-2608,RLY-2608+Fulvestrant25877889;31091374;30543347;37256976;39476340;37916956;Pazolli et al. Abstract# P5-16-10, SABCS 2021.(https://aacrjournals.org/cancerres/article/82/4_Supplement/P5-16-10/681459);Pazolli et al. Abstract# P251, TARG 2021.(https://aacrjournals.org/mct/article/20/12_Supplement/P251/676005/Abstract-P251-Discovery-and-characterization-of)95Gmissense_variantPIK3CA5290GeneENST00000263967.3ENST00000263967.3:c.3140A>GNP_006209.2:p.His1047Arg107HIS1047ARG/RS121913279https://civicdb.org/links/variants/107PIK3CA_H1047R107NM_006218.3:c.3140A>G/NP_006209.2:p.His1047Arg/ENST00000263967.3:c.3140A>G/NC_000003.11:g.178952085A>GCA12332613652
TUMORp.Glu746_Ala750delENSP00000275493.2:p.Glu746_Ala750delchr755174772GAATTAAGAGAAGCATGPASSNM_005228inframe_deletionMODERATEEGFR19/28c.2236_2250delCOSV51765066&COSV51849442deletion4.7500e-01v7.0.LEVEL_Fda2✓ Hotspot07/07/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAfatinib,Amivantamab+Chemotherapy,Amivantamab+Lazertinib,Dacomitinib,Datopotamab Deruxtecan,Erlotinib,Gefitinib,Osimertinib,Osimertinib+Chemotherapy,Erlotinib+RamucirumabPatritumab DeruxtecanLEVEL_1LEVEL_158,370/10.3894736842105263GRCh38EGFRGAATTAAGAGAAGCATGIn_Frame_DelDELGAATTAAGAGAAGCAT55174772EGFR_del19.GT:AD:AF:DP0/1:58,37:0.39:95-ENSG00000146648TranscriptENST00000275493protein_coding2497-25112236-2250746-750ELREA/-GAATTAAGAGAAGCA/-1HGNCHGNC:3236YESMANE_SelectNM_005228.51P1CCDS5514.1ENSP00000275493P00533.293UPI000003E750P00533-1EnsemblAATTAAGAGAAGCATGAATTAAGAGAAGCA1PDB-ENSP_mappings:1m14.A&PDB-ENSP_mappings:1m17.A&PDB-ENSP_mappings:1xkk.A&PDB-ENSP_mappings:2eb2.A&PDB-ENSP_mappings:2eb3.A&PDB-ENSP_mappings:2gs2.A&PDB-ENSP_mappings:2gs6.A&PDB-ENSP_mappings:2gs7.A&PDB-ENSP_mappings:2gs7.B&PDB-ENSP_mappings:2itn.A&PDB-ENSP_mappings:2ito.A&PDB-ENSP_mappings:2itp.A&PDB-ENSP_mappings:2itq.A&PDB-ENSP_mappings:2itt.A&PDB-ENSP_mappings:2itu.A&PDB-ENSP_mappings:2itv.A&PDB-ENSP_mappings:2itw.A&PDB-ENSP_mappings:2itx.A&PDB-ENSP_mappings:2ity.A&PDB-ENSP_mappings:2itz.A&PDB-ENSP_mappings:2j5e.A&PDB-ENSP_mappings:2j5f.A&PDB-ENSP_mappings:2j6m.A&PDB-ENSP_mappings:2jit.A&PDB-ENSP_mappings:2jit.B&PDB-ENSP_mappings:2jiu.A&PDB-ENSP_mappings:2jiu.B&PDB-ENSP_mappings:2jiv.A&PDB-ENSP_mappings:2jiv.B&PDB-ENSP_mappings:2rf9.A&PDB-ENSP_mappings:2rf9.B&PDB-ENSP_mappings:2rfd.A&PDB-ENSP_mappings:2rfd.B&PDB-ENSP_mappings:2rfe.A&PDB-ENSP_mappings:2rfe.B&PDB-ENSP_mappings:2rfe.C&PDB-ENSP_mappings:2rfe.D&PDB-ENSP_mappings:2rgp.A&PDB-ENSP_mappings:3bel.A&PDB-ENSP_mappings:3gop.A&PDB-ENSP_mappings:3gt8.A&PDB-ENSP_mappings:3gt8.B&PDB-ENSP_mappings:3gt8.C&PDB-ENSP_mappings:3gt8.D&PDB-ENSP_mappings:3ika.A&PDB-ENSP_mappings:3ika.B&PDB-ENSP_mappings:3lzb.A&PDB-ENSP_mappings:3lzb.B&PDB-ENSP_mappings:3lzb.C&PDB-ENSP_mappings:3lzb.D&PDB-ENSP_mappings:3lzb.E&PDB-ENSP_mappings:3lzb.F&PDB-ENSP_mappings:3lzb.G&PDB-ENSP_mappings:3lzb.H&PDB-ENSP_mappings:3poz.A&PDB-ENSP_mappings:3ug1.A&PDB-ENSP_mappings:3ug2.A&PDB-ENSP_mappings:3vjn.A&PDB-ENSP_mappings:3vjo.A&PDB-ENSP_mappings:3w2o.A&PDB-ENSP_mappings:3w2p.A&PDB-ENSP_mappings:3w2q.A&PDB-ENSP_mappings:3w2r.A&PDB-ENSP_mappings:3w2s.A&PDB-ENSP_mappings:3w32.A&PDB-ENSP_mappings:3w33.A&PDB-ENSP_mappings:4g5j.A&PDB-ENSP_mappings:4g5p.A&PDB-ENSP_mappings:4g5p.B&PDB-ENSP_mappings:4hjo.A&PDB-ENSP_mappings:4i1z.A&PDB-ENSP_mappings:4i20.A&PDB-ENSP_mappings:4i21.A&PDB-ENSP_mappings:4i21.B&PDB-ENSP_mappings:4i22.A&PDB-ENSP_mappings:4i23.A&PDB-ENSP_mappings:4i24.A&PDB-ENSP_mappings:4i24.B&PDB-ENSP_mappings:4jq7.A&PDB-ENSP_mappings:4jq8.A&PDB-ENSP_mappings:4jr3.A&PDB-ENSP_mappings:4jrv.A&PDB-ENSP_mappings:4li5.A&PDB-ENSP_mappings:4ll0.A&PDB-ENSP_mappings:4ll0.B&PDB-ENSP_mappings:4lqm.A&PDB-ENSP_mappings:4lrm.A&PDB-ENSP_mappings:4lrm.B&PDB-ENSP_mappings:4lrm.C&PDB-ENSP_mappings:4lrm.D&PDB-ENSP_mappings:4lrm.E&PDB-ENSP_mappings:4r3p.A&PDB-ENSP_mappings:4r3r.A&PDB-ENSP_mappings:4r5s.A&PDB-ENSP_mappings:4riw.B&PDB-ENSP_mappings:4riw.D&PDB-ENSP_mappings:4rix.B&PDB-ENSP_mappings:4rix.D&PDB-ENSP_mappings:4riy.B&PDB-ENSP_mappings:4riy.D&PDB-ENSP_mappings:4rj4.A&PDB-ENSP_mappings:4rj5.A&PDB-ENSP_mappings:4rj6.A&PDB-ENSP_mappings:4rj7.A&PDB-ENSP_mappings:4rj8.A&PDB-ENSP_mappings:4tks.A&PDB-ENSP_mappings:4wd5.A&PDB-ENSP_mappings:4wd5.B&PDB-ENSP_mappings:4wkq.A&PDB-ENSP_mappings:4wrg.A&PDB-ENSP_mappings:4zau.A&PDB-ENSP_mappings:4zjv.A&PDB-ENSP_mappings:4zjv.B&PDB-ENSP_mappings:4zse.A&PDB-ENSP_mappings:4zse.B&PDB-ENSP_mappings:4zse.C&PDB-ENSP_mappings:4zse.D&PDB-ENSP_mappings:5c8k.A&PDB-ENSP_mappings:5c8m.A&PDB-ENSP_mappings:5c8n.A&PDB-ENSP_mappings:5cal.A&PDB-ENSP_mappings:5can.A&PDB-ENSP_mappings:5cao.A&PDB-ENSP_mappings:5cap.A&PDB-ENSP_mappings:5caq.A&PDB-ENSP_mappings:5cas.A&PDB-ENSP_mappings:5cau.A&PDB-ENSP_mappings:5cav.A&PDB-ENSP_mappings:5cnn.A&PDB-ENSP_mappings:5cnn.B&PDB-ENSP_mappings:5cno.A&PDB-ENSP_mappings:5cno.B&PDB-ENSP_mappings:5cno.X&PDB-ENSP_mappings:5czh.A&PDB-ENSP_mappings:5czi.A&PDB-ENSP_mappings:5d41.A&PDB-ENSP_mappings:5d41.B&PDB-ENSP_mappings:5edp.A&PDB-ENSP_mappings:5edq.A&PDB-ENSP_mappings:5edr.A&PDB-ENSP_mappings:5em5.A&PDB-ENSP_mappings:5em6.A&PDB-ENSP_mappings:5em7.A&PDB-ENSP_mappings:5em8.A&PDB-ENSP_mappings:5fed.A&PDB-ENSP_mappings:5fee.A&PDB-ENSP_mappings:5feq.A&PDB-ENSP_mappings:5gmp.A&PDB-ENSP_mappings:5gnk.A&PDB-ENSP_mappings:5gty.A&PDB-ENSP_mappings:5gty.B&PDB-ENSP_mappings:5gty.C&PDB-ENSP_mappings:5gty.D&PDB-ENSP_mappings:5gty.E&PDB-ENSP_mappings:5gty.F&PDB-ENSP_mappings:5gty.G&PDB-ENSP_mappings:5gty.H&PDB-ENSP_mappings:5gtz.A&PDB-ENSP_mappings:5hcx.A&PDB-ENSP_mappings:5hcy.A&PDB-ENSP_mappings:5hcz.A&PDB-ENSP_mappings:5hg5.A&PDB-ENSP_mappings:5hg7.A&PDB-ENSP_mappings:5hg8.A&PDB-ENSP_mappings:5hg9.A&PDB-ENSP_mappings:5hib.A&PDB-ENSP_mappings:5hic.A&PDB-ENSP_mappings:5j9y.A&PDB-ENSP_mappings:5j9z.A&PDB-ENSP_mappings:5jeb.A&PDB-ENSP_mappings:5u8l.A&PDB-ENSP_mappings:5ug8.A&PDB-ENSP_mappings:5ug9.A&PDB-ENSP_mappings:5uga.A&PDB-ENSP_mappings:5ugb.A&PDB-ENSP_mappings:5ugc.A&PDB-ENSP_mappings:5uwd.A&PDB-ENSP_mappings:5x26.A&PDB-ENSP_mappings:5x27.A&PDB-ENSP_mappings:5x28.A&PDB-ENSP_mappings:5x2a.A&PDB-ENSP_mappings:5x2a.B&PDB-ENSP_mappings:5x2a.C&PDB-ENSP_mappings:5x2a.D&PDB-ENSP_mappings:5x2c.A&PDB-ENSP_mappings:5x2c.B&PDB-ENSP_mappings:5x2f.A&PDB-ENSP_mappings:5x2f.B&PDB-ENSP_mappings:5x2f.C&PDB-ENSP_mappings:5x2f.D&PDB-ENSP_mappings:5x2k.A&PDB-ENSP_mappings:5xdk.A&PDB-ENSP_mappings:5xdl.A&PDB-ENSP_mappings:5xgm.A&PDB-ENSP_mappings:5xgn.A&PDB-ENSP_mappings:5xgn.B&PDB-ENSP_mappings:5y25.A&PDB-ENSP_mappings:5y9t.A&PDB-ENSP_mappings:5yu9.A&PDB-ENSP_mappings:5yu9.B&PDB-ENSP_mappings:5yu9.C&PDB-ENSP_mappings:5yu9.D&PDB-ENSP_mappings:5zto.A&PDB-ENSP_mappings:5zwj.A&PDB-ENSP_mappings:6d8e.A&PDB-ENSP_mappings:6duk.A&PDB-ENSP_mappings:6duk.B&PDB-ENSP_mappings:6duk.C&PDB-ENSP_mappings:6duk.D&PDB-ENSP_mappings:6duk.E&PDB-ENSP_mappings:6duk.F&PDB-ENSP_mappings:6jrj.A&PDB-ENSP_mappings:6jrk.A&PDB-ENSP_mappings:6jrx.A&PDB-ENSP_mappings:6jwl.A&PDB-ENSP_mappings:6jx0.A&PDB-ENSP_mappings:6jx4.A&PDB-ENSP_mappings:6jxt.A&PDB-ENSP_mappings:6jz0.A&PDB-ENSP_mappings:6lub.A&PDB-ENSP_mappings:6lud.A&PDB-ENSP_mappings:6p1d.A&PDB-ENSP_mappings:6p1d.B&PDB-ENSP_mappings:6p1d.C&PDB-ENSP_mappings:6p1d.D&PDB-ENSP_mappings:6p1l.A&PDB-ENSP_mappings:6p1l.B&PDB-ENSP_mappings:6p1l.C&PDB-ENSP_mappings:6p1l.D&PDB-ENSP_mappings:6p8q.A&PDB-ENSP_mappings:6p8q.B&PDB-ENSP_mappings:6p8q.C&PDB-ENSP_mappings:6p8q.D&PDB-ENSP_mappings:6s89.A&PDB-ENSP_mappings:6s8a.A&PDB-ENSP_mappings:6s9b.A&PDB-ENSP_mappings:6s9c.A&PDB-ENSP_mappings:6s9d.A&PDB-ENSP_mappings:6tfu.A&PDB-ENSP_mappings:6tfu.B&PDB-ENSP_mappings:6tfv.A&PDB-ENSP_mappings:6tfv.B&PDB-ENSP_mappings:6tfw.A&PDB-ENSP_mappings:6tfw.B&PDB-ENSP_mappings:6tfy.A&PDB-ENSP_mappings:6tfy.B&PDB-ENSP_mappings:6tfz.A&PDB-ENSP_mappings:6tfz.B&PDB-ENSP_mappings:6tg0.A&PDB-ENSP_mappings:6tg0.B&PDB-ENSP_mappings:6tg1.A&PDB-ENSP_mappings:6tg1.B&PDB-ENSP_mappings:6v5n.A&PDB-ENSP_mappings:6v5n.B&PDB-ENSP_mappings:6v5n.C&PDB-ENSP_mappings:6v5n.D&PDB-ENSP_mappings:6v5p.A&PDB-ENSP_mappings:6v5p.B&PDB-ENSP_mappings:6v5p.C&PDB-ENSP_mappings:6v5p.D&PDB-ENSP_mappings:6v66.A&PDB-ENSP_mappings:6v66.B&PDB-ENSP_mappings:6v66.C&PDB-ENSP_mappings:6v66.D&PDB-ENSP_mappings:6v6k.A&PDB-ENSP_mappings:6v6k.B&PDB-ENSP_mappings:6v6k.C&PDB-ENSP_mappings:6v6k.D&PDB-ENSP_mappings:6v6k.E&PDB-ENSP_mappings:6v6k.F&PDB-ENSP_mappings:6v6k.G&PDB-ENSP_mappings:6v6k.H&PDB-ENSP_mappings:6v6o.A&PDB-ENSP_mappings:6v6o.B&PDB-ENSP_mappings:6v6o.C&PDB-ENSP_mappings:6v6o.D&PDB-ENSP_mappings:6v6o.E&PDB-ENSP_mappings:6v6o.F&PDB-ENSP_mappings:6v6o.G&PDB-ENSP_mappings:6v6o.H&PDB-ENSP_mappings:6vh4.A&PDB-ENSP_mappings:6vhn.A&PDB-ENSP_mappings:6vhp.A&PDB-ENSP_mappings:6wa2.A&PDB-ENSP_mappings:6wa2.B&PDB-ENSP_mappings:6wa2.C&PDB-ENSP_mappings:6wa2.D&PDB-ENSP_mappings:6wak.A&PDB-ENSP_mappings:6wak.B&PDB-ENSP_mappings:6wak.C&PDB-ENSP_mappings:6wak.D&PDB-ENSP_mappings:6wxn.A&PDB-ENSP_mappings:6wxn.B&PDB-ENSP_mappings:6wxn.C&PDB-ENSP_mappings:6wxn.D&PDB-ENSP_mappings:6xl4.A&PDB-ENSP_mappings:6xl4.B&PDB-ENSP_mappings:6xl4.C&PDB-ENSP_mappings:6xl4.D&PDB-ENSP_mappings:6z4b.A&PDB-ENSP_mappings:6z4b.B&PDB-ENSP_mappings:6z4d.A&PDB-ENSP_mappings:6z4d.B&PDB-ENSP_mappings:7a2a.A&PDB-ENSP_mappings:7a2a.B&PDB-ENSP_mappings:7a6i.A&PDB-ENSP_mappings:7a6j.A&PDB-ENSP_mappings:7a6j.B&PDB-ENSP_mappings:7a6k.A&PDB-ENSP_mappings:7a6k.B&PDB-ENSP_mappings:7a6k.C&PDB-ENSP_mappings:7a6k.D&PDB-ENSP_mappings:7aei.A&PDB-ENSP_mappings:7aem.A&PDB-ENSP_mappings:7b85.A&PDB-ENSP_mappings:7er2.A&PDB-ENSP_mappings:7jxi.A&PDB-ENSP_mappings:7jxi.B&PDB-ENSP_mappings:7jxi.C&PDB-ENSP_mappings:7jxi.D&PDB-ENSP_mappings:7jxk.A&PDB-ENSP_mappings:7jxk.B&PDB-ENSP_mappings:7jxk.C&PDB-ENSP_mappings:7jxk.D&PDB-ENSP_mappings:7jxk.E&PDB-ENSP_mappings:7jxk.F&PDB-ENSP_mappings:7jxl.A&PDB-ENSP_mappings:7jxl.B&PDB-ENSP_mappings:7jxl.C&PDB-ENSP_mappings:7jxl.D&PDB-ENSP_mappings:7jxm.A&PDB-ENSP_mappings:7jxm.B&PDB-ENSP_mappings:7jxm.C&PDB-ENSP_mappings:7jxm.D&PDB-ENSP_mappings:7jxp.A&PDB-ENSP_mappings:7jxp.B&PDB-ENSP_mappings:7jxp.C&PDB-ENSP_mappings:7jxp.D&PDB-ENSP_mappings:7jxp.E&PDB-ENSP_mappings:7jxp.F&PDB-ENSP_mappings:7jxq.A&PDB-ENSP_mappings:7jxq.B&PDB-ENSP_mappings:7jxq.C&PDB-ENSP_mappings:7jxq.D&PDB-ENSP_mappings:7jxw.A&PDB-ENSP_mappings:7jxw.B&PDB-ENSP_mappings:7jxw.C&PDB-ENSP_mappings:7jxw.D&PDB-ENSP_mappings:7k1h.A&PDB-ENSP_mappings:7k1h.B&PDB-ENSP_mappings:7k1h.C&PDB-ENSP_mappings:7k1h.D&PDB-ENSP_mappings:7k1h.E&PDB-ENSP_mappings:7k1h.F&PDB-ENSP_mappings:7k1i.A&PDB-ENSP_mappings:7kxz.A&PDB-ENSP_mappings:7ky0.A&PDB-ENSP_mappings:7ky0.B&PDB-ENSP_mappings:7ky0.C&PDB-ENSP_mappings:7ky0.D&PDB-ENSP_mappings:7lg8.A&PDB-ENSP_mappings:7lg8.B&PDB-ENSP_mappings:7lg8.C&PDB-ENSP_mappings:7lg8.D&PDB-ENSP_mappings:7lgs.A&PDB-ENSP_mappings:7lgs.B&PDB-ENSP_mappings:7lgs.C&PDB-ENSP_mappings:7lgs.D&PDB-ENSP_mappings:7ltx.A&PDB-ENSP_mappings:7ltx.B&PDB-ENSP_mappings:7ltx.C&PDB-ENSP_mappings:7ltx.D&PDB-ENSP_mappings:7oxb.A&PDB-ENSP_mappings:7si1.A&PDB-ENSP_mappings:7syd.A&PDB-ENSP_mappings:7syd.B&PDB-ENSP_mappings:7sye.A&PDB-ENSP_mappings:7sye.B&PDB-ENSP_mappings:7sz0.A&PDB-ENSP_mappings:7sz0.B&PDB-ENSP_mappings:7sz1.A&PDB-ENSP_mappings:7sz1.B&PDB-ENSP_mappings:7sz5.A&PDB-ENSP_mappings:7sz5.B&PDB-ENSP_mappings:7sz7.A&PDB-ENSP_mappings:7sz7.B&PDB-ENSP_mappings:7t4i.A&PDB-ENSP_mappings:7t4j.A&PDB-ENSP_mappings:7t4j.B&PDB-ENSP_mappings:7tvd.A&PDB-ENSP_mappings:7u98.A&PDB-ENSP_mappings:7u98.B&PDB-ENSP_mappings:7u98.C&PDB-ENSP_mappings:7u98.D&PDB-ENSP_mappings:7u99.A&PDB-ENSP_mappings:7u9a.A&PDB-ENSP_mappings:7ukv.A&PDB-ENSP_mappings:7ukw.A&PDB-ENSP_mappings:7ukw.B&PDB-ENSP_mappings:7ukw.C&PDB-ENSP_mappings:7ukw.D&PDB-ENSP_mappings:7vra.A&PDB-ENSP_mappings:7vre.A&PDB-ENSP_mappings:7zym.A&PDB-ENSP_mappings:7zyn.A&PDB-ENSP_mappings:7zyp.A&PDB-ENSP_mappings:7zyq.A&PDB-ENSP_mappings:7zyq.B&PDB-ENSP_mappings:8a27.A&PDB-ENSP_mappings:8a2a.A&PDB-ENSP_mappings:8a2b.A&PDB-ENSP_mappings:8a2d.A&PDB-ENSP_mappings:8d73.A&PDB-ENSP_mappings:8d73.B&PDB-ENSP_mappings:8d76.A&PDB-ENSP_mappings:8d76.B&PDB-ENSP_mappings:8dsw.A&PDB-ENSP_mappings:8eme.A&PDB-ENSP_mappings:8eme.B&PDB-ENSP_mappings:8f1h.A&PDB-ENSP_mappings:8f1w.A&PDB-ENSP_mappings:8f1w.B&PDB-ENSP_mappings:8f1w.C&PDB-ENSP_mappings:8f1w.D&PDB-ENSP_mappings:8f1x.A&PDB-ENSP_mappings:8f1y.A&PDB-ENSP_mappings:8f1z.A&PDB-ENSP_mappings:8fv3.A&PDB-ENSP_mappings:8fv3.B&PDB-ENSP_mappings:8fv3.C&PDB-ENSP_mappings:8fv3.D&PDB-ENSP_mappings:8fv4.A&PDB-ENSP_mappings:8fv4.B&PDB-ENSP_mappings:8fv4.C&PDB-ENSP_mappings:8fv4.D&PDB-ENSP_mappings:8g63.A&PDB-ENSP_mappings:8gb4.A&PDB-ENSP_mappings:8gb4.B&PDB-ENSP_mappings:8gb4.C&PDB-ENSP_mappings:8gb4.D&PDB-ENSP_mappings:8gk5.A&PDB-ENSP_mappings:8gk5.B&PDB-ENSP_mappings:8gk5.C&PDB-ENSP_mappings:8gk5.D&PDB-ENSP_mappings:8h7x.A&PDB-ENSP_mappings:8h7x.B&PDB-ENSP_mappings:8hv1.A&PDB-ENSP_mappings:8hv2.A&PDB-ENSP_mappings:8hv3.A&PDB-ENSP_mappings:8hv4.A&PDB-ENSP_mappings:8hv5.A&PDB-ENSP_mappings:8hv6.A&PDB-ENSP_mappings:8hv7.A&PDB-ENSP_mappings:8hv8.A&PDB-ENSP_mappings:8hv9.A&PDB-ENSP_mappings:8hva.A&PDB-ENSP_mappings:8hy7.A&PDB-ENSP_mappings:8kfq.A&PDB-ENSP_mappings:8pnz.A&PDB-ENSP_mappings:8po0.A&PDB-ENSP_mappings:8po1.A&PDB-ENSP_mappings:8po2.A&PDB-ENSP_mappings:8po2.B&PDB-ENSP_mappings:8po2.D&PDB-ENSP_mappings:8po3.A&PDB-ENSP_mappings:8po4.A&PDB-ENSP_mappings:8po4.B&PDB-ENSP_mappings:8sc7.A&PDB-ENSP_mappings:8tjl.A&PDB-ENSP_mappings:8to3.A&PDB-ENSP_mappings:8to3.B&PDB-ENSP_mappings:8to3.C&PDB-ENSP_mappings:8to3.D&PDB-ENSP_mappings:8to4.A&PDB-ENSP_mappings:8to4.B&PDB-ENSP_mappings:8to4.C&PDB-ENSP_mappings:8to4.D&PDB-ENSP_mappings:8wd4.A&SMART:SM00219&Superfamily:SSF56112&CDD:cd05108&PANTHER:PTHR24416&PROSITE_profiles:PS50011&Phobius:CYTOPLASMIC_DOMAIN&Pfam:PF07714&Gene3D:3.30.200.20&PIRSF:PIRSF000619&AFDB-ENSP_mappings:AF-P00533-F11&11&1.False.The EGFR E746_A750del mutation is located in the tyrosine kinase domain in exon 19 of the protein. This mutation has been found in non-small cell lung cancer (NSCLC) (PMID: 18508816, 22483783, 16467085, 18325048, 15897572, 25179728, 18261621, 15710947). In-frame deletions of EGFR exon 19 result in constitutive activation of EGFR tyrosine kinase activity and confer sensitivity to EGFR tyrosine kinase inhibitors (TKIs) including gefitinib, erlotinib and afatinib in lung adenocarcinoma (PMID: 15118073, 15118125, 15329413). Cell line experiments demonstrate that this mutation is activating, transforming and sensitive to gefitinib (PMID: 16373402, 29141884). Across many clinical studies, patients with non-small cell lung cancer harboring the EGFR E746_A750del have had clinical benefit from treatment with gefitinib or erlotinib (PMID: 18508816, 22483783, 16467085, 18325048, 15897572, 25179728, 18261621, 15710947)..EGFR, a receptor tyrosine kinase, is altered by amplification and/or mutation in lung and brain cancers among others...18508816|29141884|16467085|15329413|25179728|15710947|15118125|15897572|18325048|15118073|18261621|22483783|16373402..E746_A750del1956EGFRGRCh38.MUTATION..The EGFR E746_A750del alteration is known to be oncogenic.FalseLEVEL_Fda2The EGFR E746_A750del mutation is located in the tyrosine kinase domain in exon 19 of the protein. This mutation has been found in non-small cell lung cancer (NSCLC) (PMID: 18508816, 22483783, 16467085, 18325048, 15897572, 25179728, 18261621, 15710947). In-frame deletions of EGFR exon 19 result in constitutive activation of EGFR tyrosine kinase activity and confer sensitivity to EGFR tyrosine kinase inhibitors (TKIs) including gefitinib, erlotinib and afatinib in lung adenocarcinoma (PMID: 15118073, 15118125, 15329413). Cell line experiments demonstrate that this mutation is activating, transforming and sensitive to gefitinib (PMID: 16373402, 29141884). Across many clinical studies, patients with non-small cell lung cancer harboring the EGFR E746_A750del have had clinical benefit from treatment with gefitinib or erlotinib (PMID: 18508816, 22483783, 16467085, 18325048, 15897572, 25179728, 18261621, 15710947).['18508816', '29141884', '16467085', '15329413', '25179728', '15710947', '15118125', '15897572', '18325048', '15118073', '18261621', '22483783', '16373402']['L858R', 'Exon 19 in-frame deletions']AfatinibLEVEL_1LEVEL_Fda2['23816960', '22452895', '25589191']Afatinib, a second-generation, irreversible tyrosine kinase inhibitor of EGFR, HER2, and HER4, is FDA-approved as first-line therapy in patients with non-small cell lung cancer (NSCLC) whose tumors harbor EGFR exon 19 deletion or L858R, L861Q, G719, and/or S768I substitution mutations. FDA approval was based on the Phase II LUX-Lung 2 trial, which demonstrated an objective response rate of 61% in patients with EGFR-mutant lung cancer treated with afatinib (PMID: 22452895). In the Phase III LUX-Lung 3 trial, afatinib significantly improved progression-free survival (PFS) in patients with EGFR-mutant lung cancer compared to patients treated with chemotherapy comprised of cisplatin plus pemetrexed (13.6 months versus 6.9 months, HR=0.47, p=0.001) (PMID: 23816960). In a pooled analysis of the LUX-Lung 3 and 6 trials comparing overall survival in patients with EGFR mutation who were treated with afatinib versus those treated with chemotherapy, first-line treatment with afatinib significantly improved overall survival specifically in patients harboring exon 19 deletions compared to those treated with chemotherapy (31.7 versus 20.7 months, HR = 0.59, p = 0.0001) (PMID: 25589191).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']Amivantamab + ChemotherapyLEVEL_1LEVEL_Fda2['37879444']Amivantamab is an intravenously infused, EGFR-MET bispecific monoclonal antibody that is FDA-approved for the treatment of adult patients in combination with carboplatin and pemetrexed for the treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with EGFR exon 19 deletions or exon 21 L858R substitution mutations, whose disease has progressed on or after treatment with an EGFR tyrosine kinase inhibitor. FDA approval is based on the results of the Phase III MARIPOSA-2 (NCT04988295) trial of amivantamab plus chemotherapy versus chemotherapy in 394 patients with NSCLC with EGFR L858R mutations or exon 19 deletions. __In the Phase III MARIPOSA-2 (NCT04988295) trial, the amivantamab plus chemotherapy cohort (n=131 [n=89, EGFR exon 19 deletions, n=42, EGFR L858R]) demonstrated an overall response rate (ORR) of 53% (95% CI=44-62), with a 0.8% complete response (CR) rate and 52% partial response (PR) rate (PMID: 37879444). In contrast, the chemotherapy cohort (n=263 [n=183, EGFR exon 19 deletions, n=79, EGFR L858R]) demonstrated an ORR of 29% (95% CI=23-35) (p<0.0001), with a 29% PR rate (PMID: 37879444). The amivantamab plus chemotherapy cohort demonstrated a median progression-free survival (PFS) of 6.3 months (95% CI=5.6-8.4) and a median duration of response (DOR) of 6.9 months (95% CI= 5.5NE) while the chemotherapy cohort demonstrated a median PFS of 4.2 months (95% CI=4.04.4) (HR=0.48 [95% CI=0.36-0.64], p<0.0001) and a median DOR of 5.6 months (95% CI=4.29.6) (PMID: 37879444).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']Amivantamab + LazertinibLEVEL_1LEVEL_Fda2['38924756']Amivantamab, an intravenously infused, EGFR-MET bispecific monoclonal antibody, and lazertinib, a small molecule, third-generation EGFR tyrosine kinase inhibitor, are FDA-approved in combination for the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with EGFR exon 19 deletions or exon 21 L858R substitution mutations, as detected by an FDA-approved test. FDA approval was based on the results of the Phase III MARIPOSA (NCT04487080) trial of amivantamab plus lazertinib versus osimertinib monotherapy in 1074 patients with NSCLC with an EGFR exon 19 deletion or L858R mutation. In the Phase III MARIPOSA (NCT04487080) trial, the amivantamab plus lazertinib cohort (n=429) demonstrated an overall response rate (ORR) of 86% (95% CI=83-89), a median progression-free survival (PFS) of 23.7 months (95% CI=19.1-27.7), a median duration of response (DOR) of 25.8 months (95% CI=20.1-NE) and a 24-month overall survival (OS) rate of 74% (95% CI=69-78) while the osimertinib cohort (n=429) demonstrated an ORR of 85% (95% CI=81-88), a median PFS of 16.6 months (95% CI=14.818.5) (HR=0.70 [95% CI=0.58-0.85], p<0.001), a median DOR of 16.8 months (95% CI=14.8-18.5) and a 24-month OS rate of 69% (95% CI=64-74) (PMID: 38924756).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']DacomitinibLEVEL_1LEVEL_Fda2['29864379', '28958502']Dacomitinib is a small molecule inhibitor of EGFR that is FDA-approved for the first-line treatment of patients with metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 19 deletion or exon 21 L858R substitution mutations as detected by an FDA-approved test. FDA approval was based on the Phase III ARCHER 1050 trial of dacomitinib versus gefitinib in 452 patients with advanced, EGFR-positive NSCLC in which the median progression-free survival (PFS) was 14.7 months for patients randomized to dacomitinib and 9.2 months for patients randomized to gefitinib (HR=0.59, 95% CI=0.47-0.74, p=0001) (PMID: 28958502). Overall survival was 34.1 months in the dacomitinib arm versus 26.8 months in the gefitinib arm (HR=0.760, 95% CI=0.582-0.993, P = .044) (PMID: 29864379).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Oncogenic Mutations']Datopotamab DeruxtecanLEVEL_1LEVEL_Fda2['39761483', '39250535']Datopotamab deruxtecan (Dato-DXd) is an intravenously infused, TROP2-directed antibody drug conjugate that is FDA-approved for the treatment of patients with EGFR-mutated non-small cell lung cancer (NSCLC) who have received prior EGFR-directed therapy and platinum-based chemotherapy. FDA approval is based on the results of the Phase II TROPION-Lung05 (NCT04484142) and Phase III TROPION-Lung01 (NCT04656652) trials of Dato-DXd in patients with previously treated EGFR-mutated NSCLC._In the Phase II TROPION-Lung05 (NCT04484142) trial of Dato-DXd in patients with NSCLC harboring actionable alterations progressing on or after targeted therapy and platinum-based chemotherapy, patients with EGFR-mutated NSCLC (n=78 [exon 19 deletion: 41 (29.9%), exon 20 T790M: 26 (19.0%), exon 21 L858R: 25 (18.2%), exon 18 G719: 5 (3.6%), exon 21 L861Q: 3 (2.2%), exon 20 insertion: 2 (1.5%)]) demonstrated an overall response rate (ORR) of 43.6% (95% CI=32.4-55.3), with a 5.1% (n=4) complete response (CR) rate, 38.5% (n=30) partial response (PR) rate and 34.6% (n=27) stable disease (SD) rate, a disease control rate (DCR) of 82.1% (95% CI=71.7-89.8), a median duration of response (DOR) of 7.0 months (95% CI=4.2-10.2) and a median progression-free survival (PFS) of 5.8 months (95% CI=5.4-8.3) (PMID: 39761483)._In the Phase III TROPION-Lung01 (NCT04656652) trial of Dato-DXd versus docetaxel in patients with pretreated NSCLC, patients treated with Dato-DXd (n=299 [EGFR mutations: 39 (13.0%)]) demonstrated an ORR of 26.4% (95% CI= 21.5-31.8), with a 1.3% (n=4) CR rate, 25.1% (n=75) PR rate and 49.8% (n=149) SD rate, a DCR of 77.3% (95% CI=72.1-81.9), a median DOR of 7.1 months (95% CI=5.6-10.9), a median PFS of 4.4 months (95% CI=4.2-5.6) and a median overall survival (OS) of 12.9 months (95% CI=11.0-13.9) (PMID: 39250535). Patients treated with docetaxel (n=305 [EGFR mutations: 45 (14.8%)]) demonstrated an ORR of 12.8% (95% CI=9.3-17.1), with a 12.8% (n=39) PR rate and 50.2% (n=153) SD rate, a DCR of 64.9% (95% CI=59.3-70.3), a median DOR of 5.6 months (95% CI=5.4-8.1), a median PFS of 3.7 months (95% CI=2.9-4.2) (HR=0.75 [95% CI=0.62-0.91], p=.004) and a median OS of 11.8 months (95% CI=10.1-12.8) (HR=0.94 [95% CI=0.78-1.14], p=0.530) (PMID: 39250535).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']ErlotinibLEVEL_1LEVEL_Fda2['22285168', '27987585']Erlotinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is approved with or without ramucirumab for the treatment of non-small cell lung cancer (NSCLC) with EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. Results of the Phase III EURTAC trial demonstrated that patients with NSCLC receiving erlotinib showed significant improvement in progression-free survival (PFS) (9.7 vs. 5.2 months, HR=0.37, p=0.0001) compared to those receiving platinum-based doublet chemotherapy (PMID: 22285168). The partial response rate with erlotinib was 56%, compared to 13% with chemotherapy, and was associated with a reduced toxicity profile (PMID: 22285168). The safety and efficacy of erlotinib have not been established in patients harboring EGFR mutations other than exon 19 deletion and exon 21 (L858R) substitution, however, the phase III IUNO trial demonstrated no difference in PFS between patients with NSCLC lacking EGFR exon 19 deletion or EGFR L858R mutation who were given erlotinib versus placebo as maintenance therapy (PMID: 27987585).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']GefitinibLEVEL_1LEVEL_Fda2['20022809', '19692680', '21670455', '22370314', '31682542', '20573926']Gefitinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is FDA-approved as first-line therapy in patients with non-small cell lung cancer (NSCLC) whose tumors harbor EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. FDA approval is based on multiple clinical trials that demonstrated the efficacy of gefitinib in EGFR-mutant NSCLC and includes IPASS (PMID: 19692680, 21670455), NEJ002 (PMID: 20573926), WJTOG3405 (PMID: 20022809) and First-SIGNAL (PMID: 22370314). Response rates in EGFR-mutant lung cancers in these studies ranged from 55% to 85%, with median progression-free survival (PFS) of 8 to 10.8 months (PMID: 19692680, 21670455, 20573926, 20022809, 22370314). In one study comparing gefitinib with standard chemotherapy in pulmonary adenocarcinoma, the response rate with gefitinib in patients with EGFR mutations (47%) was nearly double that of patients who were EGFR wildtype (24%) (PMID: 19692680). Additionally, in the biomarker analysis and final overall survival (OS) analysis of the Phase III IPASS study, though OS was not different between the gefitinib and carboplatin/paclitaxel groups, 64.3% of patients assigned to chemotherapy had crossed over to treatment with EGFR TKIs, PFS in this study was significantly longer with gefitinib than chemotherapy in patients with EGFR mutation (HR=0.48) (PMID: 21670455). In a Phase II trial, the addition of carboplatin plus pemetrexed to gefitinib increased progression-free survival (20.9 months vs 11.9 months, HR = 0.490, P < .001) in patients with EGFR-mutant NSCLC compared to gefitinib alone (PMID: 31682542).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']OsimertinibLEVEL_1LEVEL_Fda2['38828946', '32955177', '29151359', '31751012']Osimertinib is an orally available, small molecule third-generation EGFR T790M tyrosine kinase inhibitor (TKI) that is FDA-approved for adjuvant therapy after tumor resection in adult patients with non-small cell lung cancer (NSCLC) whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, the treatment of adult patients with locally advanced, unresectable (stage III) NSCLC whose disease has not progressed during or following concurrent or sequential platinum-based chemoradiation therapy and whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations and the first-line treatment of adult patients with metastatic NSCLC whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, as detected by an FDA-approved test. EGFR exon 19 deletions and exon 21 L858R mutations for treatment with osimertinib were detected by the cobas EGFR Mutation Test v2, FoundationOne CDx, FoundationOne Liquid CDx or Guardant360 CDx. FDA approvals were based on the results of the Phase III ADAURA (NCT02511106) trial for adjuvant treatment, the Phase III LAURA (NCT03521154) trial for locally advanced, unresectable NSCLC treatment and the Phase III FLAURA (NCT02296125) trial for first-line monotherapy treatment. __In the Phase III ADAURA (NCT02511106) trial of osimertinib versus placebo in 682 patients with completely resected EGFR mutation-positive stage IB to IIIA NSCLC, 89% (95% CI=85-92) of patients in the osimertinib cohort (n=339 [55%, EGFR exon 19 deletion, 45%, EGFR L858R, 1%, EGFR T790M]) and 52% (95% CI=46-58) of patients in the placebo cohort (n=343 [55%, EGFR exon 19 deletion, 45%, EGFR L858R, 1%, EGFR T790M]) were alive and disease-free at 24 months (HR=0.20 [99.12% CI=0.14-0.30], p<0.001) (PMID: 32955177). __In the Phase III LAURA (NCT03521154) trial of osimertinib versus placebo in 216 patients with unresectable EGFR mutation-positive stage III NSCLC without progression during or after chemoradiotherapy, the osimertinib cohort (n=143 [n=74, EGFR exon 19 deletion, n=68, EGFR L858R]) demonstrated an objective response rate (ORR) of 57% (95% CI=49-66), with a 2% (n=3) complete response (CR) rate, 55% (n=79) partial response (PR) rate and 31% (n=45) stable disease (SD) rate, a median progression-free survival (PFS) of 39.1 months (95% CI=31.5-NC) and a median duration of response (DOR) of 36.9 months (95% CI=30.1-NC). In contrast, the placebo cohort (n=73 [n=43, EGFR exon 19 deletion, n=30, EGFR L858R]) demonstrated an ORR of 33% (95% CI=22-45) (OR=2.77 [95% CI=1.54-5.08]), with a 1% (n=1) CR rate, 32% (n=23) PR rate and 47% (n=34) SD rate, a median PFS of 5.6 months (95% CI=3.7-7.4) (HR=0.16 [95% CI=0.10-0.24], p<0.001) and a median DOR of 6.5 months (95% CI=3.6-8.3) (PMID: 38828946). __In the Phase III FLAURA (NCT02296125) trial of osimertinib versus standard EGFR TKI (gefitinib or erlotinib) in 556 patients with previously untreated, EGFR mutation-positive advanced NSCLC, the osimertinib cohort (n=279 [n=175, EGFR exon 19 deletion, n=104, EGFR L858R]) demonstrated an ORR of 80% (95% CI=75-85), with a 3% (n=7) CR rate, 77% (n=216) PR rate and 17% (n=47) SD rate, a median PFS of 18.9 months (95% CI=15.2-21.4), a median DOR of 17.2 months (95% CI=13.8-22.0) and a median overall survival (OS) could not be calculated (95% CI=NC-NC). In contrast, the standard EGFR TKI cohort (n=277 [n=174, EGFR exon 19 deletion, n=103, EGFR L858R]) demonstrated an ORR of 76% (95% CI=70-81), with a 1% (n=4) CR rate, 74% (n=206) PR rate and 17% (n=46) SD rate, a median PFS of 10.2 months (95% CI=9.6-11.1) (HR=0.46 [95% CI=0.37-0.57], p<0.001), a median DOR of 8.5 months (95% CI=7.3-9.8) and a median OS that could not be calculated (95% CI=NC-NC) (HR=0.63 [95% CI=0.45-0.88], p=0.007) (PMID: 29151359). In the final analysis of the OS in the Phase III FLAURA (NCT02296125) trial, the osimertinib cohort and standard EGFR TKI cohort demonstrated a median OS of 38.6 months (95% CI=34.5-41.8) and 31.8 months (95% CI=26.6-36.0), respectively (HR=0.80 [95.05% CI=0.64-1.00], p=0.046) (PMID: 31751012).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']Osimertinib + ChemotherapyLEVEL_1LEVEL_Fda2['37937763']Osimertinib is an orally available, small molecule third-generation EGFR T790M tyrosine kinase inhibitor (TKI) that is FDA-approved in combination with pemetrexed and platinum-based chemotherapy, the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, as detected by an FDA-approved test. EGFR exon 19 deletions and exon 21 L858R mutations for treatment with osimertinib were detected by the cobas EGFR Mutation Test v2, FoundationOne CDx, FoundationOne Liquid CDx or Guardant360 CDx. __FDA approval is based on the results of the Phase III FLAURA2 (NCT04035486) trial of osimertinib plus chemotherapy (pemetrexed plus cisplatin or carboplatin) versus single-agent osimertinib in 557 patients with previously untreated, EGFR mutation-positive advanced NSCLC. In the Phase III FLAURA2 (NCT04035486) trial, the osimertinib plus chemotherapy cohort (n=279 [n=169, EGFR exon 19 deletion, n=106, EGFR L858R, n=3, both, n=1, unknown]) demonstrated a median progression-free survival (PFS) of 25.5 months (95% CI=24.7-NC), a median duration of response (DOR) of 24.0 months (95% CI=20.9-27.8) and an objective response rate (ORR) of 83% (95% CI=78-87), with an 83% partial response (PR) rate and <1% complete response (CR) rate. The osimertinib monotherapy cohort (n=278 [n=168, EGFR exon 19 deletion, n=106, EGFR L858R, n=3, both, n=2, unknown]) demonstrated a median PFS of 16.7 months (95% CI=14.1-21.3) (HR=0.62 [95% CI=0.490.79], p<0.001), a median DOR of 15.3 months (95% CI=12.7-9.4) and an ORR of 76% (95% CI=70-80), with a 75% PR rate and 1% CR rate (PMID: 37937763).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']Erlotinib + RamucirumabLEVEL_1LEVEL_Fda2['22285168', '27987585']Erlotinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is approved with or without ramucirumab for the treatment of non-small cell lung cancer (NSCLC) with EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. Results of the Phase III EURTAC trial demonstrated that patients with NSCLC receiving erlotinib showed significant improvement in progression-free survival (PFS) (9.7 vs. 5.2 months, HR=0.37, p=0.0001) compared to those receiving platinum-based doublet chemotherapy (PMID: 22285168). The partial response rate with erlotinib was 56%, compared to 13% with chemotherapy, and was associated with a reduced toxicity profile (PMID: 22285168). The safety and efficacy of erlotinib have not been established in patients harboring EGFR mutations other than exon 19 deletion and exon 21 (L858R) substitution, however, the phase III IUNO trial demonstrated no difference in PFS between patients with NSCLC lacking EGFR exon 19 deletion or EGFR L858R mutation who were given erlotinib versus placebo as maintenance therapy (PMID: 27987585).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions', 'L861Q', 'Exon 19 in-frame insertions', 'S768I', 'G719']Patritumab DeruxtecanLEVEL_3ALEVEL_Fda3['37689979', '38369013', '31661465', '34548309', '30057690', '34084213']Patritumab deruxtecan (HER3-DXd) is an antibody-drug conjugate consisting of a HER3 antibody attached to a topoisomerase I inhibitor payload via a tetrapeptide-based cleavable linker. HER3 is the preferred heterodimeric partner for EGFR (PMID: 34084213, 30057690). In a phase I dose-escalation/expansion study (NCT03260491) of HER3-DXd in 57 patients with locally advanced or metastatic EGFR-mutated non-small cell lung cancer (NSCLC) (n=33 with Exon 19 deletion), the objective response rate (ORR) was 39% (95% CI=26.052.4) and median progression-free survival (PFS) was 8.2 (95% CI=4.48.3) months (PMID: 34548309). In the phase II HERTHENA-Lung01 trial of HER3-DXd in 225 patients with previously treated EGFR-mutated NSCLC, the median PFS was 5.5 months (95% CI=5.1-5.9) and an objective response was observed in 67 patients (29.8%, 95% CI=23.9-36.2), with complete response observed in one patient (PMID: 37689979). In preclinical studies, in vitro and in vivo models containing HER3-expressing CM-3 cancer cells treated with U3-1402 (HER3-DXd) exhibited reduced cell viability and tumor volume, respectively (PMID: 31661465). In the Phase I U31402-A-U102 (NCT03260491) trial of HER3-DXd in 97 patients with EGFR-mutated NSCLC who had received prior EGFR tyrosine kinase inhibitor therapy and platinum-based chemotherapy (n=64, exon 19 deletion, n=29, L858R, n=4, G719A, n=2, L861Q, n=1, exon 19 insertion), the cohort demonstrated an ORR of 39.2% (n=38) (95% CI=29.4-49.6), with a 1% (n=1) confirmed response rate, 38.1% (n=37) partial response rate, 40.2% (n=39) stable disease rate and 12.4% (n=12) progressive disease rate, a median duration of response of 9.6 months (95% CI=6.9-15.4), a median PFS of 6.4 months (95% CI=4.9-8.3) and a median overall survival of 15.8 months (95% CI=10.8-21.5) (PMID: 38369013).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID18508816;29141884;16467085;15329413;25179728;15710947;15118125;15897572;18325048;15118073;18261621;22483783;1637340223816960;22452895;25589191;37879444;38924756;29864379;28958502;39761483;39250535;22285168;27987585;20022809;19692680;21670455;22370314;31682542;20573926;38828946;32955177;29151359;31751012;37937763;37689979;38369013;31661465;34548309;30057690;3408421395
TUMORp.T790MENSP00000275493.2:p.Thr790Metchr755181378CTPASSNM_005228missense_variantMODERATEEGFR20/28c.2369C>Trs121434569&CM054664&COSV51765492SNVdeleterious_low_confidence(0)probably_damaging(1)6.156e-064.599e-057.237e-05gnomADg_AFR0.000.000.000.000.5294.7500e-01EGFR-related_disorder&Lung_cancer&Inflammatory_skin_and_bowel_disease&_neonatal&_2&Hereditary_cancer-predisposing_syndrome&not_provided&EGFR-related_lung_cancer&Non-small_cell_lung_carcinoma&Lung_adenocarcinoma&Tyrosine_kinase_inhibitor_response&gefitinib_response_-_Efficacy&erlotinib_response_-_EfficacyNC_000007.14:g.55181378C>Treviewed_by_expert_paneldrug_responseOncogeniccriteria_provided&_single_submitter3EGFRT790Mrs121434569✓ Hotspotv7.0.LEVEL_Fda2✓ Hotspot07/07/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicDatopotamab Deruxtecan,OsimertinibErlotinib,Gefitinib,AfatinibLEVEL_R1LEVEL_1LEVEL_R160,350/1T790M0.3684210526315789GRCh38EGFRCTMissense_MutationSNPC55181378EGFR_T790M.GT:AD:AF:DP0/1:60,35:0.37:95TENSG00000146648TranscriptENST00000275493protein_coding26302369790T/MaCg/aTg1HGNCHGNC:3236YESMANE_SelectNM_005228.51P1CCDS5514.1ENSP00000275493P00533.293UPI000003E750P00533-1EnsemblCC1PDB-ENSP_mappings:1m14.A&PDB-ENSP_mappings:1m17.A&PDB-ENSP_mappings:1xkk.A&PDB-ENSP_mappings:2eb2.A&PDB-ENSP_mappings:2eb3.A&PDB-ENSP_mappings:2gs2.A&PDB-ENSP_mappings:2gs6.A&PDB-ENSP_mappings:2gs7.A&PDB-ENSP_mappings:2gs7.B&PDB-ENSP_mappings:2itn.A&PDB-ENSP_mappings:2ito.A&PDB-ENSP_mappings:2itp.A&PDB-ENSP_mappings:2itq.A&PDB-ENSP_mappings:2itt.A&PDB-ENSP_mappings:2itu.A&PDB-ENSP_mappings:2itv.A&PDB-ENSP_mappings:2itw.A&PDB-ENSP_mappings:2itx.A&PDB-ENSP_mappings:2ity.A&PDB-ENSP_mappings:2itz.A&PDB-ENSP_mappings:2j5e.A&PDB-ENSP_mappings:2j5f.A&PDB-ENSP_mappings:2j6m.A&PDB-ENSP_mappings:2jit.A&PDB-ENSP_mappings:2jit.B&PDB-ENSP_mappings:2jiu.A&PDB-ENSP_mappings:2jiu.B&PDB-ENSP_mappings:2jiv.A&PDB-ENSP_mappings:2jiv.B&PDB-ENSP_mappings:2rf9.A&PDB-ENSP_mappings:2rf9.B&PDB-ENSP_mappings:2rfd.A&PDB-ENSP_mappings:2rfd.B&PDB-ENSP_mappings:2rfe.A&PDB-ENSP_mappings:2rfe.B&PDB-ENSP_mappings:2rfe.C&PDB-ENSP_mappings:2rfe.D&PDB-ENSP_mappings:2rgp.A&PDB-ENSP_mappings:3bel.A&PDB-ENSP_mappings:3gop.A&PDB-ENSP_mappings:3gt8.A&PDB-ENSP_mappings:3gt8.B&PDB-ENSP_mappings:3gt8.C&PDB-ENSP_mappings:3gt8.D&PDB-ENSP_mappings:3ika.A&PDB-ENSP_mappings:3ika.B&PDB-ENSP_mappings:3lzb.A&PDB-ENSP_mappings:3lzb.B&PDB-ENSP_mappings:3lzb.C&PDB-ENSP_mappings:3lzb.D&PDB-ENSP_mappings:3lzb.E&PDB-ENSP_mappings:3lzb.F&PDB-ENSP_mappings:3lzb.G&PDB-ENSP_mappings:3lzb.H&PDB-ENSP_mappings:3poz.A&PDB-ENSP_mappings:3ug1.A&PDB-ENSP_mappings:3ug2.A&PDB-ENSP_mappings:3vjn.A&PDB-ENSP_mappings:3vjo.A&PDB-ENSP_mappings:3w2o.A&PDB-ENSP_mappings:3w2p.A&PDB-ENSP_mappings:3w2q.A&PDB-ENSP_mappings:3w2r.A&PDB-ENSP_mappings:3w2s.A&PDB-ENSP_mappings:3w32.A&PDB-ENSP_mappings:3w33.A&PDB-ENSP_mappings:4g5j.A&PDB-ENSP_mappings:4g5p.A&PDB-ENSP_mappings:4g5p.B&PDB-ENSP_mappings:4hjo.A&PDB-ENSP_mappings:4i1z.A&PDB-ENSP_mappings:4i20.A&PDB-ENSP_mappings:4i21.A&PDB-ENSP_mappings:4i21.B&PDB-ENSP_mappings:4i22.A&PDB-ENSP_mappings:4i23.A&PDB-ENSP_mappings:4i24.A&PDB-ENSP_mappings:4i24.B&PDB-ENSP_mappings:4jq7.A&PDB-ENSP_mappings:4jq8.A&PDB-ENSP_mappings:4jr3.A&PDB-ENSP_mappings:4jrv.A&PDB-ENSP_mappings:4li5.A&PDB-ENSP_mappings:4ll0.A&PDB-ENSP_mappings:4ll0.B&PDB-ENSP_mappings:4lqm.A&PDB-ENSP_mappings:4lrm.A&PDB-ENSP_mappings:4lrm.B&PDB-ENSP_mappings:4lrm.C&PDB-ENSP_mappings:4lrm.D&PDB-ENSP_mappings:4lrm.E&PDB-ENSP_mappings:4r3p.A&PDB-ENSP_mappings:4r3r.A&PDB-ENSP_mappings:4r5s.A&PDB-ENSP_mappings:4riw.B&PDB-ENSP_mappings:4riw.D&PDB-ENSP_mappings:4rix.B&PDB-ENSP_mappings:4rix.D&PDB-ENSP_mappings:4riy.B&PDB-ENSP_mappings:4riy.D&PDB-ENSP_mappings:4rj4.A&PDB-ENSP_mappings:4rj5.A&PDB-ENSP_mappings:4rj6.A&PDB-ENSP_mappings:4rj7.A&PDB-ENSP_mappings:4rj8.A&PDB-ENSP_mappings:4tks.A&PDB-ENSP_mappings:4wd5.A&PDB-ENSP_mappings:4wd5.B&PDB-ENSP_mappings:4wkq.A&PDB-ENSP_mappings:4wrg.A&PDB-ENSP_mappings:4zau.A&PDB-ENSP_mappings:4zjv.A&PDB-ENSP_mappings:4zjv.B&PDB-ENSP_mappings:4zse.A&PDB-ENSP_mappings:4zse.B&PDB-ENSP_mappings:4zse.C&PDB-ENSP_mappings:4zse.D&PDB-ENSP_mappings:5c8k.A&PDB-ENSP_mappings:5c8m.A&PDB-ENSP_mappings:5c8n.A&PDB-ENSP_mappings:5cal.A&PDB-ENSP_mappings:5can.A&PDB-ENSP_mappings:5cao.A&PDB-ENSP_mappings:5cap.A&PDB-ENSP_mappings:5caq.A&PDB-ENSP_mappings:5cas.A&PDB-ENSP_mappings:5cau.A&PDB-ENSP_mappings:5cav.A&PDB-ENSP_mappings:5cnn.A&PDB-ENSP_mappings:5cnn.B&PDB-ENSP_mappings:5cno.A&PDB-ENSP_mappings:5cno.B&PDB-ENSP_mappings:5cno.X&PDB-ENSP_mappings:5czh.A&PDB-ENSP_mappings:5czi.A&PDB-ENSP_mappings:5d41.A&PDB-ENSP_mappings:5d41.B&PDB-ENSP_mappings:5edp.A&PDB-ENSP_mappings:5edq.A&PDB-ENSP_mappings:5edr.A&PDB-ENSP_mappings:5em5.A&PDB-ENSP_mappings:5em6.A&PDB-ENSP_mappings:5em7.A&PDB-ENSP_mappings:5em8.A&PDB-ENSP_mappings:5fed.A&PDB-ENSP_mappings:5fee.A&PDB-ENSP_mappings:5feq.A&PDB-ENSP_mappings:5gmp.A&PDB-ENSP_mappings:5gnk.A&PDB-ENSP_mappings:5gty.A&PDB-ENSP_mappings:5gty.B&PDB-ENSP_mappings:5gty.C&PDB-ENSP_mappings:5gty.D&PDB-ENSP_mappings:5gty.E&PDB-ENSP_mappings:5gty.F&PDB-ENSP_mappings:5gty.G&PDB-ENSP_mappings:5gty.H&PDB-ENSP_mappings:5gtz.A&PDB-ENSP_mappings:5hcx.A&PDB-ENSP_mappings:5hcy.A&PDB-ENSP_mappings:5hcz.A&PDB-ENSP_mappings:5hg5.A&PDB-ENSP_mappings:5hg7.A&PDB-ENSP_mappings:5hg8.A&PDB-ENSP_mappings:5hg9.A&PDB-ENSP_mappings:5hib.A&PDB-ENSP_mappings:5hic.A&PDB-ENSP_mappings:5j9y.A&PDB-ENSP_mappings:5j9z.A&PDB-ENSP_mappings:5jeb.A&PDB-ENSP_mappings:5u8l.A&PDB-ENSP_mappings:5ug8.A&PDB-ENSP_mappings:5ug9.A&PDB-ENSP_mappings:5uga.A&PDB-ENSP_mappings:5ugb.A&PDB-ENSP_mappings:5ugc.A&PDB-ENSP_mappings:5uwd.A&PDB-ENSP_mappings:5x26.A&PDB-ENSP_mappings:5x27.A&PDB-ENSP_mappings:5x28.A&PDB-ENSP_mappings:5x2a.A&PDB-ENSP_mappings:5x2a.B&PDB-ENSP_mappings:5x2a.C&PDB-ENSP_mappings:5x2a.D&PDB-ENSP_mappings:5x2c.A&PDB-ENSP_mappings:5x2c.B&PDB-ENSP_mappings:5x2f.A&PDB-ENSP_mappings:5x2f.B&PDB-ENSP_mappings:5x2f.C&PDB-ENSP_mappings:5x2f.D&PDB-ENSP_mappings:5x2k.A&PDB-ENSP_mappings:5xdk.A&PDB-ENSP_mappings:5xdl.A&PDB-ENSP_mappings:5xgm.A&PDB-ENSP_mappings:5xgn.A&PDB-ENSP_mappings:5xgn.B&PDB-ENSP_mappings:5y25.A&PDB-ENSP_mappings:5y9t.A&PDB-ENSP_mappings:5yu9.A&PDB-ENSP_mappings:5yu9.B&PDB-ENSP_mappings:5yu9.C&PDB-ENSP_mappings:5yu9.D&PDB-ENSP_mappings:5zto.A&PDB-ENSP_mappings:5zwj.A&PDB-ENSP_mappings:6d8e.A&PDB-ENSP_mappings:6duk.A&PDB-ENSP_mappings:6duk.B&PDB-ENSP_mappings:6duk.C&PDB-ENSP_mappings:6duk.D&PDB-ENSP_mappings:6duk.E&PDB-ENSP_mappings:6duk.F&PDB-ENSP_mappings:6jrj.A&PDB-ENSP_mappings:6jrk.A&PDB-ENSP_mappings:6jrx.A&PDB-ENSP_mappings:6jwl.A&PDB-ENSP_mappings:6jx0.A&PDB-ENSP_mappings:6jx4.A&PDB-ENSP_mappings:6jxt.A&PDB-ENSP_mappings:6jz0.A&PDB-ENSP_mappings:6lub.A&PDB-ENSP_mappings:6lud.A&PDB-ENSP_mappings:6p1d.A&PDB-ENSP_mappings:6p1d.B&PDB-ENSP_mappings:6p1d.C&PDB-ENSP_mappings:6p1d.D&PDB-ENSP_mappings:6p1l.A&PDB-ENSP_mappings:6p1l.B&PDB-ENSP_mappings:6p1l.C&PDB-ENSP_mappings:6p1l.D&PDB-ENSP_mappings:6p8q.A&PDB-ENSP_mappings:6p8q.B&PDB-ENSP_mappings:6p8q.C&PDB-ENSP_mappings:6p8q.D&PDB-ENSP_mappings:6s89.A&PDB-ENSP_mappings:6s8a.A&PDB-ENSP_mappings:6s9b.A&PDB-ENSP_mappings:6s9c.A&PDB-ENSP_mappings:6s9d.A&PDB-ENSP_mappings:6tfu.A&PDB-ENSP_mappings:6tfu.B&PDB-ENSP_mappings:6tfv.A&PDB-ENSP_mappings:6tfv.B&PDB-ENSP_mappings:6tfw.A&PDB-ENSP_mappings:6tfw.B&PDB-ENSP_mappings:6tfy.A&PDB-ENSP_mappings:6tfy.B&PDB-ENSP_mappings:6tfz.A&PDB-ENSP_mappings:6tfz.B&PDB-ENSP_mappings:6tg0.A&PDB-ENSP_mappings:6tg0.B&PDB-ENSP_mappings:6tg1.A&PDB-ENSP_mappings:6tg1.B&PDB-ENSP_mappings:6v5n.A&PDB-ENSP_mappings:6v5n.B&PDB-ENSP_mappings:6v5n.C&PDB-ENSP_mappings:6v5n.D&PDB-ENSP_mappings:6v5p.A&PDB-ENSP_mappings:6v5p.B&PDB-ENSP_mappings:6v5p.C&PDB-ENSP_mappings:6v5p.D&PDB-ENSP_mappings:6v66.A&PDB-ENSP_mappings:6v66.B&PDB-ENSP_mappings:6v66.C&PDB-ENSP_mappings:6v66.D&PDB-ENSP_mappings:6v6k.A&PDB-ENSP_mappings:6v6k.B&PDB-ENSP_mappings:6v6k.C&PDB-ENSP_mappings:6v6k.D&PDB-ENSP_mappings:6v6k.E&PDB-ENSP_mappings:6v6k.F&PDB-ENSP_mappings:6v6k.G&PDB-ENSP_mappings:6v6k.H&PDB-ENSP_mappings:6v6o.A&PDB-ENSP_mappings:6v6o.B&PDB-ENSP_mappings:6v6o.C&PDB-ENSP_mappings:6v6o.D&PDB-ENSP_mappings:6v6o.E&PDB-ENSP_mappings:6v6o.F&PDB-ENSP_mappings:6v6o.G&PDB-ENSP_mappings:6v6o.H&PDB-ENSP_mappings:6vh4.A&PDB-ENSP_mappings:6vhn.A&PDB-ENSP_mappings:6vhp.A&PDB-ENSP_mappings:6wa2.A&PDB-ENSP_mappings:6wa2.B&PDB-ENSP_mappings:6wa2.C&PDB-ENSP_mappings:6wa2.D&PDB-ENSP_mappings:6wak.A&PDB-ENSP_mappings:6wak.B&PDB-ENSP_mappings:6wak.C&PDB-ENSP_mappings:6wak.D&PDB-ENSP_mappings:6wxn.A&PDB-ENSP_mappings:6wxn.B&PDB-ENSP_mappings:6wxn.C&PDB-ENSP_mappings:6wxn.D&PDB-ENSP_mappings:6xl4.A&PDB-ENSP_mappings:6xl4.B&PDB-ENSP_mappings:6xl4.C&PDB-ENSP_mappings:6xl4.D&PDB-ENSP_mappings:6z4b.A&PDB-ENSP_mappings:6z4b.B&PDB-ENSP_mappings:6z4d.A&PDB-ENSP_mappings:6z4d.B&PDB-ENSP_mappings:7a2a.A&PDB-ENSP_mappings:7a2a.B&PDB-ENSP_mappings:7a6i.A&PDB-ENSP_mappings:7a6j.A&PDB-ENSP_mappings:7a6j.B&PDB-ENSP_mappings:7a6k.A&PDB-ENSP_mappings:7a6k.B&PDB-ENSP_mappings:7a6k.C&PDB-ENSP_mappings:7a6k.D&PDB-ENSP_mappings:7aei.A&PDB-ENSP_mappings:7aem.A&PDB-ENSP_mappings:7b85.A&PDB-ENSP_mappings:7er2.A&PDB-ENSP_mappings:7jxi.A&PDB-ENSP_mappings:7jxi.B&PDB-ENSP_mappings:7jxi.C&PDB-ENSP_mappings:7jxi.D&PDB-ENSP_mappings:7jxk.A&PDB-ENSP_mappings:7jxk.B&PDB-ENSP_mappings:7jxk.C&PDB-ENSP_mappings:7jxk.D&PDB-ENSP_mappings:7jxk.E&PDB-ENSP_mappings:7jxk.F&PDB-ENSP_mappings:7jxl.A&PDB-ENSP_mappings:7jxl.B&PDB-ENSP_mappings:7jxl.C&PDB-ENSP_mappings:7jxl.D&PDB-ENSP_mappings:7jxm.A&PDB-ENSP_mappings:7jxm.B&PDB-ENSP_mappings:7jxm.C&PDB-ENSP_mappings:7jxm.D&PDB-ENSP_mappings:7jxp.A&PDB-ENSP_mappings:7jxp.B&PDB-ENSP_mappings:7jxp.C&PDB-ENSP_mappings:7jxp.D&PDB-ENSP_mappings:7jxp.E&PDB-ENSP_mappings:7jxp.F&PDB-ENSP_mappings:7jxq.A&PDB-ENSP_mappings:7jxq.B&PDB-ENSP_mappings:7jxq.C&PDB-ENSP_mappings:7jxq.D&PDB-ENSP_mappings:7jxw.A&PDB-ENSP_mappings:7jxw.B&PDB-ENSP_mappings:7jxw.C&PDB-ENSP_mappings:7jxw.D&PDB-ENSP_mappings:7k1h.A&PDB-ENSP_mappings:7k1h.B&PDB-ENSP_mappings:7k1h.C&PDB-ENSP_mappings:7k1h.D&PDB-ENSP_mappings:7k1h.E&PDB-ENSP_mappings:7k1h.F&PDB-ENSP_mappings:7k1i.A&PDB-ENSP_mappings:7kxz.A&PDB-ENSP_mappings:7ky0.A&PDB-ENSP_mappings:7ky0.B&PDB-ENSP_mappings:7ky0.C&PDB-ENSP_mappings:7ky0.D&PDB-ENSP_mappings:7lg8.A&PDB-ENSP_mappings:7lg8.B&PDB-ENSP_mappings:7lg8.C&PDB-ENSP_mappings:7lg8.D&PDB-ENSP_mappings:7lgs.A&PDB-ENSP_mappings:7lgs.B&PDB-ENSP_mappings:7lgs.C&PDB-ENSP_mappings:7lgs.D&PDB-ENSP_mappings:7ltx.A&PDB-ENSP_mappings:7ltx.B&PDB-ENSP_mappings:7ltx.C&PDB-ENSP_mappings:7ltx.D&PDB-ENSP_mappings:7oxb.A&PDB-ENSP_mappings:7si1.A&PDB-ENSP_mappings:7syd.A&PDB-ENSP_mappings:7syd.B&PDB-ENSP_mappings:7sye.A&PDB-ENSP_mappings:7sye.B&PDB-ENSP_mappings:7sz0.A&PDB-ENSP_mappings:7sz0.B&PDB-ENSP_mappings:7sz1.A&PDB-ENSP_mappings:7sz1.B&PDB-ENSP_mappings:7sz5.A&PDB-ENSP_mappings:7sz5.B&PDB-ENSP_mappings:7sz7.A&PDB-ENSP_mappings:7sz7.B&PDB-ENSP_mappings:7t4i.A&PDB-ENSP_mappings:7t4j.A&PDB-ENSP_mappings:7t4j.B&PDB-ENSP_mappings:7tvd.A&PDB-ENSP_mappings:7u98.A&PDB-ENSP_mappings:7u98.B&PDB-ENSP_mappings:7u98.C&PDB-ENSP_mappings:7u98.D&PDB-ENSP_mappings:7u99.A&PDB-ENSP_mappings:7u9a.A&PDB-ENSP_mappings:7ukv.A&PDB-ENSP_mappings:7ukw.A&PDB-ENSP_mappings:7ukw.B&PDB-ENSP_mappings:7ukw.C&PDB-ENSP_mappings:7ukw.D&PDB-ENSP_mappings:7vra.A&PDB-ENSP_mappings:7vre.A&PDB-ENSP_mappings:7zym.A&PDB-ENSP_mappings:7zyn.A&PDB-ENSP_mappings:7zyp.A&PDB-ENSP_mappings:7zyq.A&PDB-ENSP_mappings:7zyq.B&PDB-ENSP_mappings:8a27.A&PDB-ENSP_mappings:8a2a.A&PDB-ENSP_mappings:8a2b.A&PDB-ENSP_mappings:8a2d.A&PDB-ENSP_mappings:8d73.A&PDB-ENSP_mappings:8d73.B&PDB-ENSP_mappings:8d76.A&PDB-ENSP_mappings:8d76.B&PDB-ENSP_mappings:8dsw.A&PDB-ENSP_mappings:8eme.A&PDB-ENSP_mappings:8eme.B&PDB-ENSP_mappings:8f1h.A&PDB-ENSP_mappings:8f1w.A&PDB-ENSP_mappings:8f1w.B&PDB-ENSP_mappings:8f1w.C&PDB-ENSP_mappings:8f1w.D&PDB-ENSP_mappings:8f1x.A&PDB-ENSP_mappings:8f1y.A&PDB-ENSP_mappings:8f1z.A&PDB-ENSP_mappings:8fv3.A&PDB-ENSP_mappings:8fv3.B&PDB-ENSP_mappings:8fv3.C&PDB-ENSP_mappings:8fv3.D&PDB-ENSP_mappings:8fv4.A&PDB-ENSP_mappings:8fv4.B&PDB-ENSP_mappings:8fv4.C&PDB-ENSP_mappings:8fv4.D&PDB-ENSP_mappings:8g63.A&PDB-ENSP_mappings:8gb4.A&PDB-ENSP_mappings:8gb4.B&PDB-ENSP_mappings:8gb4.C&PDB-ENSP_mappings:8gb4.D&PDB-ENSP_mappings:8gk5.A&PDB-ENSP_mappings:8gk5.B&PDB-ENSP_mappings:8gk5.C&PDB-ENSP_mappings:8gk5.D&PDB-ENSP_mappings:8h7x.A&PDB-ENSP_mappings:8h7x.B&PDB-ENSP_mappings:8hv1.A&PDB-ENSP_mappings:8hv2.A&PDB-ENSP_mappings:8hv3.A&PDB-ENSP_mappings:8hv4.A&PDB-ENSP_mappings:8hv5.A&PDB-ENSP_mappings:8hv6.A&PDB-ENSP_mappings:8hv7.A&PDB-ENSP_mappings:8hv8.A&PDB-ENSP_mappings:8hv9.A&PDB-ENSP_mappings:8hva.A&PDB-ENSP_mappings:8hy7.A&PDB-ENSP_mappings:8kfq.A&PDB-ENSP_mappings:8pnz.A&PDB-ENSP_mappings:8po0.A&PDB-ENSP_mappings:8po1.A&PDB-ENSP_mappings:8po2.A&PDB-ENSP_mappings:8po2.B&PDB-ENSP_mappings:8po2.D&PDB-ENSP_mappings:8po3.A&PDB-ENSP_mappings:8po4.A&PDB-ENSP_mappings:8po4.B&PDB-ENSP_mappings:8sc7.A&PDB-ENSP_mappings:8tjl.A&PDB-ENSP_mappings:8to3.A&PDB-ENSP_mappings:8to3.B&PDB-ENSP_mappings:8to3.C&PDB-ENSP_mappings:8to3.D&PDB-ENSP_mappings:8to4.A&PDB-ENSP_mappings:8to4.B&PDB-ENSP_mappings:8to4.C&PDB-ENSP_mappings:8to4.D&PDB-ENSP_mappings:8wd4.A&Transmembrane_helices:TMhelix&SMART:SM00219&Superfamily:SSF56112&CDD:cd05108&PANTHER:PTHR24416&PROSITE_profiles:PS50011&Phobius:CYTOPLASMIC_DOMAIN&Prints:PR00109&Pfam:PF07714&Gene3D:3.30.200.20&PIRSF:PIRSF000619&AFDB-ENSP_mappings:AF-P00533-F12.987e-052.236e-0500006.295e-06007.237e-050000005.879e-0500drug_response&pathogenic&pathogenic/likely_pathogenic&likely_pathogenic&protective0&1&11&1&122992668&25157968&28158543&21430269&20068085&15118073&15118125&15329413&23102728&15901872&22215752&11423618&15272417&15728811&15737014&16258541&17020982&17085664&17332364&17510392&18093943&18227510&18596266&18981003&18992959&19096324&19381876&19589612&20033049&20129249&21194487&21233402&21248300&21252721&21531810&21921847&22452896&22588155&23540867&23816963&24065731&24202392&24453288&24478319&24623981&24636847&24658966&24729716&24736066&24736080&24893891&25668228&25923549&25923550&26515464&26720284&27074804&25477325&36388934&36164570&37425402&38431735FAIL5-7-27EGFR166130.0000431652.&MONDO:MONDO:0008903&MedGen:C0242379&OMIM:211980&MONDO:MONDO:0014481&MedGen:C4015130&OMIM:616069&Orphanet:294023&MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MedGen:C3661900&MedGen:CN130014&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&Human_Phenotype_Ontology:HP:0030078&MONDO:MONDO:0005061&MeSH:D000077192&MedGen:C0152013&MedGen:CN225347&MedGen:CN322733&MedGen:CN322731SCV000268172&SCV002031219single_nucleotide_variantSO:0001483ClinGen:CA090928&ClinPGx_Clinical_Annotation:981475450&Genetic_Testing_Registry_(GTR):GTR000575663&OMIM:131550.0006&UniProtKB:P00533#VAR_026098EGFR:1956&EGFR-AS1:100507500SO:0001583&missense_variant&SO:0001619&non-coding_transcript_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV0050941351214345697:55181378-55181378EGFRp.T790M.False.The EGFR exon 20 T790M mutation occurs in the EGFR tyrosine kinase domain and is considered a "gatekeeper" mutation. This mutation is found in non-small cell lung cancer (PMID: 15737014). Studies show that this mutation is oncogenic and increases the affinity of EGFR for ATP (PMID: 18227510). EGFR T790M generally occurs as an acquired secondary mutation upon prolonged exposure to first- and second-generation EGFR tyrosine kinase inhibitors (TKIs) such as erlotinib, gefinitib or afatinib, and is recognized by the NCCN to confer clinical resistance to these inhibitors (PMID: 15728811, 15737014, 18227510). The third-generation EGFR TKI, osimertinib, is associated with clinical benefit in patients with the EGFR T790M mutation and is FDA-approved for patients with EGFR T790M-mutant non-small cell lung cancer (PMID: 29151359). Preclinical models with EGFR exon 19 deletion and the T790M and L792H mutations show resistance to first-, second-, and third-generation EGFR inhibitors, and moderate sensitivity to PKC and ALK inhibitors (PMID: 34526717)..EGFR, a receptor tyrosine kinase, is altered by amplification and/or mutation in lung and brain cancers among others...15737014|29151359|15728811|34526717|18227510..T790M1956EGFRGRCh38.MUTATIONLEVEL_R1.The EGFR T790M mutation is known to be oncogenic.FalseLEVEL_Fda2The EGFR exon 20 T790M mutation occurs in the EGFR tyrosine kinase domain and is considered a "gatekeeper" mutation. This mutation is found in non-small cell lung cancer (PMID: 15737014). Studies show that this mutation is oncogenic and increases the affinity of EGFR for ATP (PMID: 18227510). EGFR T790M generally occurs as an acquired secondary mutation upon prolonged exposure to first- and second-generation EGFR tyrosine kinase inhibitors (TKIs) such as erlotinib, gefinitib or afatinib, and is recognized by the NCCN to confer clinical resistance to these inhibitors (PMID: 15728811, 15737014, 18227510). The third-generation EGFR TKI, osimertinib, is associated with clinical benefit in patients with the EGFR T790M mutation and is FDA-approved for patients with EGFR T790M-mutant non-small cell lung cancer (PMID: 29151359). Preclinical models with EGFR exon 19 deletion and the T790M and L792H mutations show resistance to first-, second-, and third-generation EGFR inhibitors, and moderate sensitivity to PKC and ALK inhibitors (PMID: 34526717).['15737014', '29151359', '15728811', '34526717', '18227510']['T790M']ErlotinibLEVEL_R1LEVEL_Fda2['24478319', '26051236', '23816963'][{'abstract': 'Yang et al. Abstract# O03.05, IASLC 2013.', 'link': 'http://library.iaslc.org/search-speaker?search_speaker=17991'}]Erlotinib, gefitinib and afatinib are first- and second-generation EGFR tyrosine kinase inhibitors (TKIs), respectively. Responses to first- and second-generation switch TKIs at the time of T790M-mediated acquired resistance is uncommon. Two patients with EGFR T790M mutant acquired resistance to erlotinib/gefitinib were treated with afatinib in LUX-Lung 4: both achieved stable disease, one for nine months and the other for one month (PMID: 23816963). Resistance to standard EGFR TKIs is typical in patients with de novo EGFR T790M mutations, although responses are uncommonly reported. In one series, only one of thirteen (8%, 95% CI=0-35%) patients with de novo EGFR T790M mutant lung cancers had an objective response to erlotinib (PMID: 24478319). In another series of four patients with de novo EGFR T790M mutant lung cancers, no responses were seen. Responses were seen in two of fourteen patients (14%) with de novo EGFR T790M treated with afatinib, with individual responses lasting four and twelve months, respectively (PMID: 26051236) (Abstract: Yang et al. Abstract# O03.05, IASLC 2013. http://library.iaslc.org/search-speaker?search_speaker=17991).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['T790M']GefitinibLEVEL_R1LEVEL_Fda2['24478319', '26051236', '23816963'][{'abstract': 'Yang et al. Abstract# O03.05, IASLC 2013.', 'link': 'http://library.iaslc.org/search-speaker?search_speaker=17991'}]Erlotinib, gefitinib and afatinib are first- and second-generation EGFR tyrosine kinase inhibitors (TKIs), respectively. Responses to first- and second-generation switch TKIs at the time of T790M-mediated acquired resistance is uncommon. Two patients with EGFR T790M mutant acquired resistance to erlotinib/gefitinib were treated with afatinib in LUX-Lung 4: both achieved stable disease, one for nine months and the other for one month (PMID: 23816963). Resistance to standard EGFR TKIs is typical in patients with de novo EGFR T790M mutations, although responses are uncommonly reported. In one series, only one of thirteen (8%, 95% CI=0-35%) patients with de novo EGFR T790M mutant lung cancers had an objective response to erlotinib (PMID: 24478319). In another series of four patients with de novo EGFR T790M mutant lung cancers, no responses were seen. Responses were seen in two of fourteen patients (14%) with de novo EGFR T790M treated with afatinib, with individual responses lasting four and twelve months, respectively (PMID: 26051236) (Abstract: Yang et al. Abstract# O03.05, IASLC 2013. http://library.iaslc.org/search-speaker?search_speaker=17991).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['T790M']AfatinibLEVEL_R1LEVEL_Fda2['24478319', '26051236', '23816963'][{'abstract': 'Yang et al. Abstract# O03.05, IASLC 2013.', 'link': 'http://library.iaslc.org/search-speaker?search_speaker=17991'}]Erlotinib, gefitinib and afatinib are first- and second-generation EGFR tyrosine kinase inhibitors (TKIs), respectively. Responses to first- and second-generation switch TKIs at the time of T790M-mediated acquired resistance is uncommon. Two patients with EGFR T790M mutant acquired resistance to erlotinib/gefitinib were treated with afatinib in LUX-Lung 4: both achieved stable disease, one for nine months and the other for one month (PMID: 23816963). Resistance to standard EGFR TKIs is typical in patients with de novo EGFR T790M mutations, although responses are uncommonly reported. In one series, only one of thirteen (8%, 95% CI=0-35%) patients with de novo EGFR T790M mutant lung cancers had an objective response to erlotinib (PMID: 24478319). In another series of four patients with de novo EGFR T790M mutant lung cancers, no responses were seen. Responses were seen in two of fourteen patients (14%) with de novo EGFR T790M treated with afatinib, with individual responses lasting four and twelve months, respectively (PMID: 26051236) (Abstract: Yang et al. Abstract# O03.05, IASLC 2013. http://library.iaslc.org/search-speaker?search_speaker=17991).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Oncogenic Mutations']Datopotamab DeruxtecanLEVEL_1LEVEL_Fda2['39761483', '39250535']Datopotamab deruxtecan (Dato-DXd) is an intravenously infused, TROP2-directed antibody drug conjugate that is FDA-approved for the treatment of patients with EGFR-mutated non-small cell lung cancer (NSCLC) who have received prior EGFR-directed therapy and platinum-based chemotherapy. FDA approval is based on the results of the Phase II TROPION-Lung05 (NCT04484142) and Phase III TROPION-Lung01 (NCT04656652) trials of Dato-DXd in patients with previously treated EGFR-mutated NSCLC._In the Phase II TROPION-Lung05 (NCT04484142) trial of Dato-DXd in patients with NSCLC harboring actionable alterations progressing on or after targeted therapy and platinum-based chemotherapy, patients with EGFR-mutated NSCLC (n=78 [exon 19 deletion: 41 (29.9%), exon 20 T790M: 26 (19.0%), exon 21 L858R: 25 (18.2%), exon 18 G719: 5 (3.6%), exon 21 L861Q: 3 (2.2%), exon 20 insertion: 2 (1.5%)]) demonstrated an overall response rate (ORR) of 43.6% (95% CI=32.4-55.3), with a 5.1% (n=4) complete response (CR) rate, 38.5% (n=30) partial response (PR) rate and 34.6% (n=27) stable disease (SD) rate, a disease control rate (DCR) of 82.1% (95% CI=71.7-89.8), a median duration of response (DOR) of 7.0 months (95% CI=4.2-10.2) and a median progression-free survival (PFS) of 5.8 months (95% CI=5.4-8.3) (PMID: 39761483)._In the Phase III TROPION-Lung01 (NCT04656652) trial of Dato-DXd versus docetaxel in patients with pretreated NSCLC, patients treated with Dato-DXd (n=299 [EGFR mutations: 39 (13.0%)]) demonstrated an ORR of 26.4% (95% CI= 21.5-31.8), with a 1.3% (n=4) CR rate, 25.1% (n=75) PR rate and 49.8% (n=149) SD rate, a DCR of 77.3% (95% CI=72.1-81.9), a median DOR of 7.1 months (95% CI=5.6-10.9), a median PFS of 4.4 months (95% CI=4.2-5.6) and a median overall survival (OS) of 12.9 months (95% CI=11.0-13.9) (PMID: 39250535). Patients treated with docetaxel (n=305 [EGFR mutations: 45 (14.8%)]) demonstrated an ORR of 12.8% (95% CI=9.3-17.1), with a 12.8% (n=39) PR rate and 50.2% (n=153) SD rate, a DCR of 64.9% (95% CI=59.3-70.3), a median DOR of 5.6 months (95% CI=5.4-8.1), a median PFS of 3.7 months (95% CI=2.9-4.2) (HR=0.75 [95% CI=0.62-0.91], p=.004) and a median OS of 11.8 months (95% CI=10.1-12.8) (HR=0.94 [95% CI=0.78-1.14], p=0.530) (PMID: 39250535).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['T790M']OsimertinibLEVEL_1LEVEL_Fda2['32861806', '27959700']Osimertinib is an orally available, small molecule third-generation EGFR T790M tyrosine kinase inhibitor (TKI) that is FDA-approved for the treatment of adult patients with metastatic EGFR T790M mutation-positive non-small cell lung cancer (NSCLC), as detected by an FDA-approved test, whose disease has progressed on or after EGFR TKI therapy. EGFR T790M mutations for treatment with osimertinib were detected by the cobas EGFR Mutation Test v2, FoundationOne CDx, FoundationOne Liquid CDx or Guardant360 CDx. FDA approval was based on the results of the Phase III AURA3 (NCT02151981) trial of osimertinib versus platinum-based doublet chemotherapy in 419 patients with EGFR T790M-positive advanced NSCLC, who had disease progression after first-line EGFR TKI therapy. In the Phase III AURA3 (NCT02151981) trial, the osimertinib cohort (n=279) demonstrated an objective response rate (ORR) of 71% (95% CI=65-76), with a 1% (n=4) complete response (CR) rate, 69% (n=193) partial response (PR) rate and 23% (n=63) stable disease (SD) rate, a median progression-free survival (PFS) of 10.1 months (95% CI=8.3-12.3), a median overall survival (OS) of 26.8 months (95% CI=23.5-31.5) and a median duration of response (DOR) of 9.7 months (95% CI=8.3-11.6). In contrast, the platinum-pemetrexed cohort (n=140) demonstrated an ORR of 31% (95% CI=24-40), with a 1% (n=2) CR rate, 30% (n=42) PR rate and 43% (n=60) SD rate, a median PFS of 4.4 months (95% CI=4.2-5.6) (HR=0.30 [95% CI=0.23-0.41], p<0.001), a median OS of 22.5 months (95% CI=20.2-28.8) (HR=0.87 [95% CI=0.67-1.12], p=0.277) and a median DOR of 4.2 (95% CI=3.0-5.9) (PMID: 27959700, 32861806).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID15737014;29151359;15728811;34526717;1822751024478319;26051236;23816963;Yang et al. Abstract# O03.05, IASLC 2013.(http://library.iaslc.org/search-speaker?search_speaker=17991);39761483;39250535;32861806;2795970095Tmissense_variantEGFR1956GeneENST00000275493.2NM_005228.4:c.2369C>TNP_005219.2:p.Thr790Met34THR790MET/RS121434569https://civicdb.org/links/variants/34EGFR_T790M34ENST00000275493.2:c.2369C>T/NC_000007.13:g.55249071C>T/NM_005228.4:c.2369C>T/NP_005219.2:p.Thr790MetCA09092816613
TUMORp.L858RENSP00000275493.2:p.Leu858Argchr755191822TGPASSNM_005228missense_variantMODERATEEGFR21/28c.2573T>Grs121434568&COSV51765161&COSV51854030SNVdeleterious_low_confidence(0)probably_damaging(0.997)0.000.000.000.010.9614.7500e-01Hereditary_cancer-predisposing_syndrome&Lung_carcinoma&Nonsmall_cell_lung_cancer&_response_to_tyrosine_kinase_inhibitor_in&_somatic&Adenocarcinoma_of_lung&_response_to_tyrosine_kinase_inhibitor_in&_somatic&Lung_adenocarcinoma&Tyrosine_kinase_inhibitor_response&gefitinib_response_-_EfficacyNC_000007.14:g.55191822T>Greviewed_by_expert_paneldrug_responseOncogeniccriteria_provided&_single_submitter3criteria_provided&_multiple_submittersTier_I_-_StrongEGFRL858Rchr7:55191822-55191822v7.0.LEVEL_Fda2✓ Hotspot07/07/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAfatinib,Amivantamab+Chemotherapy,Amivantamab+Lazertinib,Dacomitinib,Datopotamab Deruxtecan,Erlotinib,Gefitinib,Osimertinib,Osimertinib+Chemotherapy,Erlotinib+RamucirumabPatritumab DeruxtecanLEVEL_1LEVEL_165,400/1L858R0.38095238095238093GRCh38EGFRTGMissense_MutationSNPT55191822EGFR_L858R.GT:AD:AF:DP0/1:65,40:0.38:105GENSG00000146648TranscriptENST00000275493protein_coding28342573858L/RcTg/cGg1HGNCHGNC:3236YESMANE_SelectNM_005228.51P1CCDS5514.1ENSP00000275493P00533.293UPI000003E750P00533-1EnsemblTT1PDB-ENSP_mappings:1m14.A&PDB-ENSP_mappings:1m17.A&PDB-ENSP_mappings:1xkk.A&PDB-ENSP_mappings:2eb2.A&PDB-ENSP_mappings:2eb3.A&PDB-ENSP_mappings:2gs2.A&PDB-ENSP_mappings:2gs6.A&PDB-ENSP_mappings:2gs7.A&PDB-ENSP_mappings:2gs7.B&PDB-ENSP_mappings:2itn.A&PDB-ENSP_mappings:2ito.A&PDB-ENSP_mappings:2itp.A&PDB-ENSP_mappings:2itq.A&PDB-ENSP_mappings:2itt.A&PDB-ENSP_mappings:2itu.A&PDB-ENSP_mappings:2itv.A&PDB-ENSP_mappings:2itw.A&PDB-ENSP_mappings:2itx.A&PDB-ENSP_mappings:2ity.A&PDB-ENSP_mappings:2itz.A&PDB-ENSP_mappings:2j5e.A&PDB-ENSP_mappings:2j5f.A&PDB-ENSP_mappings:2j6m.A&PDB-ENSP_mappings:2jit.A&PDB-ENSP_mappings:2jit.B&PDB-ENSP_mappings:2jiu.A&PDB-ENSP_mappings:2jiu.B&PDB-ENSP_mappings:2jiv.A&PDB-ENSP_mappings:2jiv.B&PDB-ENSP_mappings:2rf9.A&PDB-ENSP_mappings:2rf9.B&PDB-ENSP_mappings:2rfd.A&PDB-ENSP_mappings:2rfd.B&PDB-ENSP_mappings:2rfe.A&PDB-ENSP_mappings:2rfe.B&PDB-ENSP_mappings:2rfe.C&PDB-ENSP_mappings:2rfe.D&PDB-ENSP_mappings:2rgp.A&PDB-ENSP_mappings:3bel.A&PDB-ENSP_mappings:3gop.A&PDB-ENSP_mappings:3gt8.A&PDB-ENSP_mappings:3gt8.B&PDB-ENSP_mappings:3gt8.C&PDB-ENSP_mappings:3gt8.D&PDB-ENSP_mappings:3ika.A&PDB-ENSP_mappings:3ika.B&PDB-ENSP_mappings:3lzb.A&PDB-ENSP_mappings:3lzb.B&PDB-ENSP_mappings:3lzb.C&PDB-ENSP_mappings:3lzb.D&PDB-ENSP_mappings:3lzb.E&PDB-ENSP_mappings:3lzb.F&PDB-ENSP_mappings:3lzb.G&PDB-ENSP_mappings:3lzb.H&PDB-ENSP_mappings:3poz.A&PDB-ENSP_mappings:3ug1.A&PDB-ENSP_mappings:3ug2.A&PDB-ENSP_mappings:3vjn.A&PDB-ENSP_mappings:3vjo.A&PDB-ENSP_mappings:3w2o.A&PDB-ENSP_mappings:3w2p.A&PDB-ENSP_mappings:3w2q.A&PDB-ENSP_mappings:3w2r.A&PDB-ENSP_mappings:3w2s.A&PDB-ENSP_mappings:3w32.A&PDB-ENSP_mappings:3w33.A&PDB-ENSP_mappings:4g5j.A&PDB-ENSP_mappings:4g5p.A&PDB-ENSP_mappings:4g5p.B&PDB-ENSP_mappings:4hjo.A&PDB-ENSP_mappings:4i1z.A&PDB-ENSP_mappings:4i20.A&PDB-ENSP_mappings:4i21.A&PDB-ENSP_mappings:4i21.B&PDB-ENSP_mappings:4i22.A&PDB-ENSP_mappings:4i23.A&PDB-ENSP_mappings:4i24.A&PDB-ENSP_mappings:4i24.B&PDB-ENSP_mappings:4jq7.A&PDB-ENSP_mappings:4jq8.A&PDB-ENSP_mappings:4jr3.A&PDB-ENSP_mappings:4jrv.A&PDB-ENSP_mappings:4li5.A&PDB-ENSP_mappings:4ll0.A&PDB-ENSP_mappings:4ll0.B&PDB-ENSP_mappings:4lqm.A&PDB-ENSP_mappings:4lrm.A&PDB-ENSP_mappings:4lrm.B&PDB-ENSP_mappings:4lrm.C&PDB-ENSP_mappings:4lrm.D&PDB-ENSP_mappings:4lrm.E&PDB-ENSP_mappings:4r3p.A&PDB-ENSP_mappings:4r3r.A&PDB-ENSP_mappings:4r5s.A&PDB-ENSP_mappings:4riw.B&PDB-ENSP_mappings:4riw.D&PDB-ENSP_mappings:4rix.B&PDB-ENSP_mappings:4rix.D&PDB-ENSP_mappings:4riy.B&PDB-ENSP_mappings:4riy.D&PDB-ENSP_mappings:4rj4.A&PDB-ENSP_mappings:4rj5.A&PDB-ENSP_mappings:4rj6.A&PDB-ENSP_mappings:4rj7.A&PDB-ENSP_mappings:4rj8.A&PDB-ENSP_mappings:4tks.A&PDB-ENSP_mappings:4wd5.A&PDB-ENSP_mappings:4wd5.B&PDB-ENSP_mappings:4wkq.A&PDB-ENSP_mappings:4wrg.A&PDB-ENSP_mappings:4zau.A&PDB-ENSP_mappings:4zjv.A&PDB-ENSP_mappings:4zjv.B&PDB-ENSP_mappings:4zse.A&PDB-ENSP_mappings:4zse.B&PDB-ENSP_mappings:4zse.C&PDB-ENSP_mappings:4zse.D&PDB-ENSP_mappings:5c8k.A&PDB-ENSP_mappings:5c8m.A&PDB-ENSP_mappings:5c8n.A&PDB-ENSP_mappings:5cal.A&PDB-ENSP_mappings:5can.A&PDB-ENSP_mappings:5cao.A&PDB-ENSP_mappings:5cap.A&PDB-ENSP_mappings:5caq.A&PDB-ENSP_mappings:5cas.A&PDB-ENSP_mappings:5cau.A&PDB-ENSP_mappings:5cav.A&PDB-ENSP_mappings:5cnn.A&PDB-ENSP_mappings:5cnn.B&PDB-ENSP_mappings:5cno.A&PDB-ENSP_mappings:5cno.B&PDB-ENSP_mappings:5cno.X&PDB-ENSP_mappings:5czh.A&PDB-ENSP_mappings:5czi.A&PDB-ENSP_mappings:5d41.A&PDB-ENSP_mappings:5d41.B&PDB-ENSP_mappings:5edp.A&PDB-ENSP_mappings:5edq.A&PDB-ENSP_mappings:5edr.A&PDB-ENSP_mappings:5em5.A&PDB-ENSP_mappings:5em6.A&PDB-ENSP_mappings:5em7.A&PDB-ENSP_mappings:5em8.A&PDB-ENSP_mappings:5fed.A&PDB-ENSP_mappings:5fee.A&PDB-ENSP_mappings:5feq.A&PDB-ENSP_mappings:5gmp.A&PDB-ENSP_mappings:5gnk.A&PDB-ENSP_mappings:5gty.A&PDB-ENSP_mappings:5gty.B&PDB-ENSP_mappings:5gty.C&PDB-ENSP_mappings:5gty.D&PDB-ENSP_mappings:5gty.E&PDB-ENSP_mappings:5gty.F&PDB-ENSP_mappings:5gty.G&PDB-ENSP_mappings:5gty.H&PDB-ENSP_mappings:5gtz.A&PDB-ENSP_mappings:5hcx.A&PDB-ENSP_mappings:5hcy.A&PDB-ENSP_mappings:5hcz.A&PDB-ENSP_mappings:5hg5.A&PDB-ENSP_mappings:5hg7.A&PDB-ENSP_mappings:5hg8.A&PDB-ENSP_mappings:5hg9.A&PDB-ENSP_mappings:5hib.A&PDB-ENSP_mappings:5hic.A&PDB-ENSP_mappings:5j9y.A&PDB-ENSP_mappings:5j9z.A&PDB-ENSP_mappings:5jeb.A&PDB-ENSP_mappings:5u8l.A&PDB-ENSP_mappings:5ug8.A&PDB-ENSP_mappings:5ug9.A&PDB-ENSP_mappings:5uga.A&PDB-ENSP_mappings:5ugb.A&PDB-ENSP_mappings:5ugc.A&PDB-ENSP_mappings:5uwd.A&PDB-ENSP_mappings:5x26.A&PDB-ENSP_mappings:5x27.A&PDB-ENSP_mappings:5x28.A&PDB-ENSP_mappings:5x2a.A&PDB-ENSP_mappings:5x2a.B&PDB-ENSP_mappings:5x2a.C&PDB-ENSP_mappings:5x2a.D&PDB-ENSP_mappings:5x2c.A&PDB-ENSP_mappings:5x2c.B&PDB-ENSP_mappings:5x2f.A&PDB-ENSP_mappings:5x2f.B&PDB-ENSP_mappings:5x2f.C&PDB-ENSP_mappings:5x2f.D&PDB-ENSP_mappings:5x2k.A&PDB-ENSP_mappings:5xdk.A&PDB-ENSP_mappings:5xdl.A&PDB-ENSP_mappings:5xgm.A&PDB-ENSP_mappings:5xgn.A&PDB-ENSP_mappings:5xgn.B&PDB-ENSP_mappings:5y25.A&PDB-ENSP_mappings:5y9t.A&PDB-ENSP_mappings:5yu9.A&PDB-ENSP_mappings:5yu9.B&PDB-ENSP_mappings:5yu9.C&PDB-ENSP_mappings:5yu9.D&PDB-ENSP_mappings:5zto.A&PDB-ENSP_mappings:5zwj.A&PDB-ENSP_mappings:6d8e.A&PDB-ENSP_mappings:6duk.A&PDB-ENSP_mappings:6duk.B&PDB-ENSP_mappings:6duk.C&PDB-ENSP_mappings:6duk.D&PDB-ENSP_mappings:6duk.E&PDB-ENSP_mappings:6duk.F&PDB-ENSP_mappings:6jrj.A&PDB-ENSP_mappings:6jrk.A&PDB-ENSP_mappings:6jrx.A&PDB-ENSP_mappings:6jwl.A&PDB-ENSP_mappings:6jx0.A&PDB-ENSP_mappings:6jx4.A&PDB-ENSP_mappings:6jxt.A&PDB-ENSP_mappings:6jz0.A&PDB-ENSP_mappings:6lub.A&PDB-ENSP_mappings:6lud.A&PDB-ENSP_mappings:6p1d.A&PDB-ENSP_mappings:6p1d.B&PDB-ENSP_mappings:6p1d.C&PDB-ENSP_mappings:6p1d.D&PDB-ENSP_mappings:6p1l.A&PDB-ENSP_mappings:6p1l.B&PDB-ENSP_mappings:6p1l.C&PDB-ENSP_mappings:6p1l.D&PDB-ENSP_mappings:6p8q.A&PDB-ENSP_mappings:6p8q.B&PDB-ENSP_mappings:6p8q.C&PDB-ENSP_mappings:6p8q.D&PDB-ENSP_mappings:6s89.A&PDB-ENSP_mappings:6s8a.A&PDB-ENSP_mappings:6s9b.A&PDB-ENSP_mappings:6s9c.A&PDB-ENSP_mappings:6s9d.A&PDB-ENSP_mappings:6tfu.A&PDB-ENSP_mappings:6tfu.B&PDB-ENSP_mappings:6tfv.A&PDB-ENSP_mappings:6tfv.B&PDB-ENSP_mappings:6tfw.A&PDB-ENSP_mappings:6tfw.B&PDB-ENSP_mappings:6tfy.A&PDB-ENSP_mappings:6tfy.B&PDB-ENSP_mappings:6tfz.A&PDB-ENSP_mappings:6tfz.B&PDB-ENSP_mappings:6tg0.A&PDB-ENSP_mappings:6tg0.B&PDB-ENSP_mappings:6tg1.A&PDB-ENSP_mappings:6tg1.B&PDB-ENSP_mappings:6v5n.A&PDB-ENSP_mappings:6v5n.B&PDB-ENSP_mappings:6v5n.C&PDB-ENSP_mappings:6v5n.D&PDB-ENSP_mappings:6v5p.A&PDB-ENSP_mappings:6v5p.B&PDB-ENSP_mappings:6v5p.C&PDB-ENSP_mappings:6v5p.D&PDB-ENSP_mappings:6v66.A&PDB-ENSP_mappings:6v66.B&PDB-ENSP_mappings:6v66.C&PDB-ENSP_mappings:6v66.D&PDB-ENSP_mappings:6v6k.A&PDB-ENSP_mappings:6v6k.B&PDB-ENSP_mappings:6v6k.C&PDB-ENSP_mappings:6v6k.D&PDB-ENSP_mappings:6v6k.E&PDB-ENSP_mappings:6v6k.F&PDB-ENSP_mappings:6v6k.G&PDB-ENSP_mappings:6v6k.H&PDB-ENSP_mappings:6v6o.A&PDB-ENSP_mappings:6v6o.B&PDB-ENSP_mappings:6v6o.C&PDB-ENSP_mappings:6v6o.D&PDB-ENSP_mappings:6v6o.E&PDB-ENSP_mappings:6v6o.F&PDB-ENSP_mappings:6v6o.G&PDB-ENSP_mappings:6v6o.H&PDB-ENSP_mappings:6vh4.A&PDB-ENSP_mappings:6vhn.A&PDB-ENSP_mappings:6vhp.A&PDB-ENSP_mappings:6wa2.A&PDB-ENSP_mappings:6wa2.B&PDB-ENSP_mappings:6wa2.C&PDB-ENSP_mappings:6wa2.D&PDB-ENSP_mappings:6wak.A&PDB-ENSP_mappings:6wak.B&PDB-ENSP_mappings:6wak.C&PDB-ENSP_mappings:6wak.D&PDB-ENSP_mappings:6wxn.A&PDB-ENSP_mappings:6wxn.B&PDB-ENSP_mappings:6wxn.C&PDB-ENSP_mappings:6wxn.D&PDB-ENSP_mappings:6xl4.A&PDB-ENSP_mappings:6xl4.B&PDB-ENSP_mappings:6xl4.C&PDB-ENSP_mappings:6xl4.D&PDB-ENSP_mappings:6z4b.A&PDB-ENSP_mappings:6z4b.B&PDB-ENSP_mappings:6z4d.A&PDB-ENSP_mappings:6z4d.B&PDB-ENSP_mappings:7a2a.A&PDB-ENSP_mappings:7a2a.B&PDB-ENSP_mappings:7a6i.A&PDB-ENSP_mappings:7a6j.A&PDB-ENSP_mappings:7a6j.B&PDB-ENSP_mappings:7a6k.A&PDB-ENSP_mappings:7a6k.B&PDB-ENSP_mappings:7a6k.C&PDB-ENSP_mappings:7a6k.D&PDB-ENSP_mappings:7aei.A&PDB-ENSP_mappings:7aem.A&PDB-ENSP_mappings:7b85.A&PDB-ENSP_mappings:7er2.A&PDB-ENSP_mappings:7jxi.A&PDB-ENSP_mappings:7jxi.B&PDB-ENSP_mappings:7jxi.C&PDB-ENSP_mappings:7jxi.D&PDB-ENSP_mappings:7jxk.A&PDB-ENSP_mappings:7jxk.B&PDB-ENSP_mappings:7jxk.C&PDB-ENSP_mappings:7jxk.D&PDB-ENSP_mappings:7jxk.E&PDB-ENSP_mappings:7jxk.F&PDB-ENSP_mappings:7jxl.A&PDB-ENSP_mappings:7jxl.B&PDB-ENSP_mappings:7jxl.C&PDB-ENSP_mappings:7jxl.D&PDB-ENSP_mappings:7jxm.A&PDB-ENSP_mappings:7jxm.B&PDB-ENSP_mappings:7jxm.C&PDB-ENSP_mappings:7jxm.D&PDB-ENSP_mappings:7jxp.A&PDB-ENSP_mappings:7jxp.B&PDB-ENSP_mappings:7jxp.C&PDB-ENSP_mappings:7jxp.D&PDB-ENSP_mappings:7jxp.E&PDB-ENSP_mappings:7jxp.F&PDB-ENSP_mappings:7jxq.A&PDB-ENSP_mappings:7jxq.B&PDB-ENSP_mappings:7jxq.C&PDB-ENSP_mappings:7jxq.D&PDB-ENSP_mappings:7jxw.A&PDB-ENSP_mappings:7jxw.B&PDB-ENSP_mappings:7jxw.C&PDB-ENSP_mappings:7jxw.D&PDB-ENSP_mappings:7k1h.A&PDB-ENSP_mappings:7k1h.B&PDB-ENSP_mappings:7k1h.C&PDB-ENSP_mappings:7k1h.D&PDB-ENSP_mappings:7k1h.E&PDB-ENSP_mappings:7k1h.F&PDB-ENSP_mappings:7k1i.A&PDB-ENSP_mappings:7kxz.A&PDB-ENSP_mappings:7ky0.A&PDB-ENSP_mappings:7ky0.B&PDB-ENSP_mappings:7ky0.C&PDB-ENSP_mappings:7ky0.D&PDB-ENSP_mappings:7lg8.A&PDB-ENSP_mappings:7lg8.B&PDB-ENSP_mappings:7lg8.C&PDB-ENSP_mappings:7lg8.D&PDB-ENSP_mappings:7lgs.A&PDB-ENSP_mappings:7lgs.B&PDB-ENSP_mappings:7lgs.C&PDB-ENSP_mappings:7lgs.D&PDB-ENSP_mappings:7ltx.A&PDB-ENSP_mappings:7ltx.B&PDB-ENSP_mappings:7ltx.C&PDB-ENSP_mappings:7ltx.D&PDB-ENSP_mappings:7oxb.A&PDB-ENSP_mappings:7si1.A&PDB-ENSP_mappings:7syd.A&PDB-ENSP_mappings:7syd.B&PDB-ENSP_mappings:7sye.A&PDB-ENSP_mappings:7sye.B&PDB-ENSP_mappings:7sz0.A&PDB-ENSP_mappings:7sz0.B&PDB-ENSP_mappings:7sz1.A&PDB-ENSP_mappings:7sz1.B&PDB-ENSP_mappings:7sz5.A&PDB-ENSP_mappings:7sz5.B&PDB-ENSP_mappings:7sz7.A&PDB-ENSP_mappings:7sz7.B&PDB-ENSP_mappings:7t4i.A&PDB-ENSP_mappings:7t4j.A&PDB-ENSP_mappings:7t4j.B&PDB-ENSP_mappings:7tvd.A&PDB-ENSP_mappings:7u98.A&PDB-ENSP_mappings:7u98.B&PDB-ENSP_mappings:7u98.C&PDB-ENSP_mappings:7u98.D&PDB-ENSP_mappings:7u99.A&PDB-ENSP_mappings:7u9a.A&PDB-ENSP_mappings:7ukv.A&PDB-ENSP_mappings:7ukw.A&PDB-ENSP_mappings:7ukw.B&PDB-ENSP_mappings:7ukw.C&PDB-ENSP_mappings:7ukw.D&PDB-ENSP_mappings:7vra.A&PDB-ENSP_mappings:7vre.A&PDB-ENSP_mappings:7zym.A&PDB-ENSP_mappings:7zyn.A&PDB-ENSP_mappings:7zyp.A&PDB-ENSP_mappings:7zyq.A&PDB-ENSP_mappings:7zyq.B&PDB-ENSP_mappings:8a27.A&PDB-ENSP_mappings:8a2a.A&PDB-ENSP_mappings:8a2b.A&PDB-ENSP_mappings:8a2d.A&PDB-ENSP_mappings:8d73.A&PDB-ENSP_mappings:8d73.B&PDB-ENSP_mappings:8d76.A&PDB-ENSP_mappings:8d76.B&PDB-ENSP_mappings:8dsw.A&PDB-ENSP_mappings:8eme.A&PDB-ENSP_mappings:8eme.B&PDB-ENSP_mappings:8f1h.A&PDB-ENSP_mappings:8f1w.A&PDB-ENSP_mappings:8f1w.B&PDB-ENSP_mappings:8f1w.C&PDB-ENSP_mappings:8f1w.D&PDB-ENSP_mappings:8f1x.A&PDB-ENSP_mappings:8f1y.A&PDB-ENSP_mappings:8f1z.A&PDB-ENSP_mappings:8fv3.A&PDB-ENSP_mappings:8fv3.B&PDB-ENSP_mappings:8fv3.C&PDB-ENSP_mappings:8fv3.D&PDB-ENSP_mappings:8fv4.A&PDB-ENSP_mappings:8fv4.B&PDB-ENSP_mappings:8fv4.C&PDB-ENSP_mappings:8fv4.D&PDB-ENSP_mappings:8g63.A&PDB-ENSP_mappings:8gb4.A&PDB-ENSP_mappings:8gb4.B&PDB-ENSP_mappings:8gb4.C&PDB-ENSP_mappings:8gb4.D&PDB-ENSP_mappings:8gk5.A&PDB-ENSP_mappings:8gk5.B&PDB-ENSP_mappings:8gk5.C&PDB-ENSP_mappings:8gk5.D&PDB-ENSP_mappings:8h7x.A&PDB-ENSP_mappings:8h7x.B&PDB-ENSP_mappings:8hv1.A&PDB-ENSP_mappings:8hv2.A&PDB-ENSP_mappings:8hv3.A&PDB-ENSP_mappings:8hv4.A&PDB-ENSP_mappings:8hv5.A&PDB-ENSP_mappings:8hv6.A&PDB-ENSP_mappings:8hv7.A&PDB-ENSP_mappings:8hv8.A&PDB-ENSP_mappings:8hv9.A&PDB-ENSP_mappings:8hva.A&PDB-ENSP_mappings:8hy7.A&PDB-ENSP_mappings:8kfq.A&PDB-ENSP_mappings:8pnz.A&PDB-ENSP_mappings:8po0.A&PDB-ENSP_mappings:8po1.A&PDB-ENSP_mappings:8po2.A&PDB-ENSP_mappings:8po2.B&PDB-ENSP_mappings:8po2.D&PDB-ENSP_mappings:8po3.A&PDB-ENSP_mappings:8po4.A&PDB-ENSP_mappings:8po4.B&PDB-ENSP_mappings:8sc7.A&PDB-ENSP_mappings:8tjl.A&PDB-ENSP_mappings:8to3.A&PDB-ENSP_mappings:8to3.B&PDB-ENSP_mappings:8to3.C&PDB-ENSP_mappings:8to3.D&PDB-ENSP_mappings:8to4.A&PDB-ENSP_mappings:8to4.B&PDB-ENSP_mappings:8to4.C&PDB-ENSP_mappings:8to4.D&PDB-ENSP_mappings:8wd4.A&SMART:SM00219&Superfamily:SSF56112&CDD:cd05108&PANTHER:PTHR24416&PROSITE_profiles:PS50011&Phobius:CYTOPLASMIC_DOMAIN&Pfam:PF07714&Gene3D:1.10.510.10&PIRSF:PIRSF000619&AFDB-ENSP_mappings:AF-P00533-F1drug_response&pathogenic0&1&11&1&124944790&31019283&22992668&27618021&32295184&25157968&26619011&29525983&15118073&15118125&15329413&16115929&16204070&17192902&17285735&19922469&20479403&22753918&23102728&15897572&15901872&16043828&16203769&16204011&16865253&16956694&17047654&17106442&17317677&17387341&17429313&17473659&18303429&18349398&19096302&19455431&19692680&19692684&20022809&20038723&20573926&21670455&21783417&21900837&21969500&22215752&22370314&22452895&22740981&22760226&22982650&23816960&23948351&26490356&32175330&28347348&26053404&36388934&32962681&30149365&29721857&36629526&38008767FAIL-9-25-4114EGFR1660931648MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MONDO:MONDO:0005138&MedGen:C0684249&MedGen:C4016032&MedGen:C1851577&Human_Phenotype_Ontology:HP:0030078&MONDO:MONDO:0005061&MeSH:D000077192&MedGen:C0152013&MedGen:CN225347&MedGen:CN322733SCV000268169single_nucleotide_variantSO:0001483ClinGen:CA126713&ClinPGx_Clinical_Annotation:981420042&ClinPGx_Clinical_Annotation:981475838&ClinPGx_Clinical_Annotation:981475880&OMIM:131550.0002&UniProtKB:P00533#VAR_019298EGFR:1956SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005871752121434568Non-small_cell_lung_carcinomaHuman_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131SCV004565358&SCV004565359&SCV0058709097:55191822-551918221EGFRp.L858R.True.The EGFR exon 21 L858R mutation occurs in the EGFR tyrosine kinase domain. Cell line experiments demonstrate that this mutation is activating, transforming, and sensitizing to EGFR tyrosine kinase inhibitors (TKI) (PMID: 15118073, 15118125). Preclinical models with the L858R mutation show high sensitivity to first-, second- and third-generation inhibitors, and to Ex20ins-active inhibitors (PMID: 34526717). Patients with lung cancers harboring the L858R mutation responded to EGFR TKIs with overall survival ranging from 3.5-17+ months after starting treatment (PMID: 15329413)..EGFR, a receptor tyrosine kinase, is altered by amplification and/or mutation in lung and brain cancers among others...15329413|15118073|15118125|34526717..L858R1956EGFRGRCh38.MUTATION..The EGFR L858R mutation is known to be oncogenic.FalseLEVEL_Fda2The EGFR exon 21 L858R mutation occurs in the EGFR tyrosine kinase domain. Cell line experiments demonstrate that this mutation is activating, transforming, and sensitizing to EGFR tyrosine kinase inhibitors (TKI) (PMID: 15118073, 15118125). Preclinical models with the L858R mutation show high sensitivity to first-, second- and third-generation inhibitors, and to Ex20ins-active inhibitors (PMID: 34526717). Patients with lung cancers harboring the L858R mutation responded to EGFR TKIs with overall survival ranging from 3.5-17+ months after starting treatment (PMID: 15329413).['15329413', '15118073', '15118125', '34526717']['L858R', 'Exon 19 in-frame deletions']AfatinibLEVEL_1LEVEL_Fda2['23816960', '22452895', '25589191']Afatinib, a second-generation, irreversible tyrosine kinase inhibitor of EGFR, HER2, and HER4, is FDA-approved as first-line therapy in patients with non-small cell lung cancer (NSCLC) whose tumors harbor EGFR exon 19 deletion or L858R, L861Q, G719, and/or S768I substitution mutations. FDA approval was based on the Phase II LUX-Lung 2 trial, which demonstrated an objective response rate of 61% in patients with EGFR-mutant lung cancer treated with afatinib (PMID: 22452895). In the Phase III LUX-Lung 3 trial, afatinib significantly improved progression-free survival (PFS) in patients with EGFR-mutant lung cancer compared to patients treated with chemotherapy comprised of cisplatin plus pemetrexed (13.6 months versus 6.9 months, HR=0.47, p=0.001) (PMID: 23816960). In a pooled analysis of the LUX-Lung 3 and 6 trials comparing overall survival in patients with EGFR mutation who were treated with afatinib versus those treated with chemotherapy, first-line treatment with afatinib significantly improved overall survival specifically in patients harboring exon 19 deletions compared to those treated with chemotherapy (31.7 versus 20.7 months, HR = 0.59, p = 0.0001) (PMID: 25589191).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']Amivantamab + ChemotherapyLEVEL_1LEVEL_Fda2['37879444']Amivantamab is an intravenously infused, EGFR-MET bispecific monoclonal antibody that is FDA-approved for the treatment of adult patients in combination with carboplatin and pemetrexed for the treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with EGFR exon 19 deletions or exon 21 L858R substitution mutations, whose disease has progressed on or after treatment with an EGFR tyrosine kinase inhibitor. FDA approval is based on the results of the Phase III MARIPOSA-2 (NCT04988295) trial of amivantamab plus chemotherapy versus chemotherapy in 394 patients with NSCLC with EGFR L858R mutations or exon 19 deletions. __In the Phase III MARIPOSA-2 (NCT04988295) trial, the amivantamab plus chemotherapy cohort (n=131 [n=89, EGFR exon 19 deletions, n=42, EGFR L858R]) demonstrated an overall response rate (ORR) of 53% (95% CI=44-62), with a 0.8% complete response (CR) rate and 52% partial response (PR) rate (PMID: 37879444). In contrast, the chemotherapy cohort (n=263 [n=183, EGFR exon 19 deletions, n=79, EGFR L858R]) demonstrated an ORR of 29% (95% CI=23-35) (p<0.0001), with a 29% PR rate (PMID: 37879444). The amivantamab plus chemotherapy cohort demonstrated a median progression-free survival (PFS) of 6.3 months (95% CI=5.6-8.4) and a median duration of response (DOR) of 6.9 months (95% CI= 5.5NE) while the chemotherapy cohort demonstrated a median PFS of 4.2 months (95% CI=4.04.4) (HR=0.48 [95% CI=0.36-0.64], p<0.0001) and a median DOR of 5.6 months (95% CI=4.29.6) (PMID: 37879444).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']Amivantamab + LazertinibLEVEL_1LEVEL_Fda2['38924756']Amivantamab, an intravenously infused, EGFR-MET bispecific monoclonal antibody, and lazertinib, a small molecule, third-generation EGFR tyrosine kinase inhibitor, are FDA-approved in combination for the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) with EGFR exon 19 deletions or exon 21 L858R substitution mutations, as detected by an FDA-approved test. FDA approval was based on the results of the Phase III MARIPOSA (NCT04487080) trial of amivantamab plus lazertinib versus osimertinib monotherapy in 1074 patients with NSCLC with an EGFR exon 19 deletion or L858R mutation. In the Phase III MARIPOSA (NCT04487080) trial, the amivantamab plus lazertinib cohort (n=429) demonstrated an overall response rate (ORR) of 86% (95% CI=83-89), a median progression-free survival (PFS) of 23.7 months (95% CI=19.1-27.7), a median duration of response (DOR) of 25.8 months (95% CI=20.1-NE) and a 24-month overall survival (OS) rate of 74% (95% CI=69-78) while the osimertinib cohort (n=429) demonstrated an ORR of 85% (95% CI=81-88), a median PFS of 16.6 months (95% CI=14.818.5) (HR=0.70 [95% CI=0.58-0.85], p<0.001), a median DOR of 16.8 months (95% CI=14.8-18.5) and a 24-month OS rate of 69% (95% CI=64-74) (PMID: 38924756).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']DacomitinibLEVEL_1LEVEL_Fda2['29864379', '28958502']Dacomitinib is a small molecule inhibitor of EGFR that is FDA-approved for the first-line treatment of patients with metastatic non-small cell lung cancer (NSCLC) with epidermal growth factor receptor (EGFR) exon 19 deletion or exon 21 L858R substitution mutations as detected by an FDA-approved test. FDA approval was based on the Phase III ARCHER 1050 trial of dacomitinib versus gefitinib in 452 patients with advanced, EGFR-positive NSCLC in which the median progression-free survival (PFS) was 14.7 months for patients randomized to dacomitinib and 9.2 months for patients randomized to gefitinib (HR=0.59, 95% CI=0.47-0.74, p=0001) (PMID: 28958502). Overall survival was 34.1 months in the dacomitinib arm versus 26.8 months in the gefitinib arm (HR=0.760, 95% CI=0.582-0.993, P = .044) (PMID: 29864379).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Oncogenic Mutations']Datopotamab DeruxtecanLEVEL_1LEVEL_Fda2['39761483', '39250535']Datopotamab deruxtecan (Dato-DXd) is an intravenously infused, TROP2-directed antibody drug conjugate that is FDA-approved for the treatment of patients with EGFR-mutated non-small cell lung cancer (NSCLC) who have received prior EGFR-directed therapy and platinum-based chemotherapy. FDA approval is based on the results of the Phase II TROPION-Lung05 (NCT04484142) and Phase III TROPION-Lung01 (NCT04656652) trials of Dato-DXd in patients with previously treated EGFR-mutated NSCLC._In the Phase II TROPION-Lung05 (NCT04484142) trial of Dato-DXd in patients with NSCLC harboring actionable alterations progressing on or after targeted therapy and platinum-based chemotherapy, patients with EGFR-mutated NSCLC (n=78 [exon 19 deletion: 41 (29.9%), exon 20 T790M: 26 (19.0%), exon 21 L858R: 25 (18.2%), exon 18 G719: 5 (3.6%), exon 21 L861Q: 3 (2.2%), exon 20 insertion: 2 (1.5%)]) demonstrated an overall response rate (ORR) of 43.6% (95% CI=32.4-55.3), with a 5.1% (n=4) complete response (CR) rate, 38.5% (n=30) partial response (PR) rate and 34.6% (n=27) stable disease (SD) rate, a disease control rate (DCR) of 82.1% (95% CI=71.7-89.8), a median duration of response (DOR) of 7.0 months (95% CI=4.2-10.2) and a median progression-free survival (PFS) of 5.8 months (95% CI=5.4-8.3) (PMID: 39761483)._In the Phase III TROPION-Lung01 (NCT04656652) trial of Dato-DXd versus docetaxel in patients with pretreated NSCLC, patients treated with Dato-DXd (n=299 [EGFR mutations: 39 (13.0%)]) demonstrated an ORR of 26.4% (95% CI= 21.5-31.8), with a 1.3% (n=4) CR rate, 25.1% (n=75) PR rate and 49.8% (n=149) SD rate, a DCR of 77.3% (95% CI=72.1-81.9), a median DOR of 7.1 months (95% CI=5.6-10.9), a median PFS of 4.4 months (95% CI=4.2-5.6) and a median overall survival (OS) of 12.9 months (95% CI=11.0-13.9) (PMID: 39250535). Patients treated with docetaxel (n=305 [EGFR mutations: 45 (14.8%)]) demonstrated an ORR of 12.8% (95% CI=9.3-17.1), with a 12.8% (n=39) PR rate and 50.2% (n=153) SD rate, a DCR of 64.9% (95% CI=59.3-70.3), a median DOR of 5.6 months (95% CI=5.4-8.1), a median PFS of 3.7 months (95% CI=2.9-4.2) (HR=0.75 [95% CI=0.62-0.91], p=.004) and a median OS of 11.8 months (95% CI=10.1-12.8) (HR=0.94 [95% CI=0.78-1.14], p=0.530) (PMID: 39250535).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']ErlotinibLEVEL_1LEVEL_Fda2['22285168', '27987585']Erlotinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is approved with or without ramucirumab for the treatment of non-small cell lung cancer (NSCLC) with EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. Results of the Phase III EURTAC trial demonstrated that patients with NSCLC receiving erlotinib showed significant improvement in progression-free survival (PFS) (9.7 vs. 5.2 months, HR=0.37, p=0.0001) compared to those receiving platinum-based doublet chemotherapy (PMID: 22285168). The partial response rate with erlotinib was 56%, compared to 13% with chemotherapy, and was associated with a reduced toxicity profile (PMID: 22285168). The safety and efficacy of erlotinib have not been established in patients harboring EGFR mutations other than exon 19 deletion and exon 21 (L858R) substitution, however, the phase III IUNO trial demonstrated no difference in PFS between patients with NSCLC lacking EGFR exon 19 deletion or EGFR L858R mutation who were given erlotinib versus placebo as maintenance therapy (PMID: 27987585).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']GefitinibLEVEL_1LEVEL_Fda2['20022809', '19692680', '21670455', '22370314', '31682542', '20573926']Gefitinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is FDA-approved as first-line therapy in patients with non-small cell lung cancer (NSCLC) whose tumors harbor EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. FDA approval is based on multiple clinical trials that demonstrated the efficacy of gefitinib in EGFR-mutant NSCLC and includes IPASS (PMID: 19692680, 21670455), NEJ002 (PMID: 20573926), WJTOG3405 (PMID: 20022809) and First-SIGNAL (PMID: 22370314). Response rates in EGFR-mutant lung cancers in these studies ranged from 55% to 85%, with median progression-free survival (PFS) of 8 to 10.8 months (PMID: 19692680, 21670455, 20573926, 20022809, 22370314). In one study comparing gefitinib with standard chemotherapy in pulmonary adenocarcinoma, the response rate with gefitinib in patients with EGFR mutations (47%) was nearly double that of patients who were EGFR wildtype (24%) (PMID: 19692680). Additionally, in the biomarker analysis and final overall survival (OS) analysis of the Phase III IPASS study, though OS was not different between the gefitinib and carboplatin/paclitaxel groups, 64.3% of patients assigned to chemotherapy had crossed over to treatment with EGFR TKIs, PFS in this study was significantly longer with gefitinib than chemotherapy in patients with EGFR mutation (HR=0.48) (PMID: 21670455). In a Phase II trial, the addition of carboplatin plus pemetrexed to gefitinib increased progression-free survival (20.9 months vs 11.9 months, HR = 0.490, P < .001) in patients with EGFR-mutant NSCLC compared to gefitinib alone (PMID: 31682542).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']OsimertinibLEVEL_1LEVEL_Fda2['38828946', '32955177', '29151359', '31751012']Osimertinib is an orally available, small molecule third-generation EGFR T790M tyrosine kinase inhibitor (TKI) that is FDA-approved for adjuvant therapy after tumor resection in adult patients with non-small cell lung cancer (NSCLC) whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, the treatment of adult patients with locally advanced, unresectable (stage III) NSCLC whose disease has not progressed during or following concurrent or sequential platinum-based chemoradiation therapy and whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations and the first-line treatment of adult patients with metastatic NSCLC whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, as detected by an FDA-approved test. EGFR exon 19 deletions and exon 21 L858R mutations for treatment with osimertinib were detected by the cobas EGFR Mutation Test v2, FoundationOne CDx, FoundationOne Liquid CDx or Guardant360 CDx. FDA approvals were based on the results of the Phase III ADAURA (NCT02511106) trial for adjuvant treatment, the Phase III LAURA (NCT03521154) trial for locally advanced, unresectable NSCLC treatment and the Phase III FLAURA (NCT02296125) trial for first-line monotherapy treatment. __In the Phase III ADAURA (NCT02511106) trial of osimertinib versus placebo in 682 patients with completely resected EGFR mutation-positive stage IB to IIIA NSCLC, 89% (95% CI=85-92) of patients in the osimertinib cohort (n=339 [55%, EGFR exon 19 deletion, 45%, EGFR L858R, 1%, EGFR T790M]) and 52% (95% CI=46-58) of patients in the placebo cohort (n=343 [55%, EGFR exon 19 deletion, 45%, EGFR L858R, 1%, EGFR T790M]) were alive and disease-free at 24 months (HR=0.20 [99.12% CI=0.14-0.30], p<0.001) (PMID: 32955177). __In the Phase III LAURA (NCT03521154) trial of osimertinib versus placebo in 216 patients with unresectable EGFR mutation-positive stage III NSCLC without progression during or after chemoradiotherapy, the osimertinib cohort (n=143 [n=74, EGFR exon 19 deletion, n=68, EGFR L858R]) demonstrated an objective response rate (ORR) of 57% (95% CI=49-66), with a 2% (n=3) complete response (CR) rate, 55% (n=79) partial response (PR) rate and 31% (n=45) stable disease (SD) rate, a median progression-free survival (PFS) of 39.1 months (95% CI=31.5-NC) and a median duration of response (DOR) of 36.9 months (95% CI=30.1-NC). In contrast, the placebo cohort (n=73 [n=43, EGFR exon 19 deletion, n=30, EGFR L858R]) demonstrated an ORR of 33% (95% CI=22-45) (OR=2.77 [95% CI=1.54-5.08]), with a 1% (n=1) CR rate, 32% (n=23) PR rate and 47% (n=34) SD rate, a median PFS of 5.6 months (95% CI=3.7-7.4) (HR=0.16 [95% CI=0.10-0.24], p<0.001) and a median DOR of 6.5 months (95% CI=3.6-8.3) (PMID: 38828946). __In the Phase III FLAURA (NCT02296125) trial of osimertinib versus standard EGFR TKI (gefitinib or erlotinib) in 556 patients with previously untreated, EGFR mutation-positive advanced NSCLC, the osimertinib cohort (n=279 [n=175, EGFR exon 19 deletion, n=104, EGFR L858R]) demonstrated an ORR of 80% (95% CI=75-85), with a 3% (n=7) CR rate, 77% (n=216) PR rate and 17% (n=47) SD rate, a median PFS of 18.9 months (95% CI=15.2-21.4), a median DOR of 17.2 months (95% CI=13.8-22.0) and a median overall survival (OS) could not be calculated (95% CI=NC-NC). In contrast, the standard EGFR TKI cohort (n=277 [n=174, EGFR exon 19 deletion, n=103, EGFR L858R]) demonstrated an ORR of 76% (95% CI=70-81), with a 1% (n=4) CR rate, 74% (n=206) PR rate and 17% (n=46) SD rate, a median PFS of 10.2 months (95% CI=9.6-11.1) (HR=0.46 [95% CI=0.37-0.57], p<0.001), a median DOR of 8.5 months (95% CI=7.3-9.8) and a median OS that could not be calculated (95% CI=NC-NC) (HR=0.63 [95% CI=0.45-0.88], p=0.007) (PMID: 29151359). In the final analysis of the OS in the Phase III FLAURA (NCT02296125) trial, the osimertinib cohort and standard EGFR TKI cohort demonstrated a median OS of 38.6 months (95% CI=34.5-41.8) and 31.8 months (95% CI=26.6-36.0), respectively (HR=0.80 [95.05% CI=0.64-1.00], p=0.046) (PMID: 31751012).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']Osimertinib + ChemotherapyLEVEL_1LEVEL_Fda2['37937763']Osimertinib is an orally available, small molecule third-generation EGFR T790M tyrosine kinase inhibitor (TKI) that is FDA-approved in combination with pemetrexed and platinum-based chemotherapy, the first-line treatment of adult patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) whose tumors have EGFR exon 19 deletions or exon 21 L858R mutations, as detected by an FDA-approved test. EGFR exon 19 deletions and exon 21 L858R mutations for treatment with osimertinib were detected by the cobas EGFR Mutation Test v2, FoundationOne CDx, FoundationOne Liquid CDx or Guardant360 CDx. __FDA approval is based on the results of the Phase III FLAURA2 (NCT04035486) trial of osimertinib plus chemotherapy (pemetrexed plus cisplatin or carboplatin) versus single-agent osimertinib in 557 patients with previously untreated, EGFR mutation-positive advanced NSCLC. In the Phase III FLAURA2 (NCT04035486) trial, the osimertinib plus chemotherapy cohort (n=279 [n=169, EGFR exon 19 deletion, n=106, EGFR L858R, n=3, both, n=1, unknown]) demonstrated a median progression-free survival (PFS) of 25.5 months (95% CI=24.7-NC), a median duration of response (DOR) of 24.0 months (95% CI=20.9-27.8) and an objective response rate (ORR) of 83% (95% CI=78-87), with an 83% partial response (PR) rate and <1% complete response (CR) rate. The osimertinib monotherapy cohort (n=278 [n=168, EGFR exon 19 deletion, n=106, EGFR L858R, n=3, both, n=2, unknown]) demonstrated a median PFS of 16.7 months (95% CI=14.1-21.3) (HR=0.62 [95% CI=0.490.79], p<0.001), a median DOR of 15.3 months (95% CI=12.7-9.4) and an ORR of 76% (95% CI=70-80), with a 75% PR rate and 1% CR rate (PMID: 37937763).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions']Erlotinib + RamucirumabLEVEL_1LEVEL_Fda2['22285168', '27987585']Erlotinib, a first-generation EGFR tyrosine kinase inhibitor (TKI), is approved with or without ramucirumab for the treatment of non-small cell lung cancer (NSCLC) with EGFR exon 19 deletion or exon 21 (L858R) substitution mutations. Results of the Phase III EURTAC trial demonstrated that patients with NSCLC receiving erlotinib showed significant improvement in progression-free survival (PFS) (9.7 vs. 5.2 months, HR=0.37, p=0.0001) compared to those receiving platinum-based doublet chemotherapy (PMID: 22285168). The partial response rate with erlotinib was 56%, compared to 13% with chemotherapy, and was associated with a reduced toxicity profile (PMID: 22285168). The safety and efficacy of erlotinib have not been established in patients harboring EGFR mutations other than exon 19 deletion and exon 21 (L858R) substitution, however, the phase III IUNO trial demonstrated no difference in PFS between patients with NSCLC lacking EGFR exon 19 deletion or EGFR L858R mutation who were given erlotinib versus placebo as maintenance therapy (PMID: 27987585).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['L858R', 'Exon 19 in-frame deletions', 'L861Q', 'Exon 19 in-frame insertions', 'S768I', 'G719']Patritumab DeruxtecanLEVEL_3ALEVEL_Fda3['37689979', '38369013', '31661465', '34548309', '30057690', '34084213']Patritumab deruxtecan (HER3-DXd) is an antibody-drug conjugate consisting of a HER3 antibody attached to a topoisomerase I inhibitor payload via a tetrapeptide-based cleavable linker. HER3 is the preferred heterodimeric partner for EGFR (PMID: 34084213, 30057690). In a phase I dose-escalation/expansion study (NCT03260491) of HER3-DXd in 57 patients with locally advanced or metastatic EGFR-mutated non-small cell lung cancer (NSCLC) (n=33 with Exon 19 deletion), the objective response rate (ORR) was 39% (95% CI=26.052.4) and median progression-free survival (PFS) was 8.2 (95% CI=4.48.3) months (PMID: 34548309). In the phase II HERTHENA-Lung01 trial of HER3-DXd in 225 patients with previously treated EGFR-mutated NSCLC, the median PFS was 5.5 months (95% CI=5.1-5.9) and an objective response was observed in 67 patients (29.8%, 95% CI=23.9-36.2), with complete response observed in one patient (PMID: 37689979). In preclinical studies, in vitro and in vivo models containing HER3-expressing CM-3 cancer cells treated with U3-1402 (HER3-DXd) exhibited reduced cell viability and tumor volume, respectively (PMID: 31661465). In the Phase I U31402-A-U102 (NCT03260491) trial of HER3-DXd in 97 patients with EGFR-mutated NSCLC who had received prior EGFR tyrosine kinase inhibitor therapy and platinum-based chemotherapy (n=64, exon 19 deletion, n=29, L858R, n=4, G719A, n=2, L861Q, n=1, exon 19 insertion), the cohort demonstrated an ORR of 39.2% (n=38) (95% CI=29.4-49.6), with a 1% (n=1) confirmed response rate, 38.1% (n=37) partial response rate, 40.2% (n=39) stable disease rate and 12.4% (n=12) progressive disease rate, a median duration of response of 9.6 months (95% CI=6.9-15.4), a median PFS of 6.4 months (95% CI=4.9-8.3) and a median overall survival of 15.8 months (95% CI=10.8-21.5) (PMID: 38369013).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID15329413;15118073;15118125;3452671723816960;22452895;25589191;37879444;38924756;29864379;28958502;39761483;39250535;22285168;27987585;20022809;19692680;21670455;22370314;31682542;20573926;38828946;32955177;29151359;31751012;37937763;37689979;38369013;31661465;34548309;30057690;34084213105Gmissense_variantEGFR1956GeneENST00000275493.2ENST00000275493.2:c.2573T>GNP_005219.2:p.Leu858Arg33LEU858ARG/RS121434568/L813R/LEU813ARGhttps://civicdb.org/links/variants/33EGFR_L858R33NC_000007.13:g.55259515T>G/NM_005228.4:c.2573T>G/ENST00000275493.2:c.2573T>G/NP_005219.2:p.Leu858ArgCA12671316609/376282/376280
TUMORchr7116672196N<DUP>PASSNM_000245start_lost&feature_elongation&start_retained_variant&coding_sequence_variant&5_prime_UTR_variant&3_prime_UTR_variant&intron_variantHIGHMET1-21/211-20/20nanduplicationv7.0.LEVEL_Fda2False11/08/2024LEVEL_2125841DUPTrueTrueTrueGain-of-functionOncogenicCapmatinib,Crizotinib,TepotinibTelisotuzumab VedotinLEVEL_2LEVEL_R20/1GRCh38METN<DUP>Translation_Start_SiteINSN116672196MantaDUP:MET_AMP.GT:PR:SR0/1:30,22:12,9duplicationENSG00000105976TranscriptENST00000397752protein_coding2-64821HGNCHGNC:7029YESMANE_SelectNM_000245.41P3CCDS43636.1ENSP00000380860P08581.277UPI000020F975P08581-1Ensembl10,10,1116798037.False.MET amplification results from the gain of the MET gene on chromosome 7q31 and is found in various cancers, including melanoma, lung and renal cancers (PMID: 28481359). Often, this amplification leads to overexpression of the MET protein, which has been demonstrated to contribute to tumorigenesis by increasing downstream pathway activation, proliferation, invasiveness, and angiogenesis (PMID: 16461907, 18077425, 17463250, 19117057, 22869872,17667909). MET amplification has also been shown to contribute to resistance to tyrosine kinase inhibitors, including gefitinib and erlotinib and more recently osimertinib, as shown by sustained pathway activation and proliferation in the presence of drug (PMID: 18093943, 17463250, 30073261). In vitro proliferation assays of cell lines with MET amplifications show sensitivity to the MET-specific kinase inhibitor, PHA-665752 (PMID: 17463250, 16461907)..MET, a receptor tyrosine kinase, is recurrently altered by mutation or amplification in various cancer types...30073261|16461907|19117057|17667909|22869872|18077425|18093943|28481359|17463250..Amplification4233METGRCh38.CNALEVEL_R2.MET amplification is known to be oncogenic.FalseLEVEL_Fda2MET amplification results from the gain of the MET gene on chromosome 7q31 and is found in various cancers, including melanoma, lung and renal cancers (PMID: 28481359). Often, this amplification leads to overexpression of the MET protein, which has been demonstrated to contribute to tumorigenesis by increasing downstream pathway activation, proliferation, invasiveness, and angiogenesis (PMID: 16461907, 18077425, 17463250, 19117057, 22869872,17667909). MET amplification has also been shown to contribute to resistance to tyrosine kinase inhibitors, including gefitinib and erlotinib and more recently osimertinib, as shown by sustained pathway activation and proliferation in the presence of drug (PMID: 18093943, 17463250, 30073261). In vitro proliferation assays of cell lines with MET amplifications show sensitivity to the MET-specific kinase inhibitor, PHA-665752 (PMID: 17463250, 16461907).['30073261', '16461907', '19117057', '17667909', '22869872', '18077425', '18093943', '28481359', '17463250']['Amplification']CapmatinibLEVEL_2LEVEL_Fda2['32877583']Capmatinib is a small molecule inhibitor of MET that is FDA-approved for adult patients with metastatic non-small cell lung cancer (NSCLC) whose tumors have a mutation that leads to MET exon 14 skipping. The NCCN lists capmatinib as a category 2A recommendation for patients with NSCLC harboring high-level MET amplification. In a phase II trial of capmatinib in patients with MET amplified or MET exon 14 skipping non-small cell lung cancer, the overall response rate in fifteen treatment-naive patients with MET amplification was 40% (95% CI= 16 - 68), while the overall response rate in 69 previously treated patients with MET amplification was 29% (95% CI= 19 - 41) (PMID: 32877583).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Amplification']CrizotinibLEVEL_2LEVEL_Fda3['25971939', '26729443', '31416808', '21623265', '33676017'][{'abstract': 'Camidge et al. Abstract# 8001, ASCO 2014.', 'link': 'http://meetinglibrary.asco.org/content/132030-144'}]Crizotinib, an inhibitor of ALK, ROS1 and MET tyrosine kinases, is FDA-approved for the treatment of patients with metastatic non-small cell lung cancer (NSCLC) whose tumors are ROS1-positive and is a category 2A NCCN recommendation for patients with NSCLC harboring MET amplification or exon 14 skipping mutations. NCCN recommendation is based on evidence showing activity of crizotinib in patients with NSCLC with MET amplification or exon 14 skipping mutations (PMID: 21623265). In a study of twelve evaluable patients with c-MET-amplified NSCLC, four patients had partial responses (33%) with a median duration of response of 35 weeks (Abstract: Camidge et al. Abstract# 8001, ASCO 2014. http://meetinglibrary.asco.org/content/132030-144). In another study of four patients with NSCLC harboring MET exon 14 skipping mutations, three patients who were treated with crizotinib had a partial response to therapy (PMID: 25971939). A retrospective analysis also identified a patient with lung cancer harboring amplification of a mutant MET allele who had a major partial response to crizotinib (PMID: 26729443). In an open-label, multicenter phase I trial (NCT00585195) of crizotinib in 38 patients with MET-amplified NSCLC, the overall response rate was 28.9% (11/38, 95% CI= 15.445.9), with two (5.3%) patients achieving a complete response, nine patients (23.7%) achieving a partial response, eleven (28.9%) having stable disease, and eight (21.1%) having progressive disease, and the overall median PFS was 5.1 months (95% CI= 1.97.0) (PMID: 33676017). In a phase II prospective, multicenter two-arm trial (METROS, NCT02499614) evaluating the efficacy of crizotinib in 52 patients with pretreated, MET-deregulated (cohort B) NSCLC, the objective response rate was 27%, median progression-free survival was 4.4 months (95% CI= 3.05.8), and overall survival was 5.4 months (95% CI= 4.26.5)(PMID: 31416808).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Amplification']TepotinibLEVEL_2LEVEL_Fda2[{'abstract': 'Le et al. Abstract# 9021, ASCO 2021.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2021.39.15_suppl.9021'}]Tepotinib is a small molecule inhibitor of the MET tyrosine kinase that is FDA-approved for adult patients with metastatic non-small cell lung cancer (NSCLC) harboring MET exon 14 skipping alterations. The NCCN lists tepotinib as a category 2A recommendation for patients with NSCLC harboring high-level MET amplification. In the phase II VISION trial of tepotinib in patients with MET-amplified NSCLC, ten of 24 patients had a response to tepotinib for an overall response rate of 24% (95% CI= 22 - 63) (Abstract: Le et al. Abstract# 9021, ASCO 2021. https://ascopubs.org/doi/abs/10.1200/JCO.2021.39.15_suppl.9021).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Amplification']Telisotuzumab VedotinLEVEL_3ALEVEL_Fda3[{'abstract': 'Camidge et al. Abstract# 9016, ASCO 2022.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.16_suppl.9016'}]Telisotuzumab vedotin is an antibody-drug conjugate that targets the MET receptor. In the Phase II LUMINOSITY trial of telisotuzumab vedotin in 52 patients with nonsquamous, EGFR-wildtype non-small cell lung cancer (NSCLC), nineteen of 52 patients had a confirmed response, with an overall response rate of 36.5% (95% CI= 23.6, 51.0). In the MET-high group (n = 23), the overall response rate was 52.2% (95% CI= 30.6, 73.2), and in the MET-low group (n = 29), the overall response rate was 24.1 (95% CI= 10.3, 43.5) (Abstract: Camidge et al. Abstract# 9016, ASCO 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.16_suppl.9016).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Amplification']ErlotinibLEVEL_R2LEVEL_Fda3['30073261', '30676858', '18093943', '17463250'][{'abstract': 'Michels et al. JCO PO, 2018.', 'link': 'https://ascopubs.org/doi/full/10.1200/PO.18.00210'}]Erlotinib and gefitinib are first-generation small-molecule EGFR tyrosine kinase inhibitors. Multiple patients with non-small cell lung cancer harboring MET amplification in conjunction with EGFR mutation progressed on erlotinib or gefitinib (PMID: 18093943, 17463250). In two studies of patients with EGFR-mutated lung cancer that progressed on gefitinib, the presence of MET amplification was acquired in post-progression specimens in four and three samples, respectively (PMID: 17463250, 18093943). The effect of MET on drug sensitivity was confirmed in vitro in EGFR-mutated cell lines, and further analysis indicated that MET drives resistance through ERBB3-mediated activation of the PI3K pathway (PMID: 17463250, 18093943). Larger studies have demonstrated that MET amplification affects response to EGFR TKIs, including osimertinib (PMID: 30676858, 30073261)(Abstract: Michels et al. JCO PO, 2018. https://ascopubs.org/doi/full/10.1200/PO.18.00210). Notably, the presence of MET amplification in untreated lung cancer has also been observed (PMID: 18093943, 30676858).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Amplification']GefitinibLEVEL_R2LEVEL_Fda3['30073261', '30676858', '18093943', '17463250'][{'abstract': 'Michels et al. JCO PO, 2018.', 'link': 'https://ascopubs.org/doi/full/10.1200/PO.18.00210'}]Erlotinib and gefitinib are first-generation small-molecule EGFR tyrosine kinase inhibitors. Multiple patients with non-small cell lung cancer harboring MET amplification in conjunction with EGFR mutation progressed on erlotinib or gefitinib (PMID: 18093943, 17463250). In two studies of patients with EGFR-mutated lung cancer that progressed on gefitinib, the presence of MET amplification was acquired in post-progression specimens in four and three samples, respectively (PMID: 17463250, 18093943). The effect of MET on drug sensitivity was confirmed in vitro in EGFR-mutated cell lines, and further analysis indicated that MET drives resistance through ERBB3-mediated activation of the PI3K pathway (PMID: 17463250, 18093943). Larger studies have demonstrated that MET amplification affects response to EGFR TKIs, including osimertinib (PMID: 30676858, 30073261)(Abstract: Michels et al. JCO PO, 2018. https://ascopubs.org/doi/full/10.1200/PO.18.00210). Notably, the presence of MET amplification in untreated lung cancer has also been observed (PMID: 18093943, 30676858).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Amplification']OsimertinibLEVEL_R2LEVEL_Fda3['30073261', '30676858', '18093943', '17463250'][{'abstract': 'Michels et al. JCO PO, 2018.', 'link': 'https://ascopubs.org/doi/full/10.1200/PO.18.00210'}]Erlotinib and gefitinib are first-generation small-molecule EGFR tyrosine kinase inhibitors. Multiple patients with non-small cell lung cancer harboring MET amplification in conjunction with EGFR mutation progressed on erlotinib or gefitinib (PMID: 18093943, 17463250). In two studies of patients with EGFR-mutated lung cancer that progressed on gefitinib, the presence of MET amplification was acquired in post-progression specimens in four and three samples, respectively (PMID: 17463250, 18093943). The effect of MET on drug sensitivity was confirmed in vitro in EGFR-mutated cell lines, and further analysis indicated that MET drives resistance through ERBB3-mediated activation of the PI3K pathway (PMID: 17463250, 18093943). Larger studies have demonstrated that MET amplification affects response to EGFR TKIs, including osimertinib (PMID: 30676858, 30073261)(Abstract: Michels et al. JCO PO, 2018. https://ascopubs.org/doi/full/10.1200/PO.18.00210). Notably, the presence of MET amplification in untreated lung cancer has also been observed (PMID: 18093943, 30676858).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID30073261;16461907;19117057;17667909;22869872;18077425;18093943;28481359;17463250Erlotinib,Gefitinib,Osimertinib30,2212,9
TUMORp.V600EENSP00000493543.1:p.Val600Gluchr7140753336ATPASSNM_004333missense_variantMODERATEBRAF15/18c.1799T>Ars113488022&CM112509&COSV56056643&COSV56065204&COSV56080151SNVdeleterious_low_confidence(0)probably_damaging(0.935)1.369e-061.16e-05gnomADe_SAS0.000.000.000.002.4500e-01Vascular_malformation&Lymphangioma&Malignant_neoplastic_disease&Cardiovascular_phenotype&Cystic_epithelial_invagination_containing_papillae_lined_by_columnar_epithelium&Melanoma&Cardio-facio-cutaneous_syndrome&Nephroblastoma&not_provided&RASopathy&Multiple_myeloma&Papillary_thyroid_carcinoma&Cerebral_arteriovenous_malformation&Nongerminomatous_germ_cell_tumor&Non-small_cell_lung_carcinoma&Astrocytoma&_low-grade&_somatic&Carcinoma_of_colonNC_000007.14:g.140753336A>Tcriteria_provided&_conflicting_classificationsConflicting_classifications_of_pathogenicityOncogeniccriteria_provided&_single_submitter3criteria_provided&_multiple_submittersTier_I_-_StrongBRAFV600Echr7:140753336-140753336v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot02/05/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicDabrafenib,Dabrafenib+Trametinib,Encorafenib+Binimetinib,Encorafenib+Cetuximab,Encorafenib+Cetuximab+FOLFOX Regimen,Tovorafenib,Trametinib,Vemurafenib,Vemurafenib+Atezolizumab+Cobimetinib,Vemurafenib+CobimetinibEncorafenib+Panitumumab,Selumetinib,Vemurafenib,Vemurafenib+Cobimetinib,DabrafenibVemurafenib,DabrafenibLEVEL_1LEVEL_1LEVEL_Dx255,450/1V600E0.45GRCh38BRAFATMissense_MutationSNPA140753336BRAF_V600E.GT:AD:AF:DP0/1:55,45:0.45:100TENSG00000157764TranscriptENST00000646891protein_coding20251799600V/EgTg/gAg-1HGNCHGNC:1097YESMANE_SelectNM_004333.6P4CCDS5863.1ENSP00000493543P15056.261UPI000013DF26EnsemblAA1PDB-ENSP_mappings:1uwh.A&PDB-ENSP_mappings:1uwh.B&PDB-ENSP_mappings:1uwj.A&PDB-ENSP_mappings:1uwj.B&PDB-ENSP_mappings:2fb8.A&PDB-ENSP_mappings:2fb8.B&PDB-ENSP_mappings:3c4c.A&PDB-ENSP_mappings:3c4c.B&PDB-ENSP_mappings:3d4q.A&PDB-ENSP_mappings:3d4q.B&PDB-ENSP_mappings:3idp.A&PDB-ENSP_mappings:3idp.B&PDB-ENSP_mappings:3ii5.A&PDB-ENSP_mappings:3ii5.B&PDB-ENSP_mappings:3og7.A&PDB-ENSP_mappings:3og7.B&PDB-ENSP_mappings:3ppj.A&PDB-ENSP_mappings:3ppj.B&PDB-ENSP_mappings:3ppk.A&PDB-ENSP_mappings:3ppk.B&PDB-ENSP_mappings:3prf.A&PDB-ENSP_mappings:3prf.B&PDB-ENSP_mappings:3pri.A&PDB-ENSP_mappings:3pri.B&PDB-ENSP_mappings:3psb.A&PDB-ENSP_mappings:3psb.B&PDB-ENSP_mappings:3psd.A&PDB-ENSP_mappings:3psd.B&PDB-ENSP_mappings:3q4c.A&PDB-ENSP_mappings:3q4c.B&PDB-ENSP_mappings:3q96.A&PDB-ENSP_mappings:3q96.B&PDB-ENSP_mappings:3skc.A&PDB-ENSP_mappings:3skc.B&PDB-ENSP_mappings:3tv4.A&PDB-ENSP_mappings:3tv4.B&PDB-ENSP_mappings:3tv6.A&PDB-ENSP_mappings:3tv6.B&PDB-ENSP_mappings:4cqe.A&PDB-ENSP_mappings:4cqe.B&PDB-ENSP_mappings:4dbn.A&PDB-ENSP_mappings:4dbn.B&PDB-ENSP_mappings:4e26.A&PDB-ENSP_mappings:4e26.B&PDB-ENSP_mappings:4e4x.A&PDB-ENSP_mappings:4e4x.B&PDB-ENSP_mappings:4ehe.A&PDB-ENSP_mappings:4ehe.B&PDB-ENSP_mappings:4ehg.A&PDB-ENSP_mappings:4ehg.B&PDB-ENSP_mappings:4fc0.A&PDB-ENSP_mappings:4fc0.B&PDB-ENSP_mappings:4fk3.A&PDB-ENSP_mappings:4fk3.B&PDB-ENSP_mappings:4g9c.A&PDB-ENSP_mappings:4g9c.B&PDB-ENSP_mappings:4g9r.A&PDB-ENSP_mappings:4g9r.B&PDB-ENSP_mappings:4h58.A&PDB-ENSP_mappings:4h58.B&PDB-ENSP_mappings:4h58.C&PDB-ENSP_mappings:4jvg.A&PDB-ENSP_mappings:4jvg.B&PDB-ENSP_mappings:4jvg.C&PDB-ENSP_mappings:4jvg.D&PDB-ENSP_mappings:4ksp.A&PDB-ENSP_mappings:4ksp.B&PDB-ENSP_mappings:4ksq.A&PDB-ENSP_mappings:4ksq.B&PDB-ENSP_mappings:4mbj.A&PDB-ENSP_mappings:4mbj.B&PDB-ENSP_mappings:4mne.B&PDB-ENSP_mappings:4mne.C&PDB-ENSP_mappings:4mne.F&PDB-ENSP_mappings:4mne.G&PDB-ENSP_mappings:4mnf.A&PDB-ENSP_mappings:4mnf.B&PDB-ENSP_mappings:4pp7.A&PDB-ENSP_mappings:4pp7.B&PDB-ENSP_mappings:4r5y.A&PDB-ENSP_mappings:4r5y.B&PDB-ENSP_mappings:4rzv.A&PDB-ENSP_mappings:4rzv.B&PDB-ENSP_mappings:4rzw.A&PDB-ENSP_mappings:4rzw.B&PDB-ENSP_mappings:4wo5.A&PDB-ENSP_mappings:4wo5.B&PDB-ENSP_mappings:4xv1.A&PDB-ENSP_mappings:4xv1.B&PDB-ENSP_mappings:4xv2.A&PDB-ENSP_mappings:4xv2.B&PDB-ENSP_mappings:4xv3.A&PDB-ENSP_mappings:4xv3.B&PDB-ENSP_mappings:4xv9.A&PDB-ENSP_mappings:4yht.A&PDB-ENSP_mappings:4yht.B&PDB-ENSP_mappings:5c9c.A&PDB-ENSP_mappings:5c9c.B&PDB-ENSP_mappings:5csw.A&PDB-ENSP_mappings:5csw.B&PDB-ENSP_mappings:5csx.A&PDB-ENSP_mappings:5ct7.A&PDB-ENSP_mappings:5ct7.B&PDB-ENSP_mappings:5fd2.A&PDB-ENSP_mappings:5fd2.B&PDB-ENSP_mappings:5hi2.A&PDB-ENSP_mappings:5hid.A&PDB-ENSP_mappings:5hid.B&PDB-ENSP_mappings:5hie.A&PDB-ENSP_mappings:5hie.B&PDB-ENSP_mappings:5hie.C&PDB-ENSP_mappings:5hie.D&PDB-ENSP_mappings:5ita.A&PDB-ENSP_mappings:5ita.B&PDB-ENSP_mappings:5jrq.A&PDB-ENSP_mappings:5jrq.B&PDB-ENSP_mappings:5jsm.A&PDB-ENSP_mappings:5jsm.B&PDB-ENSP_mappings:5jsm.C&PDB-ENSP_mappings:5jsm.D&PDB-ENSP_mappings:5jt2.A&PDB-ENSP_mappings:5jt2.B&PDB-ENSP_mappings:5jt2.C&PDB-ENSP_mappings:5jt2.D&PDB-ENSP_mappings:5val.A&PDB-ENSP_mappings:5val.B&PDB-ENSP_mappings:5vam.A&PDB-ENSP_mappings:5vam.B&PDB-ENSP_mappings:6b8u.A&PDB-ENSP_mappings:6b8u.B&PDB-ENSP_mappings:6cad.A&PDB-ENSP_mappings:6cad.B&PDB-ENSP_mappings:6n0p.A&PDB-ENSP_mappings:6n0p.B&PDB-ENSP_mappings:6n0q.A&PDB-ENSP_mappings:6n0q.B&PDB-ENSP_mappings:6nsq.A&PDB-ENSP_mappings:6nsq.B&PDB-ENSP_mappings:6nyb.A&PDB-ENSP_mappings:6p3d.A&PDB-ENSP_mappings:6p7g.A&PDB-ENSP_mappings:6p7g.B&PDB-ENSP_mappings:6p7g.C&PDB-ENSP_mappings:6p7g.D&PDB-ENSP_mappings:6pp9.A&PDB-ENSP_mappings:6q0j.A&PDB-ENSP_mappings:6q0j.B&PDB-ENSP_mappings:6q0k.A&PDB-ENSP_mappings:6q0k.B&PDB-ENSP_mappings:6q0t.A&PDB-ENSP_mappings:6q0t.B&PDB-ENSP_mappings:6u2g.B&PDB-ENSP_mappings:6u2h.C&PDB-ENSP_mappings:6u2h.D&PDB-ENSP_mappings:6uan.B&PDB-ENSP_mappings:6uan.C&PDB-ENSP_mappings:6uuo.A&PDB-ENSP_mappings:6uuo.B&PDB-ENSP_mappings:6v2u.A&PDB-ENSP_mappings:6v2u.B&PDB-ENSP_mappings:6v2w.A&PDB-ENSP_mappings:6v34.A&PDB-ENSP_mappings:6v34.B&PDB-ENSP_mappings:6xag.C&PDB-ENSP_mappings:6xag.D&PDB-ENSP_mappings:6xfp.A&PDB-ENSP_mappings:6xlo.A&PDB-ENSP_mappings:6xlo.B&PDB-ENSP_mappings:7k0v.A&PDB-ENSP_mappings:7k0v.B&PDB-ENSP_mappings:7k0v.C&PDB-ENSP_mappings:7k0v.D&PDB-ENSP_mappings:7m0t.A&PDB-ENSP_mappings:7m0u.A&PDB-ENSP_mappings:7m0v.A&PDB-ENSP_mappings:7m0w.A&PDB-ENSP_mappings:7m0x.A&PDB-ENSP_mappings:7m0y.A&PDB-ENSP_mappings:7m0z.A&PDB-ENSP_mappings:7mfd.A&PDB-ENSP_mappings:7mfe.A&PDB-ENSP_mappings:7mff.A&PDB-ENSP_mappings:7mff.B&PDB-ENSP_mappings:7p3v.A&PDB-ENSP_mappings:7p3v.B&PDB-ENSP_mappings:7shv.A&PDB-ENSP_mappings:7shv.B&PDB-ENSP_mappings:7zr0.K&PDB-ENSP_mappings:7zr5.K&PDB-ENSP_mappings:7zr6.K&PDB-ENSP_mappings:8c7x.A&PDB-ENSP_mappings:8c7x.B&PDB-ENSP_mappings:8c7y.A&PDB-ENSP_mappings:8c7y.B&PDB-ENSP_mappings:8dgs.A&PDB-ENSP_mappings:8dgt.A&PDB-ENSP_mappings:8f7o.A&PDB-ENSP_mappings:8f7o.B&PDB-ENSP_mappings:8f7p.A&PDB-ENSP_mappings:8f7p.B&PDB-ENSP_mappings:8qqg.A&PDB-ENSP_mappings:8qqg.B&PDB-ENSP_mappings:8qqg.C&PDB-ENSP_mappings:9axx.B&PDB-ENSP_mappings:9axx.D&PDB-ENSP_mappings:9axy.A&PDB-ENSP_mappings:9bfb.A&Pfam:PF07714&Gene3D:1.10.510.10&PANTHER:PTHR44329&Superfamily:SSF56112&PROSITE_profiles:PS50011&CDD:cd14062&SMART:SM00220&AFDB-ENSP_mappings:AF-P15056-F10000009e-0701.16e-05pathogenic&not_provided&likely_pathogenic0&1&1&1&11&1&1&1&123757202&30089490&26900293&12460918&20619739&21107323&22773810&23614898&25032700&25157968&26619011&24144365&31752122&12960123&12068308&12460919&14679157&15035987&19001320&19010912&19018267&19238210&19404918&19537845&19561230&20350999&20413299&20630094&20735442&20818844&21129611&21156289&21163703&21426297&21483012&21639808&21683865&21975775&22038996&22048237&22180495&22281684&22351686&22356324&22389471&22448344&22536370&22586120&22608338&22649091&22663011&22735384&22743296&22805292&22972589&22997239&23020132&23031422&23251002&23325582&23470635&23524406&23549875&23812671&23833300&23845441&23918947&24107445&24163374&24388723&24576830&24583796&24586605&24594804&25024077&25370471&25989278&26678033&12198537&21107320&33076847&32184228&26090869&32843432&32238401&26310374&28607096&35311178&31371350&30770838&26513174&28556791&32933095&24512911&32770181&36733350&28708103&28282860&35904569&35820816&30797065&26909593&34667063&36866106&36686473&29043205&35582142&24670642&15001635&15356022&23302800&15342696&12670889&1244737FAIL622-1432BRAF139610.0000229000MONDO:MONDO:0024291&MedGen:C0158570&Human_Phenotype_Ontology:HP:0100764&MONDO:MONDO:0002013&MedGen:C0024221&Orphanet:2415&MONDO:MONDO:0004992&MedGen:C0006826&MedGen:CN230736&.&Human_Phenotype_Ontology:HP:0002861&Human_Phenotype_Ontology:HP:0002887&Human_Phenotype_Ontology:HP:0006777&Human_Phenotype_Ontology:HP:0007474&MONDO:MONDO:0005105&MeSH:D008545&MedGen:C0025202&MONDO:MONDO:0015280&MedGen:C1275081&OMIM:PS115150&Orphanet:1340&Human_Phenotype_Ontology:HP:0000115&Human_Phenotype_Ontology:HP:0002667&MONDO:MONDO:0006058&MeSH:D009396&MedGen:C0027708&Orphanet:654&MedGen:C3661900&MONDO:MONDO:0021060&MedGen:C5555857&Orphanet:536391&Human_Phenotype_Ontology:HP:0006775&MONDO:MONDO:0009693&MeSH:D009101&MedGen:C0026764&OMIM:254500&Orphanet:29073&Orphanet:85443&Human_Phenotype_Ontology:HP:0002895&MONDO:MONDO:0005075&MeSH:D000077273&MedGen:C0238463&Orphanet:146&Human_Phenotype_Ontology:HP:0002408&MONDO:MONDO:0007154&MedGen:C0917804&OMIM:108010&Orphanet:46724&MONDO:MONDO:0021656&MedGen:C1266158&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&MedGen:C2674727&MONDO:MONDO:0002032&MedGen:C0699790Pathogenic(3)&Likely_pathogenic(1)&Uncertain_significance(1)SCV000112810&SCV001450230&SCV004176942&SCV005022010&SCV005812663single_nucleotide_variantSO:0001483ClinGen:CA123643&Genetic_Testing_Registry_(GTR):GTR000522729&Genetic_Testing_Registry_(GTR):GTR000575664&Genetic_Testing_Registry_(GTR):GTR000575672&Genetic_Testing_Registry_(GTR):GTR000575677&Genetic_Testing_Registry_(GTR):GTR000613631&OMIM:164757.0001&UniProtKB:P15056#VAR_018629BRAF:673SO:0001583&missense_variantNeoplasm&Thyroid_gland_undifferentiated_(anaplastic)_carcinomaHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651&Human_Phenotype_Ontology:HP:0011779&MONDO:MONDO:0006468&MeSH:D065646&MedGen:C0238461&Orphanet:142SCV005094141113488022Diffuse_low-grade_glioma&_MAPK_pathwayaltered&Benign_metanephric_tumor&Dysembryoplastic_neuroepithelial_tumor&Malignant_peripheral_nerve_sheath_tumor&IDH-wildtype_glioblastoma&Diffuse_leptomeningeal_glioneuronal_tumor&Nodular_ganglioneuroblastoma&Polymorphous_low_grade_neuroepithelial_tumor_of_the_young&Epithelioid_Glioblastoma&Diffuse_midline_glioma&_H3_K27M-mutant&Melanoma&Ganglioglioma&Malignant_glioma&Spindle_cell_sarcoma&Embryonal_rhabdomyosarcoma&Pleomorphic_xanthoastrocytoma&Colorectal_cancer&Neuroblastoma&Papillary_thyroid_carcinoma&Alveolar_rhabdomyosarcoma&Pilocytic_astrocytomaMONDO:MONDO:0859614&MedGen:CN372173&MONDO:MONDO:0018738&MedGen:C5681098&Orphanet:464359&Human_Phenotype_Ontology:HP:0033703&MONDO:MONDO:0005505&MedGen:C1266177&Orphanet:251946&MONDO:MONDO:0017827&MedGen:C0751690&Orphanet:3148&MONDO:MONDO:0850335&MedGen:CN372125&MONDO:MONDO:0858956&MedGen:C4329735&MONDO:MONDO:0003325&MedGen:C1517445&MONDO:MONDO:0858959&MedGen:C5556330&MedGen:C4289580&MONDO:MONDO:0957196&MedGen:C4289688&Human_Phenotype_Ontology:HP:0002861&Human_Phenotype_Ontology:HP:0002887&Human_Phenotype_Ontology:HP:0006777&Human_Phenotype_Ontology:HP:0007474&MONDO:MONDO:0005105&MeSH:D008545&MedGen:C0025202&Human_Phenotype_Ontology:HP:0033664&MONDO:MONDO:0016733&MedGen:C0206716&Orphanet:251949&MONDO:MONDO:0100342&MedGen:C0555198&MONDO:MONDO:0002927&MedGen:C0205945&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&Human_Phenotype_Ontology:HP:0033682&MONDO:MONDO:0016690&MedGen:C0334586&Orphanet:251607&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500&Human_Phenotype_Ontology:HP:0003006&Human_Phenotype_Ontology:HP:0006738&MONDO:MONDO:0005072&MeSH:D009447&MedGen:C0027819&Orphanet:635&Human_Phenotype_Ontology:HP:0002895&MONDO:MONDO:0005075&MeSH:D000077273&MedGen:C0238463&Orphanet:146&Human_Phenotype_Ontology:HP:0006779&MONDO:MONDO:0009994&MedGen:C0206655&OMIM:268220&Orphanet:780&Orphanet:99756&Human_Phenotype_Ontology:HP:0033680&MONDO:MONDO:0016691&MedGen:C0334583&Orphanet:251612SCV004565360&SCV004565362&SCV005870910&SCV006312223&SCV007105098&SCV007105110&SCV007105118&SCV007105121&SCV007105125&SCV007105131&SCV007105133&SCV007105134&SCV007105140&SCV007105544&SCV007105546&SCV007105547&SCV0071055497:140753336-1407533361BRAFp.V600E.True.The class I activating exon 15 BRAF V600E mutation is located in the kinase domain of the BRAF protein and is highly recurrent in melanoma, lung and thyroid cancer, among others (PMID: 28783719, 26091043, 25079552, 23833300, 25417114, 28783719, 12068308). This mutation has been comprehensively biologically characterized and has been shown to activate the downstream MAPK pathway independent of RAS (PMID: 15035987, 12068308, 19251651, 26343582), to render BRAF constitutively activated in monomeric form (PMID: 20179705), and to retain sensitivity to RAF monomer inhibitors such as vemurafenib and dabrafenib (PMID:26343582, 28783719, 20179705, 30351999)..BRAF, an intracellular kinase, is frequently mutated in melanoma, thyroid and lung cancers among others...25417114|20179705|23833300|26091043|26343582|12068308|30351999|25079552|28783719|19251651|15035987..V600E673BRAFGRCh38.MUTATION..The BRAF V600E mutation is known to be oncogenic.FalseLEVEL_Fda2The class I activating exon 15 BRAF V600E mutation is located in the kinase domain of the BRAF protein and is highly recurrent in melanoma, lung and thyroid cancer, among others (PMID: 28783719, 26091043, 25079552, 23833300, 25417114, 28783719, 12068308). This mutation has been comprehensively biologically characterized and has been shown to activate the downstream MAPK pathway independent of RAS (PMID: 15035987, 12068308, 19251651, 26343582), to render BRAF constitutively activated in monomeric form (PMID: 20179705), and to retain sensitivity to RAF monomer inhibitors such as vemurafenib and dabrafenib (PMID:26343582, 28783719, 20179705, 30351999).['25417114', '20179705', '23833300', '26091043', '26343582', '12068308', '30351999', '25079552', '28783719', '19251651', '15035987']LEVEL_Dx2['V600E']['20519626', '30157397', '24938183', '26637772']This assertion is supported by (PMID: 24938183, 20519626, 30157397, 26637772).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUIDLEVEL_Dx2['V600E']['23347903', '25480661', '22072557', '21910720', '22210875', '25120816', '22028477', '21663470', '26071465', '22531170']This assertion is supported by (PMID: 21663470, 25480661, 22072557, 22028477, 21910720, 22531170, 22210875, 23347903, 25120816, 26071465).962.0HCLLimeGreenHairy Cell LeukemiaMature B-Cell NeoplasmsLIQUIDLymphoidMBN5.0LIQUIDLEVEL_Dx3['V600E']['25422482', '26637772']This assertion is supported by (PMID: 25422482, 26637772).854.0ECDLightSalmonErdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUIDLEVEL_Dx3['Oncogenic Mutations']['22237106']This assertion is supported by (PMID: 22237106).757.0ETPLLLimeGreenEarly T-Cell Precursor Lymphoblastic LeukemiaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidTLL4.0LIQUID['V600E']DabrafenibLEVEL_1LEVEL_Fda2['22608338', '23051966', '22735384']Dabrafenib is an orally bioavailable RAF inhibitor that is FDA-approved for use in patients with BRAF V600E- and V600K-mutant metastatic melanoma. FDA approval is based on the randomized Phase III trial in which dabrafenib (150 mg orally twice daily) was compared with dacarbazine (1000 mg/m2 intravenously every three weeks) in 250 patients with BRAF V600E-mutated metastatic melanoma. Dabrafenib was associated with improved progression-free survival (median 5.1 months vs. 2.7 months with dacarbazine, hazard ratio = 0.30, p<0.0001) (PMID: 22735384). Dabrafenib may also be effective against brain metastases, as demonstrated by a Phase II trial in which approximately 40% of previously untreated and 30% of previously treated patients experienced an overall intracranial response and a separate trial in which nine out of ten patients had a reduction in the size of their brain metastases (PMID: 23051966, 22608338).257.0MELBlackMelanomaMelanomaSOLIDSkinSKIN2.0SOLID['V600E']Dabrafenib + TrametinibLEVEL_1LEVEL_Fda2[{'id': 21, 'code': '', 'color': 'SaddleBrown', 'name': '', 'mainType': {'id': None, 'name': 'Colorectal Cancer', 'tumorForm': 'SOLID'}, 'tissue': 'Bowel', 'children': {}, 'parent': None, 'level': 0, 'tumorForm': 'SOLID'}]['32758030', '27283860', '23020132', '32818466', '25399551', '34838156'][{'abstract': 'Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020.', 'link': 'https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318'}, {'abstract': 'Bouffet et al. Abstract# LBA2002, ASCO 2022.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.17_suppl.LBA2002'}]Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved in combination for the treatment of patients with solid tumors other than colorectal harboring BRAF V600E mutation. FDA approval was based on data from 131 adult patients with solid tumors treated with dabrafenib and trametinib in the BRF117019 and NCI-MATCH trials and 36 pediatric patients treated with dabrafenib and trametinib in the CTMT212X2101 study. Of the 131 adult patients treated with dabrafenib and trametinib, the overall response rate was 41% (54/131, 95% CI = 33-50) and of the 36 pediatric patients treated with dabrafenib and trametinib (low-grade glioma, n=34, high-grade glioma, n=2), the overall response rate was 25% (95% CI = 12-24) (PMID: 32818466, 34838156, 32758030)(Abstract: Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318/). In the randomized, Phase II study of dabrafenib and trametinib in 110 patients with BRAF V600mutant pediatric low-grade glioma (dabrafenib + trametinib treatment, n=37, carboplatin + vincristine treatment, n=37), the overall response rate was 47% (95% CI= 35%-59%) with dabrafenib and trametinib and 11% (95% CI= 3%-25%) with carboplatin and vincristine, and the progression-free survival was 20.1 months (95% CI= 12.8 mo-not estimable) with dabrafenib and trametinib and 7.4 months (95% CI= 3.6-11.8 mo) with carboplatin and vincristine (Abstract: Bouffet et al. Abstract# LBA2002, ASCO 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.17_suppl.LBA2002). FDA approval was supported by results in COMBI-d, COMBI-v and BRF113928 studies in melanoma and lung cancer (PMID: 23020132, 25399551, 27283860).5.0All Solid TumorsSOLID-1.0SOLID['V600E']Dabrafenib + TrametinibLEVEL_1LEVEL_Fda2['29072975']Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved alone or in combination for the treatment of patients with locally advanced or metastatic anaplastic thyroid cancer (ATC) with BRAF V600E mutation and with no satisfactory locoregional treatment options. FDA approval was based on results of the Phase II study of dabrafenib combined with trametinib in patients with BRAF V600E-positive ATC in which the overall response rate in sixteen evaluable patients was 69% (11/16, 95% CI= 41%-89%)(PMID: 29072975).297.0THAPTealAnaplastic Thyroid CancerThyroid CancerSOLIDThyroidTHYROID2.0SOLID['V600E']Dabrafenib + TrametinibLEVEL_1LEVEL_Fda2['32758030', '37059834', '27283860', '23020132', '32818466', '25399551', '34838156'][{'abstract': 'Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020.', 'link': 'https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318'}]Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved in combination for the treatment of patients with solid tumors other than colorectal harboring BRAF V600E mutation. FDA approval was based on data from 131 adult patients with solid tumors treated with dabrafenib and trametinib in the BRF117019 and NCI-MATCH trials and 36 pediatric patients treated with dabrafenib and trametinib in the CTMT212X2101 study. Of the 131 adult patients treated with dabrafenib and trametinib, the overall response rate was 41% (54/131, 95% CI = 33-50) and of the 36 pediatric patients treated with dabrafenib and trametinib (low-grade glioma, n=34, high-grade glioma, n=2), the overall response rate was 25% (95% CI = 12-24) (PMID: 32818466, 34838156, 32758030)(Abstract: Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318/). Approval was supported by results in COMBI-d, COMBI-v and BRF113928 studies in melanoma and lung cancer (PMID: 23020132, 25399551, 27283860). In the Phase II ROAR basket trial of dabrafenib + trametinib in patients with BRAF V600E-mutated rare cancers (biliary tract cancer, n=43), the overall response rate was 53%, the median progression-free survival was nine months (95% CI = 5.5, 9.4) and the median overall survival was 13.5 months (95% CI = 10.4, 17.6) (PMID: 37059834). Of the 43 patients with biliary tract cancer, 53% of patients (23/43) had a partial response and 37% (16/43) had stable disease (PMID: 37059834). Additionally, in subprotocol H of the NCI-MATCH basket trial of dabrafenib + trametinib in patients with BRAF V600E-mutant solid tumors (n=4 patients with intrahepatic cholangiocarcinoma), the overall response rate was 100%, with 4/4 patients achieving a partial response (PMID: 32758030).153.0BILIARY_TRACTGreenBiliary TractBiliary Tract CancerSOLIDBiliary TractTISSUE1.0SOLID['V600E']Dabrafenib + TrametinibLEVEL_1LEVEL_Fda2['32758030', '37059834', '27283860', '23020132', '32818466', '25399551', '34838156'][{'abstract': 'Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020.', 'link': 'https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318'}]Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved in combination for the treatment of patients with solid tumors other than colorectal harboring BRAF V600E mutation. FDA approval was based on data from 131 adult patients with solid tumors treated with dabrafenib and trametinib in the BRF117019 and NCI-MATCH trials and 36 pediatric patients treated with dabrafenib and trametinib in the CTMT212X2101 study. Of the 131 adult patients treated with dabrafenib and trametinib, the overall response rate was 41% (54/131, 95% CI = 33-50) and of the 36 pediatric patients treated with dabrafenib and trametinib (low-grade glioma, n=34, high-grade glioma, n=2), the overall response rate was 25% (95% CI = 12-24) (PMID: 32818466, 34838156, 32758030)(Abstract: Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318/). Approval was supported by results in COMBI-d, COMBI-v and BRF113928 studies in melanoma and lung cancer (PMID: 23020132, 25399551, 27283860). In the Phase II ROAR basket trial of dabrafenib + trametinib in patients with BRAF V600E-mutated rare cancers (biliary tract cancer, n=43), the overall response rate was 53%, the median progression-free survival was nine months (95% CI = 5.5, 9.4) and the median overall survival was 13.5 months (95% CI = 10.4, 17.6) (PMID: 37059834). Of the 43 patients with biliary tract cancer, 53% of patients (23/43) had a partial response and 37% (16/43) had stable disease (PMID: 37059834). Additionally, in subprotocol H of the NCI-MATCH basket trial of dabrafenib + trametinib in patients with BRAF V600E-mutant solid tumors (n=4 patients with intrahepatic cholangiocarcinoma), the overall response rate was 100%, with 4/4 patients achieving a partial response (PMID: 32758030).15.0MIXEDHepatobiliary CancerSOLIDMIXED0.0SOLID['V600E']Dabrafenib + TrametinibLEVEL_1LEVEL_Fda2['37733309']Dabrafenib, a small molecule RAF inhibitor, and trametinib, a small molecule MEK1/2 inhibitor, are FDA-approved in combination for the treatment of pediatric patients 1 year of age and older with low-grade glioma (LGG) with a BRAF V600E mutation who require systemic therapy. FDA approval is based on the results of the Phase II Study CDRB436G2201 (NCT02684058) of dabrafenib plus trametinib versus carboplatin plus vincristine in 110 patients with BRAF V600-mutant LGG, as assessed by local or central laboratory tests. In the Phase II Study CDRB436G2201 (NCT02684058), the dabrafenib plus trametinib cohort (n=73 [n=70, V600E, n=3, other]) demonstrated an overall response rate (ORR) of 47% (95% CI=35-59), with a 3% (n=2) complete response (CR) rate, a 44% (n=32) partial response (PR) rate and a 41% (n=30) stable disease (SD) rate, and a median duration of response (DOR) of 20.3 months (95% CI=12.0-NE) while the chemotherapy cohort (n=37 [n=35, V600E, n=1, other, n=1, nonmutant]) demonstrated an ORR of 11% (95% CI=3-25) (OR=7.19 [95% CI=2.30-22.40], RR=4.31 [95% CI=1.70-11.20], p<0.001), with a 3% (n=1) CR rate, an 8% (n=3) PR rate and a 41% (n=15) SD rate, and a median DOR that was not estimable (95% CI=6.6-NE) (PMID: 37733309).646.0LGGNOSGrayLow-Grade Glioma, NOSGliomaSOLIDCNS/BrainENCG3.0SOLID['V600E', 'V600K']Dabrafenib + TrametinibLEVEL_1LEVEL_Fda2['31171876', '28891408', '31171878', '31171879', '25265492', '25287827', '29361468', '28991513', '23020132', '25399551']Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved alone or in combination for the treatment of patients with metastatic melanoma harboring a V600E or V600K BRAF mutation. FDA approval of dabrafenib in combination with trametinib was based on results from an open-label Phase III study of combination therapy versus dabrafenib monotherapy in 247 patients with metastatic melanoma who were naive to treatment with BRAF inhibitors. Combined dabrafenib and trametinib, administered in full monotherapy doses, improved the response rate in patients with BRAF V600-mutant metastatic melanoma versus dabrafenib monotherapy (67% vs.51%, p<0.002). However, median progression-free survival improved by only 2 weeks (9.3 months vs 8.8 months, HR = 0.75) compared with dabrafenib monotherapy (PMID: 23020132). Combination therapy is associated with less cutaneous toxicity than monotherapy, but systemic toxicity may be increased (PMID: 25287827, 25399551). Follow-up trials have demonstrated that all clinical measures inclusive of overall and median progression-free survival as well as objective response rates, median duration of response and number of patients with complete response favored patients treated with combination dabrafenib and trametinib, administered in full monotherapy doses, compared to either dabrafenib or vemurafenib monotherapy, including patients who previously progressed on BRAF inhibitor monotherapy (PMID: 25287827, 25399551, 25265492). Additionally, patients with melanoma treated with dabrafenib and trametinib in both the neoadjuvant and adjuvant settings have improved survival over patients given standard of care (PMID: 29361468, 28991513, 28891408). Promising clinical data has also suggested that addition of an immunotherapy agent to combination RAF and MEK inhibitor treatment may improve rate of overall response and duration of response in melanoma patients (PMID: 31171876, 31171879, 31171878).257.0MELBlackMelanomaMelanomaSOLIDSkinSKIN2.0SOLID['V600E']Dabrafenib + TrametinibLEVEL_1LEVEL_Fda2['28919011', '27283860']Dabrafenib, an orally bioavailable RAF inhibitor, and trametinib, an orally bioavailable MEK1/2 inhibitor, are FDA-approved alone or in combination for the treatment of patients with metastatic non-small cell lung cancer (NSCLC) with BRAF V600E mutation. FDA approval was based on a Phase II, multicenter, non-randomized, open-label study of dabrafenib in combination with trametinib in patients with chemotherapy-pretreated, metastatic, stage IV BRAF(V600E)-mutant non-small cell lung cancer, in which 36 of 57 patients (63%) achieved overall tumor response, with two patients experiencing durable complete responses and 34 patients having durable partial responses (PMID: 27283860). In the third arm of that study, which included patients with untreated, metastatic, stage IV BRAF(V600E)-mutant non-small cell lung cancer, 23 of 26 patients (64%, 95% CI 46-79) had an overall response, with two patients (6%) having durable complete response and 21 (58%) having partial response (PMID: 28919011).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['V600E', 'V600K']Encorafenib + BinimetinibLEVEL_1LEVEL_Fda2['29573941', '35862871']The combination of encorafenib, an inhibitor of V600E- or V600K-mutant BRAF, and binimetinib, an inhibitor of MEK1/2, is FDA-approved in combination for patients with unresectable or metastatic melanoma with a BRAF V600E or V600K mutation. FDA approval was based on the results of the Phase III COLUMBUS trial of combined encorafenib plus binimetinib versus single-agent vemurafenib in 577 patients with BRAF V600E- or V600K-mutant metastatic melanoma in which the median progression-free survival was 14.9 months (95% CI = 11.0-18.5) in the encorafenib plus binimetinib group versus 7.3 months (95% CI = 5.6-8.2) in the single agent vemurafenib group (HR= 0.54, 95% CI = 0.41-0.71, p<00001) (PMID: 29573941). In the five-year update of the Phase III COLUMBUS trial, the progression-free survival and overall survival were 23% and 35% respectively in the encorafenib plus binimetinib group (n=192) versus 10% and 21% respectively in the single agent vemurafenib group (n=191), and the median duration of response and disease control rate were 18.6 months and 92.2% in the encorafenib plus binimetinib group versus 12.3 months and 81.2% in the single-agent vemurafenib group (PMID: 35862871).257.0MELBlackMelanomaMelanomaSOLIDSkinSKIN2.0SOLID['V600E']Encorafenib + BinimetinibLEVEL_1LEVEL_Fda2['37270692']Encorafenib, a small molecule inhibitor of RAF kinases, and binimetinib, a small molecule inhibitor of MEK1/2 kinases, are FDA-approved in combination for the treatment of patients with BRAF V600E mutant non-small cell lung cancer (NSCLC). FDA approval was based on the Phase II, open-label, multicenter, single-arm PHAROS study of encorafenib in combination with binimetinib in treatment-nave (n=59) and previously treated (n=39) patients with BRAF V600E-mutant metastatic NSCLC (PMID: 37270692). In the Phase II PHAROS study, the objective response rate and duration of response for treatment-nave patients were 72% (95% CI=62, 85) and 44 months (95% CI=23.1, NE), with 15% experiencing a complete response and 59% experiencing a partial response, compared to 46% (95% CI=30, 63) and 18 months (95% CI=7.4, NE) in previously treated patients, with 10% experiencing a complete response and 36% experiencing a partial response (PMID: 37270692).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['V600E']Encorafenib + CetuximabLEVEL_1LEVEL_Fda2['31566309']Encorafenib, a small molecule RAF-targeted inhibitor, and cetuximab, an anti-EGFR antibody, are FDA-approved in combination for the treatment of adult patients with metastatic CRC with a BRAF V600E mutation, as detected by an FDA-approved test, after prior therapy. BRAF V600E mutations for treatment with encorafenib plus cetuximab were detected by the FoundationOne Liquid CDx, the MI Cancer Seek assay or the therascreen BRAF V600E RGQ PCR Kit. FDA approval was based on results of the Phase III BEACON (NCT02928224) study of encorafenib plus cetuximab (n=220) versus triplet treatment (including a MEK1/2 inhibitor) versus chemotherapy (n=221) in 665 patients with BRAF V600E-mutant colorectal cancer. __In the Phase III BEACON (NCT02928224) trial, the overall response rate (complete or partial response) was 20% (95% CI=13-29) in the doublet arm versus 2% (95% CI=<1%-7%) in the chemotherapy arm (n=221), with median overall survival of 8.4 months in the doublet arm (95% CI= 7.5-11.0) and 5.4 months in the chemotherapy arm (95% CI= 4.8-6.6) (PMID: 31566309).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['V600E']Encorafenib + Cetuximab + FOLFOX RegimenLEVEL_1LEVEL_Fda2['39863775', '40444708'][{'abstract': 'Kopetz S., et al. Abstract#13. ASCO 2026.', 'link': 'https://ascopubs.org/doi/10.1200/JCO.2026.44.2_suppl.13'}]Encorafenib, a small molecule RAF-targeted inhibitor, and cetuximab, an anti-EGFR antibody, are FDA-approved in combination with FOLFOX6 for the treatment of patients with metastatic colorectal cancer (mCRC) with a BRAF V600E mutation, as detected by an FDA-approved test. BRAF V600E mutations were detected by the therascreen BRAF V600E RGQ PCR Kit. FDA approval was based on the results of the Phase III BREAKWATER (NCT04607421) trial of encorafenib plus cetuximab versus encorafenib plus cetuximab with FOLFOX6 versus standard-of-care in 479 patients with BRAF V600E-mutant mCRC.__In the Phase III BREAKWATER (NCT04607421) trial, the cohort treated with encorafenib plus cetuximab with FOLFOX6 (n=110) demonstrated an overall response rate (ORR) of 60.9% (95% CI=51.6-69.5), with a 2.7% (n=3) complete response (CR) rate, 58.2% (n=64) partial response (PR) rate and 28.2% (n=31) stable disease (SD) rate. The median duration of response (DOR) for this cohort was 13.9 months (95% CI=8.5-NE), with a median progression free survival (mPFS) of 12.8 months (95%CI=11.2-15.9), and a median overall survival (mOS) of 30.3 months (95% CI= 21.7-NE)(PMID: 39863775, 40444708). The cohort that received standard-of-care (n=110) demonstrated an ORR of 40.0% (95% CI=31.3-49.3) (odds ratio=2.443 [95% CI=1.403-4.253, 99.8% CI=1.019-5.855], p=0.0008), with a 1.8% (n=2) CR rate, 38.2% (n=42) PR rate and 30.9% (n=34) SD rate. For this cohort, the median DOR was 11.1 months (95% CI=6.7-12.7), with a mPFS of 7.1 months (95% CI= 6.8-8.5) (hazard ratio [HR] 0.53 [95% CI= 0.41-0.68], p-value <0.0001), and a mOS of 15.1 months (95% CI= 13.7-17.7) (HR 0.49 [95% CI= 0.38-0.63), p-value <0.0001) (PMID: 39863775, 40444708). __The Phase III BREAKWATER (NCT04607421) trial also included Cohort 3 (n=147) which compared encorafenib plus cetuximab with FOLFIRI versus FOLFIRI with or without bevicuzumab for patients with BRAF V600E-mutant mCRC. The encorafenib plus cetuximab with FOLFIRI arm (n=73) demonstrated an ORR of 64.4% (95% CI=53-74), a median DOR that was not evaluable (95%CI= NE-NE) with 57.4% of patients with a DOR of 6 months, and a mOS that was also not evaluable (95% CI=NE-NE). The FOLFIRI with or without bevicuzumab arm (n=74) demonstrated an ORR of 39.2% (95% CI=29-51)(odds ratio 2.76 [95%CI=1.42-5.35] p-value = 0.0011), a median DOR that was not evaluable (95%CI=7.0-NE) with 34.5% of patients with a DOR of 6 months, and a mOS that was also not evaluable (95%CI=NE-NE)(HR 0.49 [95%CI=0.24-1.03])(Abstract: Kopetz S., et al. Abstract#13. ASCO 2026. https://ascopubs.org/doi/10.1200/JCO.2026.44.2_suppl.13).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['V600']TovorafenibLEVEL_1LEVEL_Fda2['37978284']Tovorafenib is an orally available, pan-RAF small molecule inhibitor that is FDA-approved for the treatment of pediatric patients six months of age and older with relapsed or refractory pediatric low-grade glioma (LGG) harboring a BRAF fusion or rearrangement, or BRAF V600 mutation. FDA approval was based on the results of the Phase II FIREFLY-1 (NCT04775485) trial of tovorafenib in 76 patients (median age=8 years old [range=2-21]) with relapsed or refractory pediatric LGG harboring an activating BRAF alteration based on local laboratory testing. In the Phase II FIREFLY-1 (NCT04775485) trial, the overall RAPNO-LGG cohort demonstrated an objective response rate (ORR) of 51% (95% CI=40-63), with a 37% (n=28) partial response rate and 14% (n=11) minor response rate, a median duration of response (DOR) of 13.8 months (95% CI=11.3-NE) in 39 patients and a median progression-free survival of 13.8 months (95% CI=8.3-16.9) (PMID: 37978284). The BRAF V600E mutation subcohort (n=12) demonstrated an ORR of 50% (95% CI=21-79) and a median DOR that was not evaluable (95% CI=8.4-NE) (PMID: 37978284).646.0LGGNOSGrayLow-Grade Glioma, NOSGliomaSOLIDCNS/BrainENCG3.0SOLID['V600E', 'V600K']TrametinibLEVEL_1LEVEL_Fda2['29361468', '25399551', '22663011', '25265492']Trametinib is an oral small molecule inhibitor of MEK1/2 that is FDA-approved alone or with dabrafenib for the treatment of patients with metastatic melanoma harboring a V600E or V600K BRAF mutation. In an open-label, randomized Phase III trial, patients with BRAF V600E/K-mutated unresectable, metastatic melanoma received oral trametinib (2 mg once daily) or an intravenous regimen of either dacarbazine (1000 mg/m2) or paclitaxel (175 mg/m2) every three weeks. Trametinib demonstrated improved progression-free survival (HR for disease progression or death = 0.45) and six-month overall survival (81% vs. 67%, death HR = 0.54, p=0.01) (PMID: 22663011). However, like other MEK inhibitors, the benefit of trametinib is limited by adverse reactions, most notably grade three or four rash and diarrhea (PMID: 22663011). Trametinib is not typically used as monotherapy for patients with BRAF V600K melanoma given its lower response rate compared to BRAF inhibitors and combined BRAF and MEK inhibitors. Patients previously treated with a RAF inhibitor appear to be less likely than untreated patients to respond to trametinib treatment (PMID: 22663011), and FDA guidelines state that trametinib as a monotherapy is not indicated for these patients. Dabrafenib and trametinib are FDA-approved as a combination therapy, which has superior clinical outcomes compared to dabrafenib or trametinib monotherapy (PMID: 25399551, 25265492). Additionally, patients with melanoma treated with dabrafenib and trametinib in both the neoadjuvant and adjuvant settings had improved survival over patients given standard of care (PMID: 29361468).257.0MELBlackMelanomaMelanomaSOLIDSkinSKIN2.0SOLID['V600']VemurafenibLEVEL_1LEVEL_Fda2['26287849', '29188284']Vemurafenib is an orally available, small molecule RAF-targeted inhibitor that is FDA-approved for the treatment of patients with Erdheim-Chester disease (ECD) with BRAF V600 mutation. FDA approval was based on the results of the Phase II VE-BASKET (NCT01524978) trial of vemurafenib in 26 patients with BRAF V600-mutant non-melanoma cancers (n=22, ECD, n=4, Langerhans cell histiocytosis [LCH])._In the Phase II VE-BASKET (NCT01524978) trial, the ECD cohort demonstrated an overall response rate of 54.5% (12/22) (95% CI=32.2-75.6), with one patient (4.5%) achieving complete response and eleven patients (50%) achieving partial response, and the median progression-free survival and overall survival were not reached (PMID: 29188284, 26287849).854.0ECDLightSalmonErdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['V600E']VemurafenibLEVEL_1LEVEL_Fda2['28961848', '24508103', '25399551']Vemurafenib is an orally available kinse inhibitor of V600-mutant BRAF that is FDA-approved for treatment of patients with unresectable or metastatic melanoma with the BRAF V600E mutation. Vemurafenib has been shown to have nearly equivalent activity against melanomas with BRAF V600E and V600K mutations (PMID: 24508103). In a randomized Phase III trial comparing vemurafenib (960 mg orally twice daily) with dacarbazine (1000 mg/m2 i.v. every 3 weeks) for treatment-naive, metastatic, BRAF V600E-mutant melanoma, vemurafenib was associated with better overall survival (median survival 13.6 months vs. 9.7 months, hazard ratio 0.70, p=.0008) and longer median progression-free survival (6.9 months vs. 1.6 months) (PMID: 24508103). Final overall survival data from the BRIM-3 study showed that the survival advantage of vemurafenib over dacarbazine persisted through the 4-year landmark, with survival rates for vemurafenib and dacarbazine at the 4-year landmark being 17.0% and 15.6%, respectively (PMID: 28961848). However, a trial evaluating clinical outcomes in patients with melanoma treated with either combination therapy of dabrafenib and trametinib compared to those treated with vemurafenib monotherapy demonstrated improved survival outcomes in the combination-therapy group compared to the vemurafenib group (PMID: 25399551).257.0MELBlackMelanomaMelanomaSOLIDSkinSKIN2.0SOLID['V600']Vemurafenib + Atezolizumab + CobimetinibLEVEL_1LEVEL_Fda2['32534646']The combination of vemurafenib, an inhibitor of V600-mutant BRAF, and cobimetinib, an inhibitor of MEK1/2, with atezolizumab, an immunotherapeutic PD-L1 antibody, is FDA-approved for patients with BRAF V600 mutation-positive unresectable or metastatic melanoma. FDA approval was based on the results of the Phase III double-blind, randomized, placebo-controlled IMspire150 trial of Atezolizumab + Cobimetinib + Vemurafenib versus Placebo + Cobimetinib + Vemurafenib in 514 patients with BRAF V600-mutant melanoma in which the median progression-free survival was 15.1 mos (95% CI=11.4,18.4) in the triplet arm versus 10.6 mos (95% CI=9.3,12.7) in the doublet + placebo arm (HR=0.78, 95% CI= 0.63, 0.97, p=0.0249) (PMID: 32534646).257.0MELBlackMelanomaMelanomaSOLIDSkinSKIN2.0SOLID['V600E', 'V600K']Vemurafenib + CobimetinibLEVEL_1LEVEL_Fda2['27480103', '31732523', '25265494']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for the treatment of patients with BRAF V600-mutant metastatic or unresectable locally advanced melanoma. FDA approval was based on results from the randomized Phase III coBRIM trial of combined vemurafenib and cobimetinib versus vemurafenib and placebo in 495 patients with metastatic BRAF V600-mutant melanoma that demonstrated superior clinical benefit measures in the combination versus the control arm. Specifically, median progression-free survival was 9.9 months in the combination arm versus 6.2 months in the control arm (HR = 0.51), with a complete response rate of 10% versus 4%, respectively, and interim nine-month overall survival of 81% versus 73%, respectively (PMID: 25265494). Follow-up analysis of the coBRIM trial showed two-year overall survival was 48.3% in the combination group versus 38.0% in the monotherapy group (PMID: 27480103), and five-year followup of the BRIM7 study showed a median overall survival of 31.8 months and a five-year survival rate of 39.2% (PMID: 31732523).257.0MELBlackMelanomaMelanomaSOLIDSkinSKIN2.0SOLID['V600E']Encorafenib + PanitumumabLEVEL_2LEVEL_Fda2['29431699', '31566309']Encorafenib, a small molecule inhibitor of RAF kinase, and panitumumab, an antibody that targets EGFR, are NCCN-compendium listed in combination as level 2A therapy for patients with BRAF V600E-positive colorectal cancer. In the Phase III BEACON study of encorafenib + cetuximab, another EGFR antibody, versus triplet treatment (including a MEK1/2 inhibitor) versus chemotherapy in 665 patients with BRAF V600E-mutant colorectal cancer, the overall response rate (complete or partial response) was 20% (95% CI= 13-29) in the doublet arm (n=220) versus 2% (95% CI= <1%-7%) in the chemotherapy arm (n=221), with median overall survival of 8.4 months in the doublet arm (95% CI= 7.5-11.0) and 5.4 months in the control arm (95% CI= 4.8-6.6) (PMID: 31566309). Panitumumab has also been used in doublet and triplet combination therapy, with a response rate in one study of 26% (PMID: 29431699).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['V600E']SelumetinibLEVEL_2LEVEL_Fda2['31151904']Selumetinib is a small molecule tyrosine kinase inhibitor of MEK1/2. In stratum one of the phase II PBTC study of selumetinib in 25 patients with pilocytic astrocytoma harboring a KIAA1549BRAF fusion or BRAF V600E mutation, seven of eighteen patients with a KIAA1549BRAF fusion had a partial response to treatment (PMID: 31151904). Additionally, the two year progression-free survival rate for the BRAF study population (n=25) was 70% (95% CI = 4785) (PMID: 31151904).452.0PASTGrayPilocytic AstrocytomaGliomaSOLIDCNS/BrainENCG3.0SOLID['V600E']VemurafenibLEVEL_2LEVEL_Fda2['26352686']Vemurafenib is an orally available kinse inhibitor of V600-mutant BRAF that is FDA-approved for treatment of patients with various BRAF V600-harboring tumors, including melanoma and Edheim-Chester Disease (ECD). Vemurafenib is listed as a 2A therapeutic in the NCCN guidelines for Hairy Cell Leukemia (HCL) based on data from two Phase II trials. In one study of vemurafenib in patients with BRAF V600E-mutant HCL (n=24), the overall response rate was 100%, with 42% of patients (10 of 24) having complete responses, with a response duration of 11.7 months and one year progression free and overall survival rates of 73% and 91%, repectively (PMID: 26352686). In another study of vemurafenib in patients with BRAF V600E-mutant HCL (n=26), the overall response rate was 96%, with 35% of patients (9 of 26) having complete responses (PMID: 26352686).962.0HCLLimeGreenHairy Cell LeukemiaMature B-Cell NeoplasmsLIQUIDLymphoidMBN5.0LIQUID['V600']VemurafenibLEVEL_2LEVEL_Fda3['32985015', '29188284', '30154124']Vemurafenib is an orally available, small molecule RAF-targeted inhibitor that is FDA-approved for the treatment of patients with Erdheim-Chester disease (ECD) with BRAF V600 mutation. Vemurafenib and dabrafenib are listed as monotherapies in the NCCN Histiocytic Neoplasms Guidelines (V3.2024) under the section "Principles of Systemic Therapy" as recommended treatment regimens for patients with Langerhans cell histiocytosis (LCH) harboring BRAF V600E mutations. NCCN recommendation was based on the results of the Phase II VE-BASKET (NCT01524978) and case reports._In the Phase II VE-BASKET (NCT01524978) trial, all four patients of the LCH cohort achieved partial response (PMID: 29188284). In the case series evaluating the use of BRAF inhibitors in six adult patients with BRAF V600Emutant LCH, patients treated with vemurafenib monotherapy (n=3) achieved one complete response (CR), one partial response (PR) and one stable disease (SD) response while patients treated with dabrafenib monotherapy (n=3) achieved one CR and two PRs (PMID: 32985015). In a separate case report, a patient with BRAF V600E-mutant LCH was treated with dabrafenib plus trametinib and demonstrated a sustained metabolic response (PMID: 30154124).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['V600E']Vemurafenib + CobimetinibLEVEL_2LEVEL_Fda3[{'id': 857, 'code': 'DMG', 'color': 'Gray', 'name': 'Diffuse Midline Glioma, H3 K27-Altered', 'mainType': {'id': None, 'name': 'Gliomas, Glioneuronal Tumors, and Neuronal Tumors', 'tumorForm': 'SOLID'}, 'tissue': 'CNS/Brain', 'children': {}, 'parent': 'PDIFHG', 'level': 4, 'tumorForm': 'SOLID'}, {'id': 534, 'code': 'GNOS', 'color': 'Gray', 'name': 'Glioma, NOS', 'mainType': {'id': None, 'name': 'Glioma', 'tumorForm': 'SOLID'}, 'tissue': 'CNS/Brain', 'children': {}, 'parent': 'DIFG', 'level': 3, 'tumorForm': 'SOLID'}]['24725538', '29039591', '30462564', '34232949', '29621181', '30351999', '26287849', '33117675']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for patients with BRAF V600E-positive melanoma, non-small cell lung cancer, and anaplastic thyroid cancer, and is NCCN-listed for patients with low-grade glioma, anaplastic glioma, and glioblastoma. Patients with various glioma subtypes harboring BRAF V600E mutations have shown responses to RAF and MEK inhibition. Three out of five patients with anaplastic astrocytoma had a response (one partial response, two stable disease) to vemurafenib monotherapy (PMID: 30351999). One patient with high-grade glioma (NOS) had stable disease in response to vemurafenib monotherapy (PMID:30351999). Four out of eight patients with glioma (NOS) had a response (one partial response, three stable disease, two progressive disease, two not evaluable) to vemurafenib monotherapy (PMID: 26287849). One patient with anaplastic oligoastrocytoma had stable disease in response to vemurafenib monotherapy (PMID: 30462564). Four of seven patients with glioblastoma multiforme had a response (one complete response, three stable disease, one progressive disease, two not evaluable) to vemurafenib monotherapy (PMID: 30351999, 24725538). Four patients with glioblastoma (including epithelioid glioblastoma) had a response (one near-complete response, three stable disease) to either dabrafenib monotherapy (n=2) or vemurafenib monotherapy (n=2) (PMID: 29621181, 29039591, 33117675, 34232949).284.0DIFGGrayDiffuse GliomaGliomaSOLIDCNS/BrainBRAIN2.0SOLID['V600E']Vemurafenib + CobimetinibLEVEL_2LEVEL_Fda3['25524464', '29039591', '31985841', '25092772', '31502039', '27398937', '29380516', '28984141', '24821190', '30351999', '26579623', '26287849']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for patients with melanoma, non-small cell lung cancer, and anaplastic thyroid cancer, and is NCCN-listed for patients with low-grade glioma, anaplastic glioma, and glioblastoma. Patients with various glioma subtypes harboring BRAF V600E mutations have shown responses to RAF and MEK inhibition. Six patients with ganglioglioma had a partial response to either vemurafenib monotherapy (n=2), vemurafenib + cobimetinib (n=1), or dabrafenib monotherapy (n=3)(PMID: 25524464, 31985841, 26579623, 31502039). Twelve out of thirteen patients with pleomorphic xanthoastrocytoma had a response (one complete response, one near-complete response, six partial response, four stable disease) to either dabrafenib + trametinib (n=2) or vemurafenib monotherapy (n=11) (PMID: 28984141, 26287849, 30351999). Three patients with anaplastic pleomorphic xanthoastrocytoma had a response (one complete response, one near-complete response, one partial response) to either vemurafenib monotherapy (n=1) or dabrafenib monotherapy (n=2)(PMID: 25092772, 29039591). One patient with low-grade glioma, NOS had a partial response to dabrafenib monotherapy (PMID: 27398937). Two patients with pilocytic astrocytoma had a response (one partial response, one stable disease) to vemurafenib monotherapy (PMID: 30351999). Three of four patients with anaplastic ganglioglioma had a response (one partial response, one "significant response", one stable disease, one not evaluable) to either dabrafenib + trametinib (n=1) or vemurafenib monotherapy (n=3)(PMID: 29380516, 30351999). One patient with pilomyxoid astrocytoma had a partial response to vemurafenib monotherapy (PMID: 24821190).277.0ENCGGrayEncapsulated GliomaGliomaSOLIDCNS/BrainBRAIN2.0SOLID['V600E']Vemurafenib + CobimetinibLEVEL_2LEVEL_Fda3['30120137', '29380516', '28984141']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for patients with melanoma, non-small cell lung cancer, and anaplastic thyroid cancer, and is NCCN-compendium listed as recommended treatment of central nervous system cancers such as pilocytic astrocytoma, pleomorphic xanthoastrocytoma (PXA) and ganglioglioma. In a case series of two patients with BRAF V600E-mutant PXA, combination treatment of dabrafenib with trametinib led to partial responses by RANO criteria in both patients (PMID: 28984141). In a case report of a sixteen-year-old female with BRAF V600E-mutant anaplastic ganglioglioma, dabrafenib and trametinib in combination led to a significant response that was maintained at least six months after treatment initiation (PMID: 29380516). In a separate case report of a 28-year-old man with BRAF V600E-mutant anaplastic ganglioglioma, combination treatment of vemurafenib and cobimetinib led to a complete response after three months, with no evidence of recurrence after sixteen months of treatment (PMID: 30120137).416.0PXAGrayPleomorphic XanthoastrocytomaGliomaSOLIDCNS/BrainENCG3.0SOLID['V600E']Vemurafenib + CobimetinibLEVEL_2LEVEL_Fda3['30120137', '29380516', '28984141']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for patients with melanoma, non-small cell lung cancer, and anaplastic thyroid cancer, and is NCCN-compendium listed as recommended treatment of central nervous system cancers such as pilocytic astrocytoma, pleomorphic xanthoastrocytoma (PXA) and ganglioglioma. In a case series of two patients with BRAF V600E-mutant PXA, combination treatment of dabrafenib with trametinib led to partial responses by RANO criteria in both patients (PMID: 28984141). In a case report of a sixteen-year-old female with BRAF V600E-mutant anaplastic ganglioglioma, dabrafenib and trametinib in combination led to a significant response that was maintained at least six months after treatment initiation (PMID: 29380516). In a separate case report of a 28-year-old man with BRAF V600E-mutant anaplastic ganglioglioma, combination treatment of vemurafenib and cobimetinib led to a complete response after three months, with no evidence of recurrence after sixteen months of treatment (PMID: 30120137).609.0GNGGrayGangliogliomaGliomaSOLIDCNS/BrainENCG3.0SOLID['V600E']Vemurafenib + CobimetinibLEVEL_2LEVEL_Fda3['30120137', '29380516', '28984141']The RAF inhibitor vemurafenib in combination with the MEK inhibitor cobimetinib is FDA-approved for patients with melanoma, non-small cell lung cancer, and anaplastic thyroid cancer, and is NCCN-compendium listed as recommended treatment of central nervous system cancers such as pilocytic astrocytoma, pleomorphic xanthoastrocytoma (PXA) and ganglioglioma. In a case series of two patients with BRAF V600E-mutant PXA, combination treatment of dabrafenib with trametinib led to partial responses by RANO criteria in both patients (PMID: 28984141). In a case report of a sixteen-year-old female with BRAF V600E-mutant anaplastic ganglioglioma, dabrafenib and trametinib in combination led to a significant response that was maintained at least six months after treatment initiation (PMID: 29380516). In a separate case report of a 28-year-old man with BRAF V600E-mutant anaplastic ganglioglioma, combination treatment of vemurafenib and cobimetinib led to a complete response after three months, with no evidence of recurrence after sixteen months of treatment (PMID: 30120137).452.0PASTGrayPilocytic AstrocytomaGliomaSOLIDCNS/BrainENCG3.0SOLID['V600']DabrafenibLEVEL_2LEVEL_Fda3['32985015', '29188284', '30154124']Vemurafenib is an orally available, small molecule RAF-targeted inhibitor that is FDA-approved for the treatment of patients with Erdheim-Chester disease (ECD) with BRAF V600 mutation. Vemurafenib and dabrafenib are listed as monotherapies in the NCCN Histiocytic Neoplasms Guidelines (V3.2024) under the section "Principles of Systemic Therapy" as recommended treatment regimens for patients with Langerhans cell histiocytosis (LCH) harboring BRAF V600E mutations. NCCN recommendation was based on the results of the Phase II VE-BASKET (NCT01524978) and case reports._In the Phase II VE-BASKET (NCT01524978) trial, all four patients of the LCH cohort achieved partial response (PMID: 29188284). In the case series evaluating the use of BRAF inhibitors in six adult patients with BRAF V600Emutant LCH, patients treated with vemurafenib monotherapy (n=3) achieved one complete response (CR), one partial response (PR) and one stable disease (SD) response while patients treated with dabrafenib monotherapy (n=3) achieved one CR and two PRs (PMID: 32985015). In a separate case report, a patient with BRAF V600E-mutant LCH was treated with dabrafenib plus trametinib and demonstrated a sustained metabolic response (PMID: 30154124).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['V600']VemurafenibLEVEL_3ALEVEL_Fda3['31376203', '31213430', '25209580']Vemurafenib is an orally available, small molecule RAF-targeted inhibitor that is FDA-approved for the treatment of patients with Erdheim-Chester disease (ECD) with BRAF V600 mutation. Vemurafenib and dabrafenib are listed as monotherapies in the NCCN Histiocytic Neoplasms Guidelines (V3.2024) under the section "Principles of Systemic Therapy" as recommended treatment regimens for patients with ECD and Langerhans cell histiocytosis (LCH) harboring BRAF V600E mutations. There is promising clinical data to support the use of vemurafenib and dabrafenib as monotherapies in patients with non-ECD and non-LCH BRAF V600-mutant histiocytic neoplasms._In a case study, a patient with heterozygous BRAF V600E-mutant histiocytic sarcoma was treated with vemurafenib and maintained both clinical and radiologic tumor responses for three months until disease progression (PMID: 25209580). In a second case study, a patient with BRAF V600E-mutant histiocytic sarcoma was treated with vemurafenib plus chemotherapy, antibiotics and steroids and remained in complete remission eighteen months after treatment initiation (PMID: 31376203). In a third case study, a pediatric patient with BRAF V600E-mutant mixed systemic Rosai-Dorfman-Destombes disease and LCH reported sustained clinical and radiographic responses after treatment with dabrafenib prior to disease relapse at thirteen months (PMID: 31213430).38.0LightSalmonHistiocytosisLIQUIDMyeloid0.0LIQUID['V600']DabrafenibLEVEL_3ALEVEL_Fda3['31376203', '31213430', '25209580']Vemurafenib is an orally available, small molecule RAF-targeted inhibitor that is FDA-approved for the treatment of patients with Erdheim-Chester disease (ECD) with BRAF V600 mutation. Vemurafenib and dabrafenib are listed as monotherapies in the NCCN Histiocytic Neoplasms Guidelines (V3.2024) under the section "Principles of Systemic Therapy" as recommended treatment regimens for patients with ECD and Langerhans cell histiocytosis (LCH) harboring BRAF V600E mutations. There is promising clinical data to support the use of vemurafenib and dabrafenib as monotherapies in patients with non-ECD and non-LCH BRAF V600-mutant histiocytic neoplasms._In a case study, a patient with heterozygous BRAF V600E-mutant histiocytic sarcoma was treated with vemurafenib and maintained both clinical and radiologic tumor responses for three months until disease progression (PMID: 25209580). In a second case study, a patient with BRAF V600E-mutant histiocytic sarcoma was treated with vemurafenib plus chemotherapy, antibiotics and steroids and remained in complete remission eighteen months after treatment initiation (PMID: 31376203). In a third case study, a pediatric patient with BRAF V600E-mutant mixed systemic Rosai-Dorfman-Destombes disease and LCH reported sustained clinical and radiographic responses after treatment with dabrafenib prior to disease relapse at thirteen months (PMID: 31213430).38.0LightSalmonHistiocytosisLIQUIDMyeloid0.0LIQUID25417114;20179705;23833300;26091043;26343582;12068308;30351999;25079552;28783719;19251651;1503598722608338;23051966;22735384;32758030;27283860;23020132;32818466;25399551;34838156;Bouffet et al. Abstract# LGG-49, Neuro-Oncology 2020.(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7715318);Bouffet et al. Abstract# LBA2002, ASCO 2022.(https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.17_suppl.LBA2002);29072975;37059834;37733309;31171876;28891408;31171878;31171879;25265492;25287827;29361468;28991513;28919011;29573941;35862871;37270692;31566309;39863775;40444708;Kopetz S., et al. Abstract#13. ASCO 2026.(https://ascopubs.org/doi/10.1200/JCO.2026.44.2_suppl.13);37978284;22663011;26287849;29188284;28961848;24508103;32534646;27480103;31732523;25265494;29431699;31151904;26352686;32985015;30154124;24725538;29039591;30462564;34232949;29621181;30351999;33117675;25524464;31985841;25092772;31502039;27398937;29380516;28984141;24821190;26579623;30120137;31376203;31213430;25209580LCH,HCLECD,ETPLL20519626;30157397;24938183;26637772;23347903;25480661;22072557;21910720;22210875;25120816;22028477;21663470;26071465;22531170;25422482;22237106100Tmissense_variantBRAF673GeneENST00000288602.6ENST00000288602.6:c.1799T>ANP_004324.2:p.Val600Glu12RS113488022/VAL600GLU/V640E/VAL640GLUhttps://civicdb.org/links/variants/12BRAF_V600E12NM_004333.4:c.1799T>A/NP_004324.2:p.Val600Glu/NC_000007.13:g.140453136A>T/ENST00000288602.6:c.1799T>ACA12364313961/376069
TUMORchr921967753N<DEL>PASSNM_000077stop_lost&feature_truncation&coding_sequence_variant&5_prime_UTR_variant&3_prime_UTR_variant&intron_variantHIGHCDKN2A1-3/31-2/2nandeletionv7.0LEVEL_Dx2LEVEL_Fda3False04/15/2025LEVEL_4-42059DELTrueTrueTrueLoss-of-functionOncogenicLEVEL_4.0/1GRCh38CDKN2AN<DEL>Nonstop_MutationINSN21967753MantaDEL:CDKN2A_DEL.GT:PR:SR0/1:28,19:11,8deletionENSG00000147889TranscriptENST00000304494protein_coding?-976-1HGNCHGNC:1787YESMANE_SelectNM_000077.51P2CCDS6510.1ENSP00000307101P42771.244K7PML8.75UPI0000047FDAP42771-1Ensembl10,10,122009812.False.Deletion of CDKN2A results in loss of the p16/INK4A and p14/ARF proteins. CDKN2A deletion has been found in head and neck squamous cell carcinoma, glioma, bladder carcinoma, leukemia and melanoma and is often associated with poorer clinical outcomes (PMID: 15495191, 26516359, 10999737). Deletion of CDKN2A in mouse models of malignant mesothelioma resulted in accelerated tumorigenesis compared to wildtype (PMID: 21526190). In addition, knockdown of CDKN2A in an HRAS G12V mouse model resulted in the induction of high-grade endometrial stromal sarcoma (PMID: 28982163)..CDKN2A, which encodes both a cyclin-dependent kinase inhibitor and an MDM2 inhibitor, is altered by mutation and deletion in various cancers...21526190|28982163|26516359|15495191|10999737..Deletion1029CDKN2AGRCh38.CNA..CDKN2A deletion is known to be oncogenic.FalseLEVEL_Fda3Deletion of CDKN2A results in loss of the p16/INK4A and p14/ARF proteins. CDKN2A deletion has been found in head and neck squamous cell carcinoma, glioma, bladder carcinoma, leukemia and melanoma and is often associated with poorer clinical outcomes (PMID: 15495191, 26516359, 10999737). Deletion of CDKN2A in mouse models of malignant mesothelioma resulted in accelerated tumorigenesis compared to wildtype (PMID: 21526190). In addition, knockdown of CDKN2A in an HRAS G12V mouse model resulted in the induction of high-grade endometrial stromal sarcoma (PMID: 28982163).['21526190', '28982163', '26516359', '15495191', '10999737']LEVEL_Dx2['Deletion']['23521501']This assertion is supported by (PMID: 23521501).895.0AMLBCRABL1LightSalmonAML with BCR-ABL1LeukemiaLIQUIDMyeloidAMLRGA5.0LIQUIDLEVEL_Dx2['Deletion']['18838613']This assertion is supported by (PMID: 18838613).580.0BLLLimeGreenB-Lymphoblastic Leukemia/LymphomaB-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidLNM3.0LIQUIDLEVEL_Dx2['Deletion']['18838613', '16079112']This assertion is supported by (PMID: 18838613, 16079112).597.0TLLLimeGreenT-Lymphoblastic Leukemia/LymphomaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidLNM3.0LIQUID['Oncogenic Mutations']PalbociclibLEVEL_4LEVEL_Fda3['19874578', '24495407', '25941111', '29232554', '39413339', '28283584']Palbociclib, ribociclib, and abemaciclib are selective small molecule inhibitors of CDK4 and CDK6 (PMID: 25941111). There are laboratory and anecdotal clinical data to support use of palbociclib, ribociclib, and abemaciclib monotherapies in patients with CDKN2A-mutated solid tumors. _In a retrospective study of patients with uterine leiomyosarcoma, a patient harboring a CDKN2A mutation experienced stable disease and significant symptom reduction upon treatment with palbociclib (PMID: 28283584). In the Phase II TAPUR (NCT02693535) trial of palbociclib in 28 patients with head and neck cancer harboring CDKN2A mutations, the objective response rate was 4% (95% CI=<1-18) and the disease control rate was 40% (one-sided 90% CI=27-100) (PMID: 39413339)._In vitro studies of cancer cell lines with CDKN2A loss demonstrated that they are sensitive to CDK4/6 inhibition as measured by growth arrest upon drug treatment (PMID: 29232554). In a panel of melanoma and estrogen receptor-positive breast cancer cell lines, CDKN2A loss was found among cells with the highest sensitivity to palbociclib (PMID: 19874578, 24495407).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']RibociclibLEVEL_4LEVEL_Fda3['19874578', '24495407', '25941111', '29232554', '39413339', '28283584']Palbociclib, ribociclib, and abemaciclib are selective small molecule inhibitors of CDK4 and CDK6 (PMID: 25941111). There are laboratory and anecdotal clinical data to support use of palbociclib, ribociclib, and abemaciclib monotherapies in patients with CDKN2A-mutated solid tumors. _In a retrospective study of patients with uterine leiomyosarcoma, a patient harboring a CDKN2A mutation experienced stable disease and significant symptom reduction upon treatment with palbociclib (PMID: 28283584). In the Phase II TAPUR (NCT02693535) trial of palbociclib in 28 patients with head and neck cancer harboring CDKN2A mutations, the objective response rate was 4% (95% CI=<1-18) and the disease control rate was 40% (one-sided 90% CI=27-100) (PMID: 39413339)._In vitro studies of cancer cell lines with CDKN2A loss demonstrated that they are sensitive to CDK4/6 inhibition as measured by growth arrest upon drug treatment (PMID: 29232554). In a panel of melanoma and estrogen receptor-positive breast cancer cell lines, CDKN2A loss was found among cells with the highest sensitivity to palbociclib (PMID: 19874578, 24495407).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']AbemaciclibLEVEL_4LEVEL_Fda3['19874578', '24495407', '25941111', '29232554', '39413339', '28283584']Palbociclib, ribociclib, and abemaciclib are selective small molecule inhibitors of CDK4 and CDK6 (PMID: 25941111). There are laboratory and anecdotal clinical data to support use of palbociclib, ribociclib, and abemaciclib monotherapies in patients with CDKN2A-mutated solid tumors. _In a retrospective study of patients with uterine leiomyosarcoma, a patient harboring a CDKN2A mutation experienced stable disease and significant symptom reduction upon treatment with palbociclib (PMID: 28283584). In the Phase II TAPUR (NCT02693535) trial of palbociclib in 28 patients with head and neck cancer harboring CDKN2A mutations, the objective response rate was 4% (95% CI=<1-18) and the disease control rate was 40% (one-sided 90% CI=27-100) (PMID: 39413339)._In vitro studies of cancer cell lines with CDKN2A loss demonstrated that they are sensitive to CDK4/6 inhibition as measured by growth arrest upon drug treatment (PMID: 29232554). In a panel of melanoma and estrogen receptor-positive breast cancer cell lines, CDKN2A loss was found among cells with the highest sensitivity to palbociclib (PMID: 19874578, 24495407).5.0All Solid TumorsSOLID-1.0SOLID21526190;28982163;26516359;15495191;10999737Palbociclib,Ribociclib,Abemaciclib28,1911,8
TUMORp.Gln209=ENSP00000286548.4:p.Gln209=chr977794572ATPASSNM_002072synonymous_variantLOWGNAQ5/7nanCOSV54105903&COSV54105914&COSV54108414SNV8.1800e-01v7.0..False06/30/2020.TrueTrueFalseUnknownUnknown55,280/10.3373493975903614GRCh38GNAQATSilentSNPA77794572GNAQ_Q209L.GT:AD:AF:DP0/1:55,28:0.34:83TENSG00000156052TranscriptENST00000286548protein_coding1202626209QcAa/cAa-1HGNCHGNC:4390YESMANE_SelectNM_002072.51P1CCDS6658.1ENSP00000286548P50148.216A0A024R240.65UPI000006D0FBEnsemblAT1PDB-ENSP_mappings:6vu5.B&PDB-ENSP_mappings:7dfl.A&PDB-ENSP_mappings:7ezm.A&PDB-ENSP_mappings:7f6g.B&PDB-ENSP_mappings:7f6h.B&PDB-ENSP_mappings:7f6i.B&PDB-ENSP_mappings:7f8w.A&PDB-ENSP_mappings:7w3z.B&PDB-ENSP_mappings:7w40.B&PDB-ENSP_mappings:7xow.A&PDB-ENSP_mappings:8ia7.A&PDB-ENSP_mappings:8iys.A&PDB-ENSP_mappings:8jpb.Q&PDB-ENSP_mappings:8jpc.Q&PDB-ENSP_mappings:8jpe.Q&PDB-ENSP_mappings:8szg.C&PDB-ENSP_mappings:8uqn.A&PDB-ENSP_mappings:8uqo.A&PDB-ENSP_mappings:8zjd.A&PDB-ENSP_mappings:8zje.A&SMART:SM00275&PROSITE_profiles:PS51882&Superfamily:SSF52540&PANTHER:PTHR10218&Gene3D:3.40.50.300&Pfam:PF00503&Prints:PR00318&CDD:cd00066&AFDB-ENSP_mappings:AF-P50148-F11&1&11&1&1.False...GNAQ, a G protein subunit, is recurrently mutated in uveal melanoma......Q209=2776GNAQGRCh38.MUTATION..This is a synonymous mutation and is not annotated by OncoKB.False.83
TUMORp.R130*ENSP00000361021.3:p.Arg130Terchr1087933147CTPASSNM_000314stop_gainedHIGHPTEN5/9c.388C>Trs121909224&CM094223&CM971273&COSV64288384&COSV64288463&COSV64297940&COSV64311187SNV2.737e-063.827e-05gnomADe_ASJ0.000.000.000.006.8500e-01Cowden_syndrome_1&Familial_prostate_cancer&Glioma_susceptibility_2&Familial_meningioma&Macrocephaly-autism_syndrome&PTEN-related_disorder&Prostate_cancer&Gastric_cancer&Cowden_syndrome&Rhabdomyosarcoma&Hereditary_cancer-predisposing_syndrome&not_provided&Ovarian_neoplasm&PTEN_hamartoma_tumor_syndrome&Abnormal_cardiovascular_system_morphologyNC_000010.11:g.87933147C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenicOncogeniccriteria_provided&_single_submitter43no_assertion_criteria_providedTier_I_-_StrongPTENR130*chr10:87933147-87933147v7.0LEVEL_Dx3LEVEL_Fda2False11/08/2024LEVEL_1TrueTrueTrueLoss-of-functionOncogenicCapivasertib+FulvestrantLEVEL_1LEVEL_1LEVEL_Dx364,510/1R130*0.4434782608695652GRCh38PTENCTNonsense_MutationSNPC87933147PTEN_R130stop.GT:AD:AF:DP0/1:64,51:0.44:115TENSG00000171862TranscriptENST00000371953protein_coding1233388130R/*Cga/Tga1HGNCHGNC:9588YESMANE_SelectNM_000314.81P1CCDS31238.1ENSP00000361021P60484.218F6KD01.101UPI00001328C5P60484-1EnsemblCC1PDB-ENSP_mappings:1d5r.A&PDB-ENSP_mappings:5bug.A&PDB-ENSP_mappings:5bug.B&PDB-ENSP_mappings:5bug.C&PDB-ENSP_mappings:5bug.D&PDB-ENSP_mappings:5bzx.A&PDB-ENSP_mappings:5bzx.B&PDB-ENSP_mappings:5bzx.C&PDB-ENSP_mappings:5bzx.D&PDB-ENSP_mappings:5bzz.A&PDB-ENSP_mappings:5bzz.B&PDB-ENSP_mappings:5bzz.C&PDB-ENSP_mappings:5bzz.D&PDB-ENSP_mappings:7jtx.A&PDB-ENSP_mappings:7juk.A&PDB-ENSP_mappings:7jul.A&PDB-ENSP_mappings:7jvx.A&PANTHER:PTHR12305&PROSITE_profiles:PS50056&PROSITE_profiles:PS51181&PROSITE_patterns:PS00383&Pfam:PF22785&Gene3D:3.90.190.10&PIRSF:PIRSF038025&SMART:SM01301&SMART:SM00404&Superfamily:SSF52799&CDD:cd14509&AFDB-ENSP_mappings:AF-P60484-F102.236e-053.827e-050001.799e-0600pathogenic&likely_pathogenic0&1&1&1&1&1&11&1&1&1&1&1&123757202&27535533&25157968&26619011&21824802&28526761&9259288&10923032&11504908&20085938&21194675&23335809&9856571&11274365&17286265&18767981&21956414&22266152&23470840&9915974&9467011&34247193&33105631&29784605&35117297FAIL27-26-188PTEN78190.0000122858MONDO:MONDO:0008021&MedGen:CN072330&OMIM:158350&MONDO:MONDO:0700275&MedGen:C2931456&OMIM:176807&Orphanet:1331&MONDO:MONDO:0013092&MedGen:C2751642&OMIM:613028&Orphanet:182067&MONDO:MONDO:0011789&MedGen:C3551915&OMIM:607174&Orphanet:263662&MONDO:MONDO:0011537&MedGen:C1854416&OMIM:605309&Orphanet:210548&.&Human_Phenotype_Ontology:HP:0012125&MONDO:MONDO:0008315&MedGen:C0376358&Orphanet:1331&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&MONDO:MONDO:0016063&MedGen:C0018553&OMIM:PS158350&Orphanet:201&Human_Phenotype_Ontology:HP:0002859&MONDO:MONDO:0005212&MeSH:D012208&MedGen:C0035412&Orphanet:780&MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MedGen:C3661900&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&MONDO:MONDO:0017623&MeSH:D006223&MedGen:C1959582&Orphanet:306498&Human_Phenotype_Ontology:HP:0001632&Human_Phenotype_Ontology:HP:0002564&Human_Phenotype_Ontology:HP:0002565&Human_Phenotype_Ontology:HP:0030680&MedGen:C4049796SCV000187267&SCV000222110&SCV000253832&SCV000579271&SCV000604969&SCV000967757&SCV001134775&SCV001249159&SCV001340966&SCV001428573&SCV001448140&SCV001448935&SCV001760260&SCV002059850&SCV002061182&SCV002525581&SCV002576484&SCV002580289&SCV002793214&SCV003761297&SCV003841764&SCV004019961&SCV004032474&SCV004175664&SCV004207132&SCV005398854&SCV005685289&SCV005900566&SCV006059506&SCV006075390&SCV006099449&SCV006302678&SCV007107203&SCV007126383&SCV007449257&SCV007496233single_nucleotide_variantSO:0001483ClinGen:CA000433&OMIM:601728.0007PTEN:5728SO:0001587&nonsense&SO:0001623&5_prime_UTR_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094204121909224Colorectal_cancerMONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500SCV00607688110:87933147-879331471PTENp.R130*.False.The PTEN R130* mutation is located in the phosphatase domain of the protein. This mutation has been found in glioblastoma, endometrial cancer, prostate cancer and colorectal cancer (PMID: 28572459). Expression of this mutation in endometrial cells demonstrated that it is inactivating as measured by in vivo tumor formation in a xenograft model (PMID: 24721394). PTEN R130* leads to loss of PTEN function as measured by yeast gene interaction assay, by altered developmental rate in Drosophila, by changes in rat neural development and by becoming a dominant negative regulator of the PI3-AKT signaling pathway (PMID: 32350270)..PTEN, a lipid and protein phosphatase, is one of the most frequently mutated genes in cancer...32350270|28572459|24721394..R130*5728PTENGRCh38.MUTATION..The PTEN R130* mutation is known to be oncogenic.FalseLEVEL_Fda2The PTEN R130* mutation is located in the phosphatase domain of the protein. This mutation has been found in glioblastoma, endometrial cancer, prostate cancer and colorectal cancer (PMID: 28572459). Expression of this mutation in endometrial cells demonstrated that it is inactivating as measured by in vivo tumor formation in a xenograft model (PMID: 24721394). PTEN R130* leads to loss of PTEN function as measured by yeast gene interaction assay, by altered developmental rate in Drosophila, by changes in rat neural development and by becoming a dominant negative regulator of the PI3-AKT signaling pathway (PMID: 32350270).['32350270', '28572459', '24721394']LEVEL_Dx3['Oncogenic Mutations']['19458356', '22491738', '19340001']This assertion is supported by (PMID: 22491738, 19340001, 19458356).597.0TLLLimeGreenT-Lymphoblastic Leukemia/LymphomaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidLNM3.0LIQUID['Oncogenic Mutations']Capivasertib + FulvestrantLEVEL_1LEVEL_Fda2['37256976']Capivasertib, an orally available, ATP-competitive pan-AKT inhibitor, is FDA-approved with fulvestrant for the treatment of patients with PTEN-mutant ER+/HER2- metastatic breast cancer. FDA approval was based on the results of the Phase III CAPItello-291 trial of capivasertib plus fulvestrant in adult patients with or without AKT pathway-altered (PIK3CA, AKT1 or PTEN) ER+/HER2- advanced breast cancer. Of the patients with only PIK3CA, AKT1 or PTEN-mutant tumors (n=289), the capivasertib plus fulvestrant group (n=155) demonstrated an objective response rate of 26% (95% CI=19, 34), with a 2.3% complete response rate and 23% partial response rate, and a median progression-free survival of 7.3 months (95% CI=5.5, 9.0) whereas the placebo plus fulvestrant group (n=134) demonstrated an objective response rate of 8% (95% CI=4, 14), with a 8% partial response rate, and a median progression-free survival of 3.1 months (95% CI=2.0, 3.7) (HR=0.50 [95% CI=0.38, 0.65], P<0.0001) (PMID: 37256976). Of all patients, including patients with wildtype tumors and patients with PIK3CA, AKT1 or PTEN-mutant tumors (n=708), the capivasertib plus fulvestrant group (n=355) demonstrated a median progression-free survival of 7.2 months (95% CI=5.5, 7.4) whereas the placebo plus fulvestrant group (n=353) demonstrated a median progression-free survival of 3.6 months (95% CI=2.8, 3.7) (HR=0.60 [95% CI=0.51, 0.71], P<0.001) (PMID: 37256976).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Oncogenic Mutations']GSK2636771LEVEL_4LEVEL_Fda3['28645941', '34281912'][{'abstract': 'Hansen et al. Abstract# 2570, ASCO 2017.', 'link': 'http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2570'}]GSK2636771 and AZD8186 are ATP-competitive small molecule inhibitors of PI3K. In a phase I clinical trial of GSK2636771 in PTEN-deficient advanced solid tumors, 11 (17%) of 65 patients experienced durable clinical benefit (>24 weeks), with 1 patient with castration-resistant prostate cancer having a partial response for over one year (PMID: 28645941). In a different Phase I trial of GSK2636771 plus enzalutamide in 36 patients with PTEN-deficient metastatic castration-resistant prostate cancer, the 12-week non-progressive disease rate was 50% (95% CI: 28.271.8, n = 22) in patients receiving 200mg of GSK2636771 daily, with 1 (3%) patient achieving a radiographic partial response lasting 36 weeks (PMID: 34281912). In a Phase I clinical trial of AZD8186 in 87 patients with advanced solid tumors, partial responses were seen in one patient with castration-resistant prostate cancer who was also treated in combination with vistusertib, a dual mTORC1/2 inhibitor, and in another patient with PTEN-deficient colorectal cancer (Abstract: Hansen et al. Abstract# 2570, ASCO 2017. http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2570).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']AZD8186LEVEL_4LEVEL_Fda3['28645941', '34281912'][{'abstract': 'Hansen et al. Abstract# 2570, ASCO 2017.', 'link': 'http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2570'}]GSK2636771 and AZD8186 are ATP-competitive small molecule inhibitors of PI3K. In a phase I clinical trial of GSK2636771 in PTEN-deficient advanced solid tumors, 11 (17%) of 65 patients experienced durable clinical benefit (>24 weeks), with 1 patient with castration-resistant prostate cancer having a partial response for over one year (PMID: 28645941). In a different Phase I trial of GSK2636771 plus enzalutamide in 36 patients with PTEN-deficient metastatic castration-resistant prostate cancer, the 12-week non-progressive disease rate was 50% (95% CI: 28.271.8, n = 22) in patients receiving 200mg of GSK2636771 daily, with 1 (3%) patient achieving a radiographic partial response lasting 36 weeks (PMID: 34281912). In a Phase I clinical trial of AZD8186 in 87 patients with advanced solid tumors, partial responses were seen in one patient with castration-resistant prostate cancer who was also treated in combination with vistusertib, a dual mTORC1/2 inhibitor, and in another patient with PTEN-deficient colorectal cancer (Abstract: Hansen et al. Abstract# 2570, ASCO 2017. http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2570).5.0All Solid TumorsSOLID-1.0SOLID32350270;28572459;24721394GSK2636771,AZD818637256976;28645941;34281912;Hansen et al. Abstract# 2570, ASCO 2017.(http://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2570)TLL19458356;22491738;19340001115Tstop_gainedPTEN5728GeneENST00000371953.3ENST00000371953.3:c.388C>TNP_000305.3:p.Arg130Ter636R130X/ARG130TER/RS121909224https://civicdb.org/links/variants/636PTEN_R130*632NM_000314.6:c.388C>T/NP_000305.3:p.Arg130Ter/ENST00000371953.3:c.388C>T/NC_000010.10:g.89692904C>TCA0004337819
TUMORp.G13DENSP00000308495.3:p.Gly13Aspchr1225245347CTPASSNM_004985missense_variantMODERATEKRAS2/5c.38G>Ars112445441&CM125166&COSV55497357&COSV55497388&COSV55522580SNVdeleterious_low_confidence(0.04)1.369e-061.971e-054.41e-05gnomADg_NFE0.010.000.000.000.8322.6400e-01KRAS-related_disorder&OCULOECTODERMAL_SYNDROME&_SOMATIC&Noonan_syndrome_and_Noonan-related_syndrome&Inborn_genetic_diseases&Familial_pancreatic_carcinoma&Encephalocraniocutaneous_lipomatosis&RASopathy&not_provided&Nevus_sebaceous&Non-small_cell_lung_carcinoma&Autoimmune_lymphoproliferative_syndrome_type_4&Breast_adenocarcinoma&Juvenile_myelomonocytic_leukemiaNC_000012.12:g.25245347C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongKRASG13Dchr12:25245347-25245347v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot05/13/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAvutometinib+DefactinibCobimetinib,TrametinibCobimetinib,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_1LEVEL_R1LEVEL_Dx280,310/1G13D0.27927927927927926GRCh38KRASCTMissense_MutationSNPC25245347KRAS_G13D.GT:AD:AF:DP0/1:80,31:0.28:111TENSG00000133703TranscriptENST00000311936protein_coding2283813G/DgGc/gAc-1HGNCHGNC:6407YESMANE_SelectNM_004985.51P4CCDS8702.1ENSP00000308495P01116.262UPI0000001252P01116-2EnsemblCC1Gene3D:3.40.50.300&AFDB-ENSP_mappings:AF-P01116-F1&Pfam:PF00071&Prints:PR00449&PROSITE_profiles:PS51419&PROSITE_profiles:PS51420&PROSITE_profiles:PS51421&PANTHER:PTHR24070&SMART:SM00173&SMART:SM00174&SMART:SM00175&Superfamily:SSF52540&NCBIFAM:TIGR00231&CDD:cd04138&Low_complexity_(Seg):seg0000001.8e-060000000004.41e-0500uncertain_significance&pathogenic&likely_pathogenic&not_provided0&1&1&1&11&1&1&1&124033266&22992668&26900293&2278970&3122217&12460918&16434492&19075190&22407852&25157968&17332249&17384584&18794081&32550823&19018267&21975775&19255327&19773371&23406027&15696205&16361624&16618717&18316791&19114683&19679400&20921462&20921465&21228335&3627975&19794967&21063026&21398618&22392911&22734028&23071293&23090619&23182985&24558511&24628546&25808193&26371285&26623049&33076847&36061173&31117243&34737598&37232746&28708103&35117297&36866106&32934698&39001385FAIL48-44-148KRAS1258027619.&.&MONDO:MONDO:0020297&MedGen:C5681679&Orphanet:98733&MeSH:D030342&MedGen:C0950123&MONDO:MONDO:0015278&MedGen:C2931038&OMIM:260350&Orphanet:1333&MONDO:MONDO:0013074&MedGen:C0406612&OMIM:613001&Orphanet:2396&MONDO:MONDO:0021060&MedGen:C5555857&Orphanet:536391&MedGen:C3661900&Human_Phenotype_Ontology:HP:0010815&MedGen:C3854181&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&MONDO:MONDO:0013767&MedGen:C2674723&OMIM:614470&Orphanet:268114&MONDO:MONDO:0004988&MedGen:C0858252&Human_Phenotype_Ontology:HP:0012209&MONDO:MONDO:0011908&MedGen:C0349639&OMIM:607785&Orphanet:86834SCV000061938&SCV001248878&SCV001444340&SCV001737088&SCV002016398&SCV002060774&SCV002117438&SCV005438357single_nucleotide_variantSO:0001483ClinGen:CA122534&OMIM:190070.0003&UniProtKB:P01116#VAR_016029KRAS:3845SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094256112445441Adenocarcinoma_of_the_large_intestine&Diffuse_midline_glioma&_H3_K27M-mutant&Embryonal_rhabdomyosarcoma&Colorectal_cancerHuman_Phenotype_Ontology:HP:0040275&MONDO:MONDO:0005008&MedGen:C1319315&MONDO:MONDO:0957196&MedGen:C4289688&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500SCV007105395&SCV00710540812:25245347-252453471KRASp.G13D.True.The KRAS G13D mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in colorectal and lung cancer (PMID: 28572459). Expression of this mutation in colorectal cancer cell lines demonstrated that it is activating, as shown by increased protein activation, downstream pathway activation, colony formation and in vivo tumor formation compared to wildtype (PMID: 22722830, 26037647, 20147967, 32792368)..KRAS, a GTPase which functions as an upstream regulator of the MAPK pathway, is frequently mutated in various cancer types including lung, colorectal and pancreatic cancers...28572459|22722830|32792368|20147967|26037647..G13D3845KRASGRCh38.MUTATIONLEVEL_R1.The KRAS G13D mutation is known to be oncogenic.FalseLEVEL_Fda2The KRAS G13D mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in colorectal and lung cancer (PMID: 28572459). Expression of this mutation in colorectal cancer cell lines demonstrated that it is activating, as shown by increased protein activation, downstream pathway activation, colony formation and in vivo tumor formation compared to wildtype (PMID: 22722830, 26037647, 20147967, 32792368).['28572459', '22722830', '32792368', '20147967', '26037647']LEVEL_Dx2['Oncogenic Mutations']['10049057', '23832011', '25691160', '26457647', '12717436']This assertion is supported by (PMID: 10049057, 23832011, 26457647, 12717436, PMID: 25691160).813.0JMMLLightSalmonJuvenile Myelomonocytic LeukemiaMyelodysplastic/Myeloproliferative NeoplasmsLIQUIDMyeloidMDS/MPN4.0LIQUIDLEVEL_Dx2['Oncogenic Mutations']['22934674', '23512829']This assertion is supported by (PMID: 23512829, 22934674).505.0MDSLightSalmonMyelodysplastic SyndromesMyelodysplastic SyndromesLIQUIDMyeloidMNM3.0LIQUIDLEVEL_Dx3['Oncogenic Mutations']['22237106']This assertion is supported by (PMID: 22237106).757.0ETPLLLimeGreenEarly T-Cell Precursor Lymphoblastic LeukemiaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidTLL4.0LIQUID['Oncogenic Mutations']CetuximabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']Tucatinib + TrastuzumabLEVEL_R1LEVEL_Fda2['30857956']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Patients with metastatic colorectal cancer harboring KRAS mutations do not respond favorably to trastuzumab as seen in the MyPath trial. In the multiple basket MyPath Phase IIa trial of pertuzumab and trastuzumab in which 56 metastatic colorectal cancer patients with HER2 amplification received combination therapy, the objective response rate for patients with KRAS wildtype colorectal cancer (43/56 patients) compared to KRAS mutated colorectal cancer (13/56 patients) was 40% (17/43, 95% CI, 25%56%) versus 8% (1/13, 95% CI 0.2%36%), respectively (PMID: 30857956).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']PanitumumabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']Avutometinib + DefactinibLEVEL_1LEVEL_Fda2['40644648']Avutometinib, a RAF/MEK clamp inhibitor, and defactinib, a FAK inhibitor, are FDA-approved in combination for the treatment of adult patients with KRAS-mutated recurrent low-grade serous ovarian cancer (LGSOC) who have received prior systemic therapy. FDA approval was based on the results of the Phase II RAMP-201 (NCT04625270) trial of avutometinib plus defactinib in 109 patients with recurrent LGSOC._In the Phase II RAMP-201 (NCT04625270) trial, patients with KRAS-mutated LGSOC (n=57) demonstrated an overall response rate (ORR) of 44% (n=25), with a 2% (n=2) complete response (CR) rate, 40% (n=23) partial response (PR) rate and 49% (n=28) stable disease (SD) rate, a median duration of response (DOR) of 31.0 months (95% CI=14.8-31.1) and a median progression-free survival (PFS) of 22.0 months (95% CI=11.1-36.6) (PMID: 40644648). Responders included patients with the following KRAS mutations: KRAS A146V, G12D, G12R, G12V and Q61H (PMID: 40644648). Of patients with KRAS wildtype LGSOC (n=52), the cohort demonstrated an ORR of 17% (n=9), with a 17% (n=9) PR rate and 65% (n=34) SD rate, and a median PFS of 9.2 months (95% CI=5.5-NE) (PMID: 40644648).796.0LGSOCLightBlueLow-Grade Serous Ovarian CancerOvarian CancerSOLIDOvary/Fallopian TubeSOC4.0SOLID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).854.0ECDLightSalmonErdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).855.0RDDLightSalmonRosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).854.0ECDLightSalmonErdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).855.0RDDLightSalmonRosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']CobimetinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).38.0LightSalmonHistiocytosisLIQUIDMyeloid0.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).38.0LightSalmonHistiocytosisLIQUIDMyeloid0.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']CobimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']BinimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).5.0All Solid TumorsSOLID-1.0SOLID28572459;22722830;32792368;20147967;26037647Trametinib,Cobimetinib,Binimetinib20921465;21228335;20619739;24024839;18316791;30857956;40644648;30867592;32991018;29236635;30361829;33933896;25435214;24746704;23934108JMML,MDSETPLL10049057;23832011;25691160;26457647;12717436;22934674;23512829;22237106111Tmissense_variantKRAS3845GeneENST00000256078.4ENST00000256078.4:c.38G>ANP_004976.2:p.Gly13Asp81GLY13ASP/RS112445441https://civicdb.org/links/variants/81KRAS_G13D81NM_033360.3:c.38G>A/NP_004976.2:p.Gly13Asp/NC_000012.11:g.25398281C>T/ENST00000256078.4:c.38G>ACA12253412580
TUMORp.G12DENSP00000308495.3:p.Gly12Aspchr1225245350CTPASSNM_004985missense_variantMODERATEKRAS2/5c.35G>Ars121913529&COSV55497369&COSV55497419&COSV55497479SNVdeleterious_low_confidence(0.04)2.739e-061.314e-052.94e-05gnomADg_NFE0.010.000.000.000.8752.6400e-01Congenital_Pulmonary_Airway_Malformations&Lung_cancer&Gastric_cancer&Acute_myeloid_leukemia&Linear_nevus_sebaceous_syndrome&Noonan_syndrome_3&Familial_pancreatic_carcinoma&Cardiofaciocutaneous_syndrome_2&Autoimmune_lymphoproliferative_syndrome_type_4&Malignant_tumor_of_urinary_bladder&Cerebral_arteriovenous_malformation&Toriello-Lacassie-Droste_syndrome&Familial_cancer_of_breast&Atypical_endometrial_hyperplasia&Endometrial_hyperplasia_without_atypia&Primary_low_grade_serous_adenocarcinoma_of_ovary&Vascular_Tumors_Including_Pyogenic_Granuloma&Encephalocraniocutaneous_lipomatosis&Cardiovascular_phenotype&not_provided&RASopathy&Nevus_sebaceous&Ovarian_neoplasm&Carcinoma_of_pancreas&Epidermal_nevus&Capillary_malformation-arteriovenous_malformation_1&Non-small_cell_lung_carcinoma&Juvenile_myelomonocytic_leukemiaNC_000012.12:g.25245350C>Tcriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenicOncogeniccriteria_provided&_single_submitter35criteria_provided&_single_submitterTier_I_-_StrongKRASG12Dchr12:25245350-25245350v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot05/13/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAvutometinib+DefactinibCobimetinib,TrametinibCobimetinib,Daraxonrasib,Setidegrasib,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_1LEVEL_R1LEVEL_Dx278,420/1G12D0.35GRCh38KRASCTMissense_MutationSNPC25245350KRAS_G12D.GT:AD:AF:DP0/1:78,42:0.35:120TENSG00000133703TranscriptENST00000311936protein_coding2253512G/DgGt/gAt-1HGNCHGNC:6407YESMANE_SelectNM_004985.51P4CCDS8702.1ENSP00000308495P01116.262UPI0000001252P01116-2EnsemblCC1Gene3D:3.40.50.300&AFDB-ENSP_mappings:AF-P01116-F1&Pfam:PF00071&Prints:PR00449&PROSITE_profiles:PS51419&PROSITE_profiles:PS51420&PROSITE_profiles:PS51421&PANTHER:PTHR24070&SMART:SM00173&SMART:SM00174&SMART:SM00175&Superfamily:SSF52540&NCBIFAM:TIGR00231&CDD:cd04138&Low_complexity_(Seg):seg0000002.7e-061.658e-05000000002.94e-0500association&pathogenic/likely_pathogenic&pathogenic&likely_pathogenic&not_provided0&1&1&11&1&1&126900293&2278970&3122217&12460918&16434492&19075190&22407852&22499344&25032700&25157968&29525983&17332249&21079152&17384584&18794081&19047918&22235099&19029981&32550823&19018267&21975775&17704260&19255327&19773371&22683711&23406027&15696205&16361624&16618717&18316791&19114683&19679400&20921462&20921465&21228335&32000721&19794967&21398618&23182985&7773929&8439212&15842656&17910045&19358724&19881948&20609353&20805368&20949522&21169357&22025163&22282465&22897852&23014527&25044103&26372703&33076847&32175330&31949278&33174010&37160318&30463544&32770181&31117243&31836588&34737598&34381078&37232746&27872090&28708103&35117297&33832922&34027089&29721857&26071483&36761421&34117074&36866106&35753820&33254149&35638910&28611940&35582142&29298116&37713191&37384296&37546424&38310289&37164664&39001385&38773265FAIL459-445KRAS125820.0000227621.&MONDO:MONDO:0008903&MedGen:C0242379&OMIM:211980&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&Human_Phenotype_Ontology:HP:0001914&Human_Phenotype_Ontology:HP:0004808&Human_Phenotype_Ontology:HP:0004843&Human_Phenotype_Ontology:HP:0005516&Human_Phenotype_Ontology:HP:0006724&Human_Phenotype_Ontology:HP:0006728&MONDO:MONDO:0018874&MeSH:D015470&MedGen:C0023467&OMIM:601626&Orphanet:519&Human_Phenotype_Ontology:HP:0010817&MONDO:MONDO:0008097&MedGen:C4552097&OMIM:163200&Orphanet:2612&MONDO:MONDO:0012371&MedGen:C1860991&OMIM:609942&Orphanet:648&MONDO:MONDO:0015278&MedGen:C2931038&OMIM:260350&Orphanet:1333&MONDO:MONDO:0014112&MedGen:C3809005&OMIM:615278&Orphanet:1340&MONDO:MONDO:0013767&MedGen:C2674723&OMIM:614470&Orphanet:268114&MONDO:MONDO:0001187&MedGen:C0005684&OMIM:109800&Human_Phenotype_Ontology:HP:0002408&MONDO:MONDO:0007154&MedGen:C0917804&OMIM:108010&Orphanet:46724&MONDO:MONDO:0010854&MedGen:C1838329&OMIM:600268&Orphanet:3339&MONDO:MONDO:0016419&MedGen:C0346153&OMIM:114480&Orphanet:227535&MONDO:MONDO:0006096&MedGen:C0349579&MONDO:MONDO:0006193&MedGen:C1516855&MedGen:C4302356&.&MONDO:MONDO:0013074&MedGen:C0406612&OMIM:613001&Orphanet:2396&MedGen:CN230736&MedGen:C3661900&MONDO:MONDO:0021060&MedGen:C5555857&Orphanet:536391&Human_Phenotype_Ontology:HP:0010815&MedGen:C3854181&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&MONDO:MONDO:0005192&MedGen:C0235974&Orphanet:1333&Orphanet:217074&Human_Phenotype_Ontology:HP:0010816&MONDO:MONDO:0008093&MedGen:C0334082&OMIM:162900&Orphanet:79414&MONDO:MONDO:0020783&MedGen:C4747394&OMIM:608354&Orphanet:137667&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&Human_Phenotype_Ontology:HP:0012209&MONDO:MONDO:0011908&MedGen:C0349639&OMIM:607785&Orphanet:86834SCV000329383&SCV000659085&SCV001736991&SCV002318898&SCV002525678&SCV002601600&SCV002821689&SCV004176950&SCV005023563&SCV005044128&SCV005414064&SCV005634967&SCV006304919single_nucleotide_variantSO:0001483ClinGen:CA122538&OMIM:190070.0005&OMIM:190070.0025&UniProtKB:P01116#VAR_016026KRAS:3845SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094257121913529Diffuse_midline_glioma&_H3_K27M-mutant&Ovarian_mucinous_adenocarcinoma&Medulloblastoma_non-WNT/non-SHH&Adenocarcinoma_of_the_large_intestine&Diffuse_pediatric-type_high-grade_glioma&_H3-wildtype_and_IDH-wildtype&Embryonal_rhabdomyosarcoma&Colorectal_cancer&Glioma&Alveolar_rhabdomyosarcoma&Papillary_thyroid_carcinoma&Precursor_B-cell_acute_lymphoblastic_leukemiaMONDO:MONDO:0957196&MedGen:C4289688&MONDO:MONDO:0005601&MedGen:C1335167&Orphanet:398961&MONDO:MONDO:0850198&MedGen:C4330667&Human_Phenotype_Ontology:HP:0040275&MONDO:MONDO:0005008&MedGen:C1319315&MONDO:MONDO:0858939&MedGen:C5669918&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500&Human_Phenotype_Ontology:HP:0009733&MONDO:MONDO:0021042&MeSH:D005910&MedGen:C0017638&Orphanet:182067&Human_Phenotype_Ontology:HP:0006779&MONDO:MONDO:0009994&MedGen:C0206655&OMIM:268220&Orphanet:780&Orphanet:99756&Human_Phenotype_Ontology:HP:0002895&MONDO:MONDO:0005075&MeSH:D000077273&MedGen:C0238463&Orphanet:146&Human_Phenotype_Ontology:HP:0004812&MONDO:MONDO:0020511&MedGen:C0349636&Orphanet:99860SCV007105405&SCV007105406&SCV007105409&SCV007105415&SCV007105422&SCV007105432&SCV00710552012:25245350-252453501KRASp.G12D{'abstract': 'Nagashima et al. Abstract# 5735, AACR 2023.', 'link': 'https://aacrjournals.org/cancerres/article/83/7_Supplement/5735/722276'}True.The KRAS G12D mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in lung, colorectal, pancreatic and ovarian cancer (PMID: 28572459). Expression of this mutation in cell lines and mouse models demonstrated that it is activating, as measured by increased downstream pathway activation, colony formation and in vivo tumor development across multiple lineages compared to wildtype (PMID: 20570890, 20147967, 11751631, 15093544,19296721,17349581, 32792368). In vitro studies have demonstrated that this mutation confers resistance to BRAF inhibition in lymphoid cells as measured by decreased pathway activation in the presence of the drug, but is sensitive to the MEK inhibitor cobimetinib (PMID: 30341394). A patient with hairy cell leukemia acquired a KRAS G12D mutation following relapse on the BRAF inhibitor vemurafenib but was successfully treated with the cobimetinib for at least twelve months (PMID: 30341394). Preclinical studies with xenograft mouse models expressing KRAS G12D demonstrated sensitivity to treatment with setidegrasib as measured by reduced tumor volume following treatment (Abstract: Nagashima et al. Abstract# 5735, AACR 2023. https://aacrjournals.org/cancerres/article/83/7_Supplement/5735/722276)..KRAS, a GTPase which functions as an upstream regulator of the MAPK pathway, is frequently mutated in various cancer types including lung, colorectal and pancreatic cancers...17349581|19296721|11751631|15093544|30341394|28572459|20570890|32792368|20147967..G12D3845KRASGRCh38.MUTATIONLEVEL_R1.The KRAS G12D mutation is known to be oncogenic.FalseLEVEL_Fda2The KRAS G12D mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in lung, colorectal, pancreatic and ovarian cancer (PMID: 28572459). Expression of this mutation in cell lines and mouse models demonstrated that it is activating, as measured by increased downstream pathway activation, colony formation and in vivo tumor development across multiple lineages compared to wildtype (PMID: 20570890, 20147967, 11751631, 15093544,19296721,17349581, 32792368). In vitro studies have demonstrated that this mutation confers resistance to BRAF inhibition in lymphoid cells as measured by decreased pathway activation in the presence of the drug, but is sensitive to the MEK inhibitor cobimetinib (PMID: 30341394). A patient with hairy cell leukemia acquired a KRAS G12D mutation following relapse on the BRAF inhibitor vemurafenib but was successfully treated with the cobimetinib for at least twelve months (PMID: 30341394). Preclinical studies with xenograft mouse models expressing KRAS G12D demonstrated sensitivity to treatment with setidegrasib as measured by reduced tumor volume following treatment (Abstract: Nagashima et al. Abstract# 5735, AACR 2023. https://aacrjournals.org/cancerres/article/83/7_Supplement/5735/722276).['17349581', '19296721', '11751631', '15093544', '30341394', '28572459', '20570890', '32792368', '20147967'][{'abstract': 'Nagashima et al. Abstract# 5735, AACR 2023.', 'link': 'https://aacrjournals.org/cancerres/article/83/7_Supplement/5735/722276'}]LEVEL_Dx2['Oncogenic Mutations']['10049057', '23832011', '25691160', '26457647', '12717436']This assertion is supported by (PMID: 10049057, 23832011, 26457647, 12717436, PMID: 25691160).813.0JMMLLightSalmonJuvenile Myelomonocytic LeukemiaMyelodysplastic/Myeloproliferative NeoplasmsLIQUIDMyeloidMDS/MPN4.0LIQUIDLEVEL_Dx2['Oncogenic Mutations']['22934674', '23512829']This assertion is supported by (PMID: 23512829, 22934674).505.0MDSLightSalmonMyelodysplastic SyndromesMyelodysplastic SyndromesLIQUIDMyeloidMNM3.0LIQUIDLEVEL_Dx3['Oncogenic Mutations']['22237106']This assertion is supported by (PMID: 22237106).757.0ETPLLLimeGreenEarly T-Cell Precursor Lymphoblastic LeukemiaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidTLL4.0LIQUID['Oncogenic Mutations']CetuximabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']Tucatinib + TrastuzumabLEVEL_R1LEVEL_Fda2['30857956']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Patients with metastatic colorectal cancer harboring KRAS mutations do not respond favorably to trastuzumab as seen in the MyPath trial. In the multiple basket MyPath Phase IIa trial of pertuzumab and trastuzumab in which 56 metastatic colorectal cancer patients with HER2 amplification received combination therapy, the objective response rate for patients with KRAS wildtype colorectal cancer (43/56 patients) compared to KRAS mutated colorectal cancer (13/56 patients) was 40% (17/43, 95% CI, 25%56%) versus 8% (1/13, 95% CI 0.2%36%), respectively (PMID: 30857956).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']PanitumumabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']Avutometinib + DefactinibLEVEL_1LEVEL_Fda2['40644648']Avutometinib, a RAF/MEK clamp inhibitor, and defactinib, a FAK inhibitor, are FDA-approved in combination for the treatment of adult patients with KRAS-mutated recurrent low-grade serous ovarian cancer (LGSOC) who have received prior systemic therapy. FDA approval was based on the results of the Phase II RAMP-201 (NCT04625270) trial of avutometinib plus defactinib in 109 patients with recurrent LGSOC._In the Phase II RAMP-201 (NCT04625270) trial, patients with KRAS-mutated LGSOC (n=57) demonstrated an overall response rate (ORR) of 44% (n=25), with a 2% (n=2) complete response (CR) rate, 40% (n=23) partial response (PR) rate and 49% (n=28) stable disease (SD) rate, a median duration of response (DOR) of 31.0 months (95% CI=14.8-31.1) and a median progression-free survival (PFS) of 22.0 months (95% CI=11.1-36.6) (PMID: 40644648). Responders included patients with the following KRAS mutations: KRAS A146V, G12D, G12R, G12V and Q61H (PMID: 40644648). Of patients with KRAS wildtype LGSOC (n=52), the cohort demonstrated an ORR of 17% (n=9), with a 17% (n=9) PR rate and 65% (n=34) SD rate, and a median PFS of 9.2 months (95% CI=5.5-NE) (PMID: 40644648).796.0LGSOCLightBlueLow-Grade Serous Ovarian CancerOvarian CancerSOLIDOvary/Fallopian TubeSOC4.0SOLID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).854.0ECDLightSalmonErdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).855.0RDDLightSalmonRosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).854.0ECDLightSalmonErdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).855.0RDDLightSalmonRosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']CobimetinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).38.0LightSalmonHistiocytosisLIQUIDMyeloid0.0LIQUID['G12D', 'G12A', 'G12R', 'G12S', 'G12V']DaraxonrasibLEVEL_3ALEVEL_Fda3['38593348'][{'abstract': 'Koltun et al. Abstract# 3597, AACR 2022.', 'link': 'https://aacrjournals.org/cancerres/article/82/12_Supplement/3597/702320'}, {'abstract': 'Arbour, KC. et al., Abstract#6520, Annals of Oncol., 2023.', 'link': 'https://www.annalsofoncology.org/article/S0923-7534%2823%2902675-3/fulltext'}, {'abstract': 'Singh et al. Abstract # 3597, AACR 2022.', 'link': 'https://s3.us-west-2.amazonaws.com/rvmdpubs.revmed.com/2022/AACR_2022_Singh.pdf'}]Daraxonrasib is an orally available, small-molecule RAS(ON) multi-selective noncovalent inhibitor. There are promising clinical data in patients with non-small cell lung cancer (NSCLC) harboring a KRAS G12 mutation treated with daraxonrasib. _In a clinical study of daraxonrasib in 39 patients with KRAS G12X-mutant NSCLC (n=3 KRAS G12A, n=17 KRAS G12D, n=17 KRAS G12V, n=2 KRAS G12S), the overall response rate was 38% (15/39), with one patient (3%) demonstrating complete response (n=1 KRAS G12V), fourteen patients (35%) demonstrating partial response (n=7 KRAS G12D, n=7 KRAS G12V), nineteen patients (48%) demonstrating stable disease (n=1 KRAS G12A, n=8 KRAS G12D, n=9 KRAS G12V, n=1 KRAS G12S) and five patients (13%) demonstrating progressive disease (n=2 KRAS G12A, n=2 KRAS G12D, n=1 KRAS G12S) (Abstract: Arbour, KC. et al., Abstract#6520, Annals of Oncol., 2023. https://www.annalsofoncology.org/article/S0923-7534%2823%2902675-3/fulltext). In a case report, a patient with NSCLC harboring KRAS G12V was treated with daraxonrasib and achieved a complete response with a 100% decrease in both target lesions (PMID: 38593348). In vitro studies with KRAS position 12 (G12X) mutated RAS-addicted cell lines demonstrated increased sensitivity to daraxonrasib as measured by increased inhibition of cellular proliferation compared to other RAS-mutated cell lines (Abstract: Singh et al. Abstract # 3597, AACR 2022. https://s3.us-west-2.amazonaws.com/rvmdpubs.revmed.com/2022/AACR_2022_Singh.pdf). In vivo human xenograft models with KRAS G12X mutant tumors demonstrated sensitivity to daraxonrasib as measured by dose-dependent tumor regression, anti-tumor immunity and RAS pathway inhibition (Abstract: Koltun et al. Abstract# 3597, AACR 2022. https://aacrjournals.org/cancerres/article/82/12_Supplement/3597/702320).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['G12D', 'G12A', 'G12R', 'G12S', 'G12V']DaraxonrasibLEVEL_3ALEVEL_Fda3['38593348'][{'abstract': 'Garrido-Laguna et al. 2025 ASCO Gastrointestinal Cancers Symposium.', 'link': 'https://www.asco.org/abstracts-presentations/ABSTRACT474560'}, {'abstract': 'Arbour et al. Abstract# 6520, Annals of Oncol., 2023.', 'link': 'https://www.annalsofoncology.org/article/S0923-7534%2823%2902675-3/fulltext'}]Daraxonrasib is an orally available, small-molecule RAS(ON) multi-selective noncovalent inhibitor. There are promising clinical data in patients with pancreatic adenocarcinoma harboring a KRAS G12 mutation treated with daraxonrasib. _In the Phase I RMC-6236-001 (NCT05379985) trial of daraxonrasib in 127 patients with RAS-mutant pancreatic adenocarcinoma (PDAC), the KRAS G12X-mutant cohort (n=42) demonstrated a median progression-free survival (PFS) of 8.5 months (95% CI=5.3-11.7), an objective response rate (ORR) of 29% (95% CI=1645) and a median overall survival (OS) of 14.5 months (95% CI=8.8-NE) (Abstract: Garrido-Laguna et al. 2025 ASCO Gastrointestinal Cancers Symposium. https://www.asco.org/abstracts-presentations/ABSTRACT474560). Of the RAS-mutant cohort (G12X, G13X or Q61X) (n=57), the median PFS was 7.6 months (95% CI=5.9-11.1), the ORR was 25% (95% CI=14-38) and the median OS was 14.5 months (95% CI=8.8-NE) (Abstract: Garrido-Laguna et al. 2025 ASCO Gastrointestinal Cancers Symposium. https://www.asco.org/abstracts-presentations/ABSTRACT474560). In a clinical study of daraxonrasib in 44 patients with KRAS G12X-mutant pancreatic adenocarcinoma (n=23 KRAS G12D, n=9 KRAS G12V, n=11 KRAS G12R, n=1 KRAS G12S), the overall response rate was 20% (9/44), with nine patients (20%) demonstrating partial response (n=4 KRAS G12D, n=2 KRAS G12V, n=3 KRAS G12R), 32 patients (73%) demonstrating stable disease (n=17 KRAS G12D, n=6 KRAS G12V, n=8 KRAS G12R, n=1 KRAS G12S) and two patients (4.5%) demonstrating progressive disease (n=2 KRAS G12D) (Abstract: Arbour et al. Abstract# 6520, Annals of Oncol., 2023. https://www.annalsofoncology.org/article/S0923-7534%2823%2902675-3/fulltext). _Preclinical studies with KRAS G12X mutated RAS-addicted cell lines and KRAS G12X mutant human xenograft models demonstrated increased sensitivity to daraxonrasib as measured by increased inhibition of cellular proliferation, dose-dependent tumor regression, anti-tumor immunity and RAS pathway inhibition (PMID: 38593348).225.0PAADPurplePancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasPANCREAS2.0SOLID['G12D']SetidegrasibLEVEL_3ALEVEL_Fda3['41879829', '40849515']Setidegrasib is an intravenously administered, small molecule KRAS G12D-targeted degrader. There are promising clinical data of response to setidegrasib in patients with KRAS G12D-mutant non-small cell lung cancer (NSCLC). In the Phase I (NCT05382559) trial of setidegrasib as a second-line of treatment or later in 45 patients with KRAS G12D-mutant NSCLC, the objective response rate was 36% (n=16) (95% CI=22-51), with one pending partial responses (PR) and fifteen confirmed PRs, the median time to a response was 1.4 months (range=1.2-8.1), the median progression-free survival (PFS) was 8.3 months (95% CI=4.1-NE), the 6-month overall survival (OS) was 77% (95% CI=62-87) and the 12-month OS was 59% (95% CI=40-74) (PMID: 41879829). In vivo studies with KRAS G12D-mutant NSCLC mouse xenograft models demonstrated antitumor activity to setidegrasib as measured by tumor regression (PMID: 40849515).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['G12D']SetidegrasibLEVEL_3ALEVEL_Fda3['41879829', '40849515'][{'abstract': 'Park et al. Abstract# 775, ASCO Gastrointestinal Cancers Symposium, 2026.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2026.44.2_suppl.775'}]Setidegrasib is an intravenously administered, small-molecule KRAS G12D-targeted degrader. There are promising clinical data of response to setidegrasib in patients with KRAS G12D-mutated pancreatic ductal adenocarcinoma (PDAC). _In the Phase I (NCT05382559) trial of setidegrasib as second-line treatment or third-line treatment in 21 patients with KRAS G12D-mutant PDAC, the objective response rate (ORR) was 24% (95% CI=8-47), with five confirmed partial responses (PR) and seven stable disease (SD) responses, the median time to response was 4.1 months (range=1.3-8.2), the median duration of response was 4.2 months (95% CI=2.7-NE), the median progression-free survival was 3.0 months (95% CI=1.4-6.9) and the median overall survival was 10.3 months (95% CI=4.2-13.0) (PMID: 41879829). In the exploratory analyses of the Phase I (NCT05382559) trial with 124 patients with KRAS G12D-mutant PDAC, 78% of patients with 50% reduced KRAS G12D variant allele frequency achieved SD or PR and demonstrated a clinical benefit (Abstract: Park et al. Abstract# 775, ASCO Gastrointestinal Cancers Symposium, 2026. https://ascopubs.org/doi/abs/10.1200/JCO.2026.44.2_suppl.775)._In vivo studies with KRAS G12D-mutant PDAC mouse xenograft models demonstrated antitumor activity with setidegrasib as measured by tumor regression (PMID: 40849515).225.0PAADPurplePancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasPANCREAS2.0SOLID['Oncogenic Mutations']TrametinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).38.0LightSalmonHistiocytosisLIQUIDMyeloid0.0LIQUID['G12D', 'G12A', 'G12R', 'G12S', 'G12V']DaraxonrasibLEVEL_4LEVEL_Fda3[{'abstract': 'Koltun et al. Abstract# 3597, AACR 2022.', 'link': 'https://aacrjournals.org/cancerres/article/82/12_Supplement/3597/702320'}, {'abstract': 'Singh et al. Abstract # 3597, AACR 2022.', 'link': 'https://s3.us-west-2.amazonaws.com/rvmdpubs.revmed.com/2022/AACR_2022_Singh.pdf'}]Daraxonrasib is an orally available, small-molecular inhibitor of RAS. In vitro studies in human RAS-addicted cancer cell lines demonstrated sensitivity to daraxonrasib as measured by decreased ERK phosphorylation, decreased cell growth and induced apoptosis (Abstract: Koltun et al. Abstract# 3597, AACR 2022. https://aacrjournals.org/cancerres/article/82/12_Supplement/3597/702320). In vitro studies with KRAS position 12 (G12X) mutated RAS-addicted cell lines demonstrated increased sensitivity to daraxonrasib as measured by increased inhibition of cellular proliferation compared to other RAS-mutated cell lines (Abstract: Singh et al. Abstract # 3597, AACR 2022. https://s3.us-west-2.amazonaws.com/rvmdpubs.revmed.com/2022/AACR_2022_Singh.pdf). In vivo human xenograft models with KRAS G12X mutant tumors demonstrated sensitivity to daraxonrasib as measured by dose-dependent tumor regression, anti-tumor immunity and RAS pathway inhibition (Abstract: Koltun et al. Abstract# 3597, AACR 2022. https://aacrjournals.org/cancerres/article/82/12_Supplement/3597/702320). In a mouse clinical trial of daraxonrasib with KRAS G12X-mutant models of non-small cell lung cancer (n=15), pancreatic ductal adenocarcinoma (n=18) and colorectal cancer (n=18), the objective response rate was 53% (8/15), 61% (11/18) and 44% (8/18), respectively (Abstract: Singh et al. Abstract # 3597, AACR 2022. https://s3.us-west-2.amazonaws.com/rvmdpubs.revmed.com/2022/AACR_2022_Singh.pdf).5.0All Solid TumorsSOLID-1.0SOLID['G12D']MRTX1133LEVEL_4LEVEL_Fda3['36472553']MRTX-1133 is an orally available, small-molecule inhibitor of KRAS G12D. In vitro studies with KRAS G12D-mutant PDAC cell lines demonstrated selective sensitivity to MRTX-1133 as measured by inhibition of KRAS G12D and downstream MAPK signaling activity compared to KRAS wildtype and KRAS G12C-mutant cell lines (PMID: 36472553). In vivo studies with KRAS G12D-mutant pancreatic ductal adenocarcinoma mouse xenograft models demonstrated antitumor activity to MRTX-1133 as measured by complete or near-complete remissions following treatment (PMID: 36472553).5.0All Solid TumorsSOLID-1.0SOLID['G12D']SetidegrasibLEVEL_4LEVEL_Fda3['40849515']Setidegrasib is an intravenously administered, small-molecule KRAS G12D degrader. There are promising laboratory data to support use of setidegrasib in patients with KRAS G12D-mutated solid tumors. In vitro studies with KRAS G12D-mutated pancreatic cancer cells demonstrated selective sensitivity to setidegrasib as measured by degradation of KRAS G12D, inhibition of ERK phosphorylation and inhibition of cellular proliferation compared to KRAS wildtype cancer cells (PMID: 40849515). In vivo studies with KRAS G12D-mutant pancreatic ductal adenocarcinoma and non-small cell lung cancer mouse xenograft models demonstrated antitumor activity to setidegrasib as measured by tumor regression (PMID: 40849515).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']TrametinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']CobimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']BinimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).5.0All Solid TumorsSOLID-1.0SOLID17349581;19296721;11751631;15093544;30341394;28572459;20570890;32792368;20147967;Nagashima et al. Abstract# 5735, AACR 2023.(https://aacrjournals.org/cancerres/article/83/7_Supplement/5735/722276)Daraxonrasib,MRTX1133,Setidegrasib,Trametinib,Cobimetinib,Binimetinib20921465;21228335;20619739;24024839;18316791;30857956;40644648;30867592;32991018;29236635;30361829;38593348;Koltun et al. Abstract# 3597, AACR 2022.(https://aacrjournals.org/cancerres/article/82/12_Supplement/3597/702320);Arbour, KC. et al., Abstract#6520, Annals of Oncol., 2023.(https://www.annalsofoncology.org/article/S0923-7534%2823%2902675-3/fulltext);Singh et al. Abstract # 3597, AACR 2022.(https://s3.us-west-2.amazonaws.com/rvmdpubs.revmed.com/2022/AACR_2022_Singh.pdf);Garrido-Laguna et al. 2025 ASCO Gastrointestinal Cancers Symposium.(https://www.asco.org/abstracts-presentations/ABSTRACT474560);Arbour et al. Abstract# 6520, Annals of Oncol., 2023.(https://www.annalsofoncology.org/article/S0923-7534%2823%2902675-3/fulltext);41879829;40849515;Park et al. Abstract# 775, ASCO Gastrointestinal Cancers Symposium, 2026.(https://ascopubs.org/doi/abs/10.1200/JCO.2026.44.2_suppl.775);36472553;33933896;25435214;24746704;23934108JMML,MDSETPLL10049057;23832011;25691160;26457647;12717436;22934674;23512829;22237106120Tmissense_variantKRAS3845GeneENST00000256078.4ENST00000256078.4:c.35G>ANP_004976.2:p.Gly12Asp79GLY12ASP/RS121913529https://civicdb.org/links/variants/79KRAS_G12D79NM_004985.4:c.35G>A/NP_004976.2:p.Gly12Asp/NC_000012.11:g.25398284C>T/ENST00000256078.4:c.35G>ACA12253812582
TUMORp.G12CENSP00000308495.3:p.Gly12Cyschr1225245351CAPASSNM_004985missense_variantMODERATEKRAS2/5c.34G>Trs121913530&CM076251&COSV55497461&COSV55497469&COSV55497582&COSV56157736SNVdeleterious_low_confidence(0)0.000.010.000.000.8532.6400e-01Gallbladder_cancer&Lung_cancer&RASopathy&not_provided&Lung_carcinoma&Non-small_cell_lung_carcinoma&Lung_adenocarcinoma&Endometrial_carcinomaNC_000012.12:g.25245351C>Acriteria_provided&_single_submitterLikely_pathogenicOncogeniccriteria_provided&_single_submitter3criteria_provided&_single_submitterTier_I_-_StrongKRASG12Cchr12:25245351-25245351v7.0LEVEL_Dx2LEVEL_Fda2✓ Hotspot05/13/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicAdagrasib,Adagrasib+Cetuximab,Avutometinib+Defactinib,Sotorasib,Sotorasib+PanitumumabAdagrasib,Adagrasib+Panitumumab,Cobimetinib,Sotorasib,Sotorasib+Cetuximab,TrametinibAdagrasib,Cobimetinib,TrametinibCetuximab,Tucatinib+Trastuzumab,PanitumumabLEVEL_R1LEVEL_1LEVEL_R1LEVEL_Dx270,300/1G12C0.3GRCh38KRASCAMissense_MutationSNPC25245351KRAS_G12C.GT:AD:AF:DP0/1:70,30:0.3:100AENSG00000133703TranscriptENST00000311936protein_coding2243412G/CGgt/Tgt-1HGNCHGNC:6407YESMANE_SelectNM_004985.51P4CCDS8702.1ENSP00000308495P01116.262UPI0000001252P01116-2EnsemblCC1Gene3D:3.40.50.300&AFDB-ENSP_mappings:AF-P01116-F1&Pfam:PF00071&Prints:PR00449&PROSITE_profiles:PS51419&PROSITE_profiles:PS51420&PROSITE_profiles:PS51421&PANTHER:PTHR24070&SMART:SM00173&SMART:SM00174&SMART:SM00175&Superfamily:SSF52540&NCBIFAM:TIGR00231&CDD:cd04138&Low_complexity_(Seg):segnot_provided&pathogenic&pathogenic/likely_pathogenic&likely_pathogenic0&1&1&1&1&11&1&1&1&1&124033266&26900293&12460918&25157968&17332249&17384584&18794081&19018267&21975775&17704260&19255327&19773371&22683711&23406027&15696205&16361624&16618717&18316791&19114683&19679400&20921462&20921465&21228335&22722830&32000721&23182985&7773929&19358724&20805368&23014527&25044103&6320174&6695174&11745231&18594010&30048458&32175330&32805489&34649968&37160318&28347348&31117243&29610392&34737598&34381078&30797065&26242988&33254149&35638910&23480694&32934698&35658005&31666701&37425402&37713191&38413718FAIL438-58KRAS125780.0000227617MONDO:MONDO:0005411&MedGen:C0153452&MONDO:MONDO:0008903&MedGen:C0242379&OMIM:211980&MONDO:MONDO:0021060&MedGen:C5555857&Orphanet:536391&MedGen:C3661900&MONDO:MONDO:0005138&MedGen:C0684249&Human_Phenotype_Ontology:HP:0030358&MONDO:MONDO:0005233&MeSH:D002289&MedGen:C0007131&Human_Phenotype_Ontology:HP:0030078&MONDO:MONDO:0005061&MeSH:D000077192&MedGen:C0152013&Human_Phenotype_Ontology:HP:0012114&MONDO:MONDO:0002447&MedGen:C0476089&OMIM:608089SCV004501632single_nucleotide_variantSO:0001483ClinGen:CA122528&OMIM:190070.0001&UniProtKB:P01116#VAR_006839KRAS:3845SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094260121913530Diffuse_pediatric-type_high-grade_glioma&_H3-wildtype_and_IDH-wildtype&Embryonal_rhabdomyosarcoma&Ovarian_mucinous_adenocarcinoma&Adenocarcinoma_of_the_large_intestineMONDO:MONDO:0858939&MedGen:C5669918&Human_Phenotype_Ontology:HP:0006743&MONDO:MONDO:0009993&MedGen:C0206656&Orphanet:99757&MONDO:MONDO:0005601&MedGen:C1335167&Orphanet:398961&Human_Phenotype_Ontology:HP:0040275&MONDO:MONDO:0005008&MedGen:C1319315SCV007105402&SCV007105420&SCV007105431&SCV00710552112:25245351-252453511KRASp.G12C{'abstract': 'Fakih et al. Abstract# 3003, ASCO 2019.', 'link': 'https://meetinglibrary.asco.org/record/172411/abstract'}True.The KRAS G12C mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in lung and colorectal cancer (PMID: 28572459). Expression of this mutation in lung and breast cancer cell lines and mouse models demonstrated that it is activating, as measured by increased pathway activation, cell proliferation, colony formation and in vivo tumor formation compared to wildtype (PMID: 25705018, 26841430, 16051643, 32792368). In vitro studies of cells expressing the KRAS G12C mutation demonstrate that it is sensitive to several targeted therapies designed specifically for this allele, including ARS853 (PMID: 26841430, 24256730). In a phase I clinical trial of the KRAS G12C inhibitor AMG510 in which thirteen patients with non-small cell lung cancer harboring this mutation were given the target drug dose, 100% of patients responded, with seven patients having partial response and six patients having stable disease (Abstract: Fakih et al. Abstract# 3003, ASCO 2019. https://meetinglibrary.asco.org/record/172411/abstract). KRAS G12C has been identified as an acquired resistance mutation in two patients with EGFR-mutated non-small cell lung cancer following a durable response to osimertinib (PMID: 38096473)..KRAS, a GTPase which functions as an upstream regulator of the MAPK pathway, is frequently mutated in various cancer types including lung, colorectal and pancreatic cancers...25705018|38096473|24256730|28572459|16051643|32792368|26841430..G12C3845KRASGRCh38.MUTATIONLEVEL_R1.The KRAS G12C mutation is known to be oncogenic.FalseLEVEL_Fda2The KRAS G12C mutation is located in the P-loop of the catalytic G-domain of the protein. This mutation has been found in lung and colorectal cancer (PMID: 28572459). Expression of this mutation in lung and breast cancer cell lines and mouse models demonstrated that it is activating, as measured by increased pathway activation, cell proliferation, colony formation and in vivo tumor formation compared to wildtype (PMID: 25705018, 26841430, 16051643, 32792368). In vitro studies of cells expressing the KRAS G12C mutation demonstrate that it is sensitive to several targeted therapies designed specifically for this allele, including ARS853 (PMID: 26841430, 24256730). In a phase I clinical trial of the KRAS G12C inhibitor AMG510 in which thirteen patients with non-small cell lung cancer harboring this mutation were given the target drug dose, 100% of patients responded, with seven patients having partial response and six patients having stable disease (Abstract: Fakih et al. Abstract# 3003, ASCO 2019. https://meetinglibrary.asco.org/record/172411/abstract). KRAS G12C has been identified as an acquired resistance mutation in two patients with EGFR-mutated non-small cell lung cancer following a durable response to osimertinib (PMID: 38096473).['25705018', '38096473', '24256730', '28572459', '16051643', '32792368', '26841430'][{'abstract': 'Fakih et al. Abstract# 3003, ASCO 2019.', 'link': 'https://meetinglibrary.asco.org/record/172411/abstract'}]LEVEL_Dx2['Oncogenic Mutations']['10049057', '23832011', '25691160', '26457647', '12717436']This assertion is supported by (PMID: 10049057, 23832011, 26457647, 12717436, PMID: 25691160).813.0JMMLLightSalmonJuvenile Myelomonocytic LeukemiaMyelodysplastic/Myeloproliferative NeoplasmsLIQUIDMyeloidMDS/MPN4.0LIQUIDLEVEL_Dx2['Oncogenic Mutations']['22934674', '23512829']This assertion is supported by (PMID: 23512829, 22934674).505.0MDSLightSalmonMyelodysplastic SyndromesMyelodysplastic SyndromesLIQUIDMyeloidMNM3.0LIQUIDLEVEL_Dx3['Oncogenic Mutations']['22237106']This assertion is supported by (PMID: 22237106).757.0ETPLLLimeGreenEarly T-Cell Precursor Lymphoblastic LeukemiaT-Lymphoblastic Leukemia/LymphomaLIQUIDLymphoidTLL4.0LIQUID['Oncogenic Mutations']CetuximabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']Tucatinib + TrastuzumabLEVEL_R1LEVEL_Fda2['30857956']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Patients with metastatic colorectal cancer harboring KRAS mutations do not respond favorably to trastuzumab as seen in the MyPath trial. In the multiple basket MyPath Phase IIa trial of pertuzumab and trastuzumab in which 56 metastatic colorectal cancer patients with HER2 amplification received combination therapy, the objective response rate for patients with KRAS wildtype colorectal cancer (43/56 patients) compared to KRAS mutated colorectal cancer (13/56 patients) was 40% (17/43, 95% CI, 25%56%) versus 8% (1/13, 95% CI 0.2%36%), respectively (PMID: 30857956).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']PanitumumabLEVEL_R1LEVEL_Fda2['20921465', '21228335', '20619739', '24024839', '18316791']Cetuximab and panitumumab are anti-EGFR monoclonal antibodies that are FDA-approved for patients with EGFR expressing, RAS-wildtype colorectal cancer. Patients with metastatic colorectal cancer (mCRC) harboring either exon 2 (e.g. G12, G13) or non-exon 2 (e.g Q61, K117, A146) KRAS mutations do not respond favorably to the anti-EGFR therapies cetuximab (PMID: 21228335, 20619739) or panitumumab (PMID: 18316791, 20921465, 24024839).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['G12C']AdagrasibLEVEL_1LEVEL_Fda2['35658005'][{'abstract': 'Gadgeel, S. et al., Abstract# MA06.04, Journal of Thoracic Oncology Vol. 18.', 'link': 'https://www.jto.org/article/S1556-0864%2823%2900954-1/fulltext'}]Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. FDA approval was based on the results of the Phase I/II KRYSTAL-1 (NCT03785249) trial of adagrasib in 112 evaluable patients with KRAS G12C-mutant non-small cell lung cancer in which the overall response rate (ORR) was 42.9% (48 of 112 patients) with a disease control rate of 79.5% (89 of 112 patients), the median duration of response (DOR) of 8.5 months (95% CI= 6.213.8), median progression-free survival (PFS) of 6.5 months (95% CI= 4.78.4) and median overall survival (OS) of 12.6 months (95% CI= 9.2NE) (PMID: 35658005). In the two-year follow-up of the Phase I/II KRYSTAL-1 trial in 128 evaluable patients with KRAS G12C-mutant non-small cell lung cancer, the ORR was 43.0% (n=55/128 patients), the median DOR was 12.4 months (95% CI= 7.0-15.2), the median PFS was 6.9 months (95% CI= 5.4-8.7) with a 1-year PFS rate of 35.0% (95% CI= 25.9-44.2) and the median OS was 14.1 months (95% CI= 9.2-18.7) with a 1-year and 2-year OS rate of 52.8% and 31.3%, respectively (Abstract: Gadgeel, S. et al., Abstract# MA06.04, Journal of Thoracic Oncology Vol. 18. https://www.jto.org/article/S1556-0864%2823%2900954-1/fulltext).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['G12C']Adagrasib + CetuximabLEVEL_1LEVEL_Fda2['38587856']Adagrasib, a small molecule KRAS G12C inhibitor, and cetuximab, an anti-EGFR monoclonal antibody, are FDA-approved in combination for the treatment of adult patients with KRAS G12C-mutated locally advanced or metastatic colorectal cancer (CRC), as determined by an FDA-approved test, who have received prior treatment with fluoropyrimidine-, oxaliplatin- and irinotecan-based chemotherapy. KRAS G12C mutation for treatment with adagrasib plus cetuximab was detected by the therascreen KRAS RGQ PCR Kit. FDA approval was based on the results of the Phase I/II KRYSTAL-1 (NCT03785249) trial of adagrasib plus cetuximab in 94 patients with KRAS G12C-mutated CRC. In the Phase I/II KRYSTAL-1 (NCT03785249) trial, the objective response rate was 34% (95% CI=26.4-44.5), with a 34% (n=32) partial response rate and 51.1% (n=48) stable disease rate, the median duration of response was 5.8 months (95% CI=4.2-7.6), the median progression-free survival was 6.9 months (95% CI=5.7-7.4) and the median overall survival was 15.9 months (95% CI=11.8-18.8) (PMID: 38587856).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']Avutometinib + DefactinibLEVEL_1LEVEL_Fda2['40644648']Avutometinib, a RAF/MEK clamp inhibitor, and defactinib, a FAK inhibitor, are FDA-approved in combination for the treatment of adult patients with KRAS-mutated recurrent low-grade serous ovarian cancer (LGSOC) who have received prior systemic therapy. FDA approval was based on the results of the Phase II RAMP-201 (NCT04625270) trial of avutometinib plus defactinib in 109 patients with recurrent LGSOC._In the Phase II RAMP-201 (NCT04625270) trial, patients with KRAS-mutated LGSOC (n=57) demonstrated an overall response rate (ORR) of 44% (n=25), with a 2% (n=2) complete response (CR) rate, 40% (n=23) partial response (PR) rate and 49% (n=28) stable disease (SD) rate, a median duration of response (DOR) of 31.0 months (95% CI=14.8-31.1) and a median progression-free survival (PFS) of 22.0 months (95% CI=11.1-36.6) (PMID: 40644648). Responders included patients with the following KRAS mutations: KRAS A146V, G12D, G12R, G12V and Q61H (PMID: 40644648). Of patients with KRAS wildtype LGSOC (n=52), the cohort demonstrated an ORR of 17% (n=9), with a 17% (n=9) PR rate and 65% (n=34) SD rate, and a median PFS of 9.2 months (95% CI=5.5-NE) (PMID: 40644648).796.0LGSOCLightBlueLow-Grade Serous Ovarian CancerOvarian CancerSOLIDOvary/Fallopian TubeSOC4.0SOLID['G12C']SotorasibLEVEL_1LEVEL_Fda2['38157806', '34096690', '32955176', '37098232', '36764316']Sotorasib is a small molecule inhibitor of the KRAS G12C mutant protein that is FDA-approved for adult patients with KRAS G12C-mutant locally advanced or metastatic non-small cell lung cancer (NSCLC). FDA approval was based on the results of the Phase II CodeBreaK 100 trial of sotorasib in 124 patients with KRAS G12C mutant NSCLC in which the objective response rate was 36% (95% CI= 28-45) and the median duration of response was 10.0 months (range: 1.3+, 11.1), with 2% of evaluable patients having a complete response and 35% of evaluable patients having a partial response (PMID: 34096690). In the two-year analysis of the Phase I/Phase II CodeBreaK 100 trial of sotorasib in 174 patients with KRAS G12C mutant NSCLC, the objective response rate was 41%, the median duration of response was 12.3 months, the progression-free survival was 6.3 months, the overall survival was 12.5 months and the two-year overall survival rate was 33% (PMID: 37098232). In the Phase III CodeBreaK 200 trial of sotorasib versus docetaxel in 345 patients with KRAS G12C-mutant NSCLC (n=171 and n=174, respectively), the objective response rates were 28.1% versus 13.2% (p < .001), the median duration of response was 8.6 months versus 6.8 months, and the overall rate of disease control was 82.5% versus 60.3%, respectively (PMID: 36764316). In the Phase I trial of sotorasib in 59 patients with KRAS G12C-mutant NSCLC, the objective response rate was 32.2% (n=19), the disease control rate was 88.1% (n=52) and the median progression-free survival was 6.3 months (range, 0.0+ to 14.9 [with + indicating that the value includes patient data that were censored at data cutoff]) (PMID: 32955176). In a retrospective, observational study of the Italian expanded access program of sotorasib in 196 patients with KRAS G12C-mutant advanced NSCLC, the objective response rate was 26% (n=51), with 51 patients demonstrating a partial response, 60 patients demonstrating stable disease and 65 patients demonstrating progressive disease, the median progression-free survival was 5.8 months (95% CI=5-6.5) and the median overall survival was 8.2 months (95% CI=6.3-9.9) (PMID: 38157806).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['G12C']Sotorasib + PanitumumabLEVEL_1LEVEL_Fda2['37870968']Sotorasib, a small molecule KRAS G12C inhibitor, and panitumumab, an anti-EGFR monoclonal antibody, are FDA-approved in combination for the treatment of adult patients with KRAS G12C-mutated metastatic colorectal cancer (mCRC) as determined by an FDA-approved test, who have received prior fluoropyrimidine-, oxaliplatin- and irinotecan-based chemotherapy. KRAS G12C mutation for treatment with sotorasib plus panitumumab was detected by the Guardant360 CDx or the therascreen KRAS RGQ PCR Kit. FDA approval was based on the results of the Phase III CodeBreaK 300 (NCT05198934) trial of sotorasib plus panitumumab versus standard-of-care (trifluridine/tipiracil or regorafenib) in patients with KRAS G12C-mutated CRC.__In the Phase III CodeBreaK 300 (NCT05198934) trial, the sotorasib cohort (n=53) demonstrated an overall response rate (ORR) of 26% (95% CI=15-40), with a 1.9% (n=1) complete response (CR) rate and 25% (n=13) partial response (PR) rate, a median progression-free survival (PFS) of 5.6 months (95% CI=4.2-6.3) and a median overall survival (OS) that was not reached (95% CI=8.6-NR) (PMID: 37870968). In the standard-of-care cohort (n=54), the ORR was 0% (95% CI=0-7), the median PFS was 2 months (95% CI=1.9-3.9) (HR=0.48 [95% CI=0.3-0.78], p=0.005) and the median OS was 10.3 months (95% CI=7-NR) (HR=0.7 [95% CI=0.41-1.18]) (PMID: 37870968).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['G12C']AdagrasibLEVEL_2LEVEL_Fda2['37099736']Adagrasib is an orally available, small molecule KRAS G12C inhibitor that is FDA-approved for adult patients with KRAS G12C-mutated locally advanced or metastatic non-small cell lung cancer, as determined by an FDA-approved test, who have received at least one prior systemic therapy. The NCCN Biliary Tract Cancers Guidelines (V2.2024) lists tucatinib plus trastuzumab under "Subsequent-Line Therapy for Biliary Tract Cancers if Disease Progression" for patients with KRAS G12C-mutant biliary tract cancer. NCCN recommendation was based on the results of the Phase II KRYSTAL-1 (NCT03785249) trial of adagrasib in 64 patients with KRAS G12C-mutated solid tumors (n=12, biliary tract cancer). In the Phase II KRYSTAL-1 (NCT03785249), the KRAS G12C-mutant biliary tract cancer cohort demonstrated an overall response rate of 41.7% (5/12) (95% CI=15.2-72.3), a median progression-free survival of 8.6 months (95% CI=2.7-11.3) and a median overall survival of 15.1 months (95% CI=8.6-NE) (PMID: 37099736).15.0MIXEDHepatobiliary CancerSOLIDMIXED0.0SOLID['G12C']AdagrasibLEVEL_2LEVEL_Fda2['31658955', '37099736'][{'abstract': 'Pant et al. Abstract # 425082, ASCO Monthly Plenary Series April 2023.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.36_suppl.425082'}]Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. The Pancreatic Cancer NCCN v1.2023 lists adagrasib for patients with KRAS G12C-mutant pancreatic cancer. In a phase II trial (KRYSTAL-1, NCT03785249) of adagrasib in 30 patients with previously treated, inoperable, or metastatic KRAS G12C-mutant gastrointestinal cancers excluding colorectal cancer, preliminary data demonstrated a 100% disease control rate in 27 evaluable patients (PMID: 37099736). Among ten evaluable patients with pancreatic ductal adenocarcinoma, 50% experienced a partial response after a median of 8.1 months and the rest developed stable disease (PMID: 37099736). In updated data from the KRYSTAL-1 trial, the overall response rate in 21 patients with KRAS G12C-mutant pancreatic cancer to treatment with adagrasib was 33.3% (Abstract: Pant et al. Abstract # 425082, ASCO Monthly Plenary Series April 2023. https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.36_suppl.425082). In a preclinical setting, seventeen of 26 (65%) KRAS G12C-positive cell line and patient-derived xenograft models from multiple tumor types that were treated with adagrasib resulted in tumor regression (PMID: 31658955).225.0PAADPurplePancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasPANCREAS2.0SOLID['G12C']AdagrasibLEVEL_2LEVEL_Fda2['37099736']Adagrasib is an orally available, small molecule KRAS G12C inhibitor that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. The NCCN Small Bowel Adenocarcinoma Guidelines (V1.2025) lists adagrasib monotherapy under "Second-Line and Subsequent Therapy" for patients with KRAS G12C-mutant small bowel adenocarcinoma. NCCN recommendation is based on the results of the Phase I/II KRYSTAL-1 (NCT03785249) trial of adagrasib in patients with KRAS G12C-mutant colorectal cancer. Due to the infrequency of KRAS G12C-mutant small bowel cancers, this recommendation relies on evidence extrapolated from colorectal cancer patients.__In the Phase I/II KRYSTAL-1 (NCT03785249) trial arm of adagrasib monotherapy for patients with KRAS G12C-mutant solid tumors, patients with small bowel cancer (n=2) demonstrated an overall response rate (ORR) of 50.0% (n=1) (95% CI=1.3-98.7), with one partial response, a median progression-free survival (PFS) of 5.6 months (95% CI=2.6-NE) and a median overall survival (OS) of 7.9 months (95% CI=6.2-NE) (PMID: 37099736).94.0SaddleBrownSmall Bowel CancerSOLIDBowel0.0SOLID['G12C']Adagrasib + PanitumumabLEVEL_2LEVEL_Fda2['37870968', '38587856', '36546659', '38177853']Adagrasib and sotorasib are KRAS G12C-targeted inhibitors that have been FDA-approved for the treatment of adult patients with KRAS G12C-mutated non-small cell lung cancer. The NCCN compendium lists KRAS G12C-targeted inhibitors, either adragrasib or sotorasib, in combination with an anti-EGFR monoclonal antibody, either cetuximab or panitumumab, as a treatment for patients with KRAS G12C-mutated colorectal cancer. __In the Phase I-II KRYSTAL-1 trial of adagrasib versus adagrasib plus cetuximab in patients with KRAS G12C-mutated colorectal cancer, the combination therapy group (n=28) demonstrated a response rate of 46% (95% CI=28, 66), a median response duration of 7.6 months (95% CI=5.7, NE) and a median progression-free survival (PFS) of 6.9 months (95% CI=5.4, 8.1), while the monotherapy group (n=43) demonstrated a response rate of 19% (95% CI=8, 33), a median response duration of 4.3 months (95% CI= 2.3, 8.3) and a median PFS of 5.6 months (95% CI=4.1, 8.3) (PMID: 36546659). In an updated analysis of the Phase I-II KRYSTAL-1 trial of adagrasib plus cetuximab in 94 patients with KRAS G12C-mutant colorectal cancer, the cohort demonstrated an objective response rate (ORR) of 34.0%, a median PFS of 6.9 months (95% CI=5.7-7.4) and a median overall survival of 15.9 months (95% CI=11.8-18.8) (PMID: 38587856). __In the Phase 1b dose-exploration and dose-expansion substudy of the CodeBreaK 101 trial of sotorasib plus panitumumab in 48 patients with KRAS G12C-mutated colorectal cancer (dose-exploration cohort, n=8, dose-expansion cohort, n=40), the dose-expansion cohort demonstrated an ORR of 30% (95% CI=16.6, 46.5), with 12 patients (30.0%, 95% CI=16.6, 46.5) achieving a confirmed partial response, a disease control rate of 92.5% (95% CI= 79.6, 98.4), a median PFS of 5.7 months (95% CI=4.2, 7.7), a median overall survival of 15.2 months (95% CI=12.5, not estimable) and tumor shrinkage of any magnitude in 35 patients (87.5%) (PMID: 38177853). In the Phase III CodeBreaK 300 trial of sotorasib plus panitumumab versus standard care in patients with KRAS G12C-mutated refractory metastatic colorectal cancer, the sotorasib 960-mg plus panitumumab therapy group (n=53) demonstrated an ORR of 26.4% (95% CI=15.3, 40.3) with 1 complete response and a median PFS of 5.6 months (95% CI=4.2, 6.3), while the standard care therapy group (n=54) demonstrated an ORR of 0% (95% CI=0.0, 6.6) and a median PFS of 2.2 months (95% CI=1.9, 3.9) (HR=0.49 [95% CI=0.30, 0.80], P=0.006) (PMID: 37870968).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).854.0ECDLightSalmonErdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']CobimetinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).855.0RDDLightSalmonRosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['G12C']SotorasibLEVEL_2LEVEL_Fda2['32955176']Sotorasib and adagrasib are orally available, small molecule KRAS G12C inhibitors that are FDA-approved for adult patients with KRAS G12C-mutated locally advanced or metastatic non-small cell lung cancer (NSCLC), as determined by an FDA-approved test. The NCCN compendium lists sotorasib and adagrasib as single agents for patients with KRAS G12C-mutant ampullary adenocarcinoma based on the results from the Phase I CodeBreaK100 (NCT03600883) trial of sotorasib in 28 patients with KRAS G12C-mutant solid tumors, excluding NSCLC and colorectal cancer. In the Phase I CodeBreaK100 (NCT03600883) trial, the cohort demonstrated an objective response rate of 14.3% (95% CI=4.03-32.67), with four patients achieving a partial response and 17 patients achieving stable disease (n=1, patient with ampullary cancer) (PMID: 32955176).13.0PurpleAmpullary CancerSOLIDAmpulla of Vater0.0SOLID['G12C']SotorasibLEVEL_2LEVEL_Fda2['32955176'][{'abstract': 'Strickler et al. Abstract# 360490, ASCO GI 2022.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.36_suppl.360490'}]Sotorasib is a small molecule inhibitor of the KRAS G12C-mutant protein. The Pancreatic Cancer NCCN v1.2023 lists sotorasib for patients with KRAS G12C-mutant pancreatic cancer. In the Phase I/II CodeBreak100 trial in 38 patients with KRAS G12C-mutant pancreatic cancer, eight patients had a confirmed partial response for an overall response rate of 21% (95% CI= 9.55-37.32) (Abstract: Strickler et al. Abstract# 360490, ASCO GI 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.36_suppl.360490). In the Phase I trial of sotorasib in 12 patients with KRAS G12C-mutant pancreatic cancer, one patient (n=1/12, 8.33%) had a confirmed partial response to treatment (PMID: 32955176).225.0PAADPurplePancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasPANCREAS2.0SOLID['G12C']SotorasibLEVEL_2LEVEL_Fda2['32955176']Sotorasib is an orally available, small molecule KRAS G12C inhibitor that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. The NCCN Small Bowel Adenocarcinoma Guidelines (V1.2025) lists sotorasib monotherapy under "Second-Line and Subsequent Therapy" for patients with KRAS G12C-mutant small bowel adenocarcinoma. NCCN recommendation is based on the results of the Phase II CodeBreaK 100 (NCT03600883) trial of sotorasib in patients with KRAS G12C-mutant colorectal cancer. Due to the infrequency of KRAS G12C-mutant small bowel cancers, this recommendation relies on evidence extrapolated from colorectal cancer patients.__In the Phase II CodeBreaK 100 (NCT03600883) trial arm of sotorasib monotherapy for patients with KRAS G12C-mutant solid tumors, a patient with small bowel cancer demonstrated stable disease after treatment with sotorasib (PMID: 32955176).94.0SaddleBrownSmall Bowel CancerSOLIDBowel0.0SOLID['G12C']AdagrasibLEVEL_2LEVEL_Fda2['32955176']Sotorasib and adagrasib are orally available, small molecule KRAS G12C inhibitors that are FDA-approved for adult patients with KRAS G12C-mutated locally advanced or metastatic non-small cell lung cancer (NSCLC), as determined by an FDA-approved test. The NCCN compendium lists sotorasib and adagrasib as single agents for patients with KRAS G12C-mutant ampullary adenocarcinoma based on the results from the Phase I CodeBreaK100 (NCT03600883) trial of sotorasib in 28 patients with KRAS G12C-mutant solid tumors, excluding NSCLC and colorectal cancer. In the Phase I CodeBreaK100 (NCT03600883) trial, the cohort demonstrated an objective response rate of 14.3% (95% CI=4.03-32.67), with four patients achieving a partial response and 17 patients achieving stable disease (n=1, patient with ampullary cancer) (PMID: 32955176).13.0PurpleAmpullary CancerSOLIDAmpulla of Vater0.0SOLID['G12C']Sotorasib + CetuximabLEVEL_2LEVEL_Fda2['37870968', '38587856', '36546659', '38177853']Adagrasib and sotorasib are KRAS G12C-targeted inhibitors that have been FDA-approved for the treatment of adult patients with KRAS G12C-mutated non-small cell lung cancer. The NCCN compendium lists KRAS G12C-targeted inhibitors, either adragrasib or sotorasib, in combination with an anti-EGFR monoclonal antibody, either cetuximab or panitumumab, as a treatment for patients with KRAS G12C-mutated colorectal cancer. __In the Phase I-II KRYSTAL-1 trial of adagrasib versus adagrasib plus cetuximab in patients with KRAS G12C-mutated colorectal cancer, the combination therapy group (n=28) demonstrated a response rate of 46% (95% CI=28, 66), a median response duration of 7.6 months (95% CI=5.7, NE) and a median progression-free survival (PFS) of 6.9 months (95% CI=5.4, 8.1), while the monotherapy group (n=43) demonstrated a response rate of 19% (95% CI=8, 33), a median response duration of 4.3 months (95% CI= 2.3, 8.3) and a median PFS of 5.6 months (95% CI=4.1, 8.3) (PMID: 36546659). In an updated analysis of the Phase I-II KRYSTAL-1 trial of adagrasib plus cetuximab in 94 patients with KRAS G12C-mutant colorectal cancer, the cohort demonstrated an objective response rate (ORR) of 34.0%, a median PFS of 6.9 months (95% CI=5.7-7.4) and a median overall survival of 15.9 months (95% CI=11.8-18.8) (PMID: 38587856). __In the Phase 1b dose-exploration and dose-expansion substudy of the CodeBreaK 101 trial of sotorasib plus panitumumab in 48 patients with KRAS G12C-mutated colorectal cancer (dose-exploration cohort, n=8, dose-expansion cohort, n=40), the dose-expansion cohort demonstrated an ORR of 30% (95% CI=16.6, 46.5), with 12 patients (30.0%, 95% CI=16.6, 46.5) achieving a confirmed partial response, a disease control rate of 92.5% (95% CI= 79.6, 98.4), a median PFS of 5.7 months (95% CI=4.2, 7.7), a median overall survival of 15.2 months (95% CI=12.5, not estimable) and tumor shrinkage of any magnitude in 35 patients (87.5%) (PMID: 38177853). In the Phase III CodeBreaK 300 trial of sotorasib plus panitumumab versus standard care in patients with KRAS G12C-mutated refractory metastatic colorectal cancer, the sotorasib 960-mg plus panitumumab therapy group (n=53) demonstrated an ORR of 26.4% (95% CI=15.3, 40.3) with 1 complete response and a median PFS of 5.6 months (95% CI=4.2, 6.3), while the standard care therapy group (n=54) demonstrated an ORR of 0% (95% CI=0.0, 6.6) and a median PFS of 2.2 months (95% CI=1.9, 3.9) (HR=0.49 [95% CI=0.30, 0.80], P=0.006) (PMID: 37870968).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Erdheim-Chester Disease (ECD). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 12/18 patients with ECD, n = 1/12 patients with KRAS R149G, n = 1/12 patients with KRAS G12R), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592).854.0ECDLightSalmonErdheim-Chester DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['32991018', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Langerhans Cell Histiocytosis (LCH). In an open-label, phase II trial (NCT02649972) of cobimetinib in eighteen adult patients with histiocytoses of any mutational status (n = 2/18 patients with LCH, n = 1/2 patients with KRAS G13C), the overall response rate was 89% (90% CI= 73100), 100% of responses were ongoing at one year, and 94% of patients remained progression-free (PMID: 30867592). In a study of three patients with LCH who were treated with trametinib, two patients harbored BRAF N486_P490del mutations, of which one had no reactivation and the other had a partial response, and the third patient with a MEK1 K57_G61del mutation had a complete response with no active disease after 22 months (PMID: 32991018).792.0LCHLightSalmonLangerhans Cell HistiocytosisHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_2LEVEL_Fda3['29236635']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with Rosai-Dorfman Disease. One adult patient with Rosai-Dorfman Disease with an activating KRAS G12R mutation was treated with cobimetinib and a follow-up CT scan two months after treatment showed a substantial response (PMID: 29236635).855.0RDDLightSalmonRosai-Dorfman DiseaseHistiocytosisLIQUIDMyeloidHDCN4.0LIQUID['G12C']AdagrasibLEVEL_3ALEVEL_Fda3['31658955'][{'abstract': 'Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519'}]Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. In a phase II trial (KRYSTAL-1, NCT03785249) of adagrasib in 30 patients with previously treated, inoperable, or metastatic KRAS G12C-mutant gastrointestinal cancers excluding colorectal cancer, preliminary data demonstrated a 100% disease control rate in 27 evaluable patients (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). After a median of 6.3 months, four of eight patients with biliary tract cancer, one patient with gastroesophageal junction cancer, and one with small bowel cancer had partial responses, and all other evaluable patients with GI cancers developed stable disease (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). In a preclinical setting, seventeen of 26 (65%) KRAS G12C-positive cell line and patient-derived xenograft models from multiple tumor types that were treated with adagrasib resulted in tumor regression (PMID: 31658955). Furthermore, case reports of patients with KRAS G12C-positive lung and colon adenocarcinomas have also reported objective responses to adagrasib (PMID: 31658955).96.0LightSkyBlueEsophagogastric CancerSOLIDEsophagus/Stomach0.0SOLID['G12C']AdagrasibLEVEL_3ALEVEL_Fda3['31658955'][{'abstract': 'Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519'}]Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. In a phase II trial (KRYSTAL-1, NCT03785249) of adagrasib in 30 patients with previously treated, inoperable, or metastatic KRAS G12C-mutant gastrointestinal cancers excluding colorectal cancer, preliminary data demonstrated a 100% disease control rate in 27 evaluable patients (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). After a median of 6.3 months, four of eight patients with biliary tract cancer, one patient with gastroesophageal junction cancer, and one with small bowel cancer had partial responses, and all other evaluable patients with GI cancers developed stable disease (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). In a preclinical setting, seventeen of 26 (65%) KRAS G12C-positive cell line and patient-derived xenograft models from multiple tumor types that were treated with adagrasib resulted in tumor regression (PMID: 31658955). Furthermore, case reports of patients with KRAS G12C-positive lung and colon adenocarcinomas have also reported objective responses to adagrasib (PMID: 31658955).34.0SaddleBrownTubular Adenoma of the ColonSOLIDBowel0.0SOLID['G12C']AdagrasibLEVEL_3ALEVEL_Fda3['31658955'][{'abstract': 'Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519'}]Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. In a phase II trial (KRYSTAL-1, NCT03785249) of adagrasib in 30 patients with previously treated, inoperable, or metastatic KRAS G12C-mutant gastrointestinal cancers excluding colorectal cancer, preliminary data demonstrated a 100% disease control rate in 27 evaluable patients (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). After a median of 6.3 months, four of eight patients with biliary tract cancer, one patient with gastroesophageal junction cancer, and one with small bowel cancer had partial responses, and all other evaluable patients with GI cancers developed stable disease (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). In a preclinical setting, seventeen of 26 (65%) KRAS G12C-positive cell line and patient-derived xenograft models from multiple tumor types that were treated with adagrasib resulted in tumor regression (PMID: 31658955). Furthermore, case reports of patients with KRAS G12C-positive lung and colon adenocarcinomas have also reported objective responses to adagrasib (PMID: 31658955).71.0LightSkyBlueGastrointestinal Neuroendocrine Tumors of the Esophagus/StomachSOLIDEsophagus/Stomach0.0SOLID['G12C']AdagrasibLEVEL_3ALEVEL_Fda3['31658955'][{'abstract': 'Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519'}]Adagrasib is a covalent inhibitor of KRAS G12C that is FDA-approved for patients with KRAS G12C-mutated non-small cell lung cancer. In a phase II trial (KRYSTAL-1, NCT03785249) of adagrasib in 30 patients with previously treated, inoperable, or metastatic KRAS G12C-mutant gastrointestinal cancers excluding colorectal cancer, preliminary data demonstrated a 100% disease control rate in 27 evaluable patients (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). After a median of 6.3 months, four of eight patients with biliary tract cancer, one patient with gastroesophageal junction cancer, and one with small bowel cancer had partial responses, and all other evaluable patients with GI cancers developed stable disease (Abstract: Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022. https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519). In a preclinical setting, seventeen of 26 (65%) KRAS G12C-positive cell line and patient-derived xenograft models from multiple tumor types that were treated with adagrasib resulted in tumor regression (PMID: 31658955). Furthermore, case reports of patients with KRAS G12C-positive lung and colon adenocarcinomas have also reported objective responses to adagrasib (PMID: 31658955).91.0SaddleBrownAnal CancerSOLIDBowel0.0SOLID['Oncogenic Mutations']CobimetinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).38.0LightSalmonHistiocytosisLIQUIDMyeloid0.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_3ALEVEL_Fda3['30361829', '29236635', '30867592']Trametinib and cobimetinib are MEK1/2 kinase inhibitors that are FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations and are NCCN-listed for patients with histiocytic neoplasms harboring MAPK pathway mutations. In a Phase II trial of cobimetinib in eighteen patients with histiocytoses, the overall response rate was 89%, with 13/18 patients (72%) having a complete response and 15/18 patients harboring a MAPK pathway mutation (PMID: 30867592). All three patients harboring KRAS mutations had a partial or complete response to treatment with cobimetinib (PMID: 30867592). Small case studies have also demonstrated the clinical efficacy of MEK inhibition in patients with histiocytic neoplasms (PMID: 29236635). In a case study of one eighteen-year-old patient with refractory histiocytic sarcoma harboring a pathogenic variant of MAP2K1 (F53L), the patient was treated with trametinib and showed an excellent response prior to treatment interruption due to severe adverse events (PMID: 30361829).38.0LightSalmonHistiocytosisLIQUIDMyeloid0.0LIQUID['Oncogenic Mutations']TrametinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']CobimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).5.0All Solid TumorsSOLID-1.0SOLID['Oncogenic Mutations']BinimetinibLEVEL_4LEVEL_Fda3['33933896', '25435214', '24746704', '23934108']Trametinib, cobimetinib, and binimetinib are MEK1/2 kinase inhibitors that are NCCN-listed and FDA-approved for patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations. In a multicenter, single-arm, open-label, phase IB trial (NCT02964689) of binimetinib in combination with cisplatin and pemetrexed in fourteen evaluable patients with stage III-IV NSCLC with KRAS (codon 12, 13 or 61) mutations, the overall response rate was 33% (95% CI=770) among the nine patients that received binimetinib, where three of nine patients had a partial response, two of nine had stable disease, three of nine had progressive disease, and one of nine was not assessable for response (PMID: 33933896). On average, in vitro studies have shown that trametinib inhibits the proliferation of KRAS mutant cancer cell lines (n = 50) with lower IC50s than other MEK inhibitors, including selumetinib (PMID: 24746704). Cobimetinib, which inhibits the kinase activity of MEK but allows the induction of RAF-dependent feedback phosphorylation of MEK, was demonstrated to be less effective in KRAS-mutant tumors than in BRAF-mutant tumors (PMID: 25435214, 23934108).5.0All Solid TumorsSOLID-1.0SOLID25705018;38096473;24256730;28572459;16051643;32792368;26841430;Fakih et al. Abstract# 3003, ASCO 2019.(https://meetinglibrary.asco.org/record/172411/abstract)Trametinib,Cobimetinib,Binimetinib20921465;21228335;20619739;24024839;18316791;30857956;35658005;Gadgeel, S. et al., Abstract# MA06.04, Journal of Thoracic Oncology Vol. 18.(https://www.jto.org/article/S1556-0864%2823%2900954-1/fulltext);38587856;40644648;38157806;34096690;32955176;37098232;36764316;37870968;37099736;31658955;Pant et al. Abstract # 425082, ASCO Monthly Plenary Series April 2023.(https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.36_suppl.425082);36546659;38177853;30867592;32991018;29236635;Strickler et al. Abstract# 360490, ASCO GI 2022.(https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.36_suppl.360490);Bekaii-Saab et al. Abstract# 519, ASCO GI Symposium, 2022.(https://ascopubs.org/doi/abs/10.1200/JCO.2022.40.4_suppl.519);30361829;33933896;25435214;24746704;23934108JMML,MDSETPLL10049057;23832011;25691160;26457647;12717436;22934674;23512829;22237106100Amissense_variantKRAS3845GeneENST00000256078.4ENST00000256078.4:c.34G>TNP_004976.2:p.Gly12Cys78GLY12CYS/RS121913530https://civicdb.org/links/variants/78KRAS_G12C78NM_004985.4:c.34G>T/NP_004976.2:p.Gly12Cys/NC_000012.11:g.25398285C>A/ENST00000256078.4:c.34G>TCA12252812578
TUMORchr1257748512N<DUP>PASSNM_000075coding_sequence_variant&5_prime_UTR_variant&3_prime_UTR_variant&intron_variantMODIFIERCDK41-8/81-7/7nanduplicationv7.0.LEVEL_Fda3False11/08/2024LEVEL_444728DUPTrueTrueTrueGain-of-functionOncogenicLEVEL_4.0/1GRCh38CDK4N<DUP>5'UTRINSN57748512MantaDUP:CDK4_AMP.GT:PR:SR0/1:32,24:13,10duplicationENSG00000135446TranscriptENST00000257904protein_coding?-1079-1HGNCHGNC:1773YESMANE_SelectNM_000075.41P1CCDS8953.1ENSP00000257904P11802.259UPI0000113582P11802-1Ensembl10,10,157793240.False.CDK4 amplification results from the gain of the CDK4 gene on chromosome 12q13-14. Often, this leads to the overexpression of CDK4 protein, which has been demonstrated to induce hyperplasia and malignant transformation of human fibroblasts and astrocytes (PMID: 8101826, 10970848, 20534551). CDK4 overexpression is mutually exclusive with other genetic events in the same pathway, such as truncating mutations in RB1 or CDKN2A, and leads to the constitutive activation of the cell cycle. Mechanistically, increased availability of CDK4 results in the formation of CDK4/6-cyclin D complexes that are able to overcome p16-mediated inhibition and lead to cell cycle progression (PMID: 28303264). CDK4-amplified tumors are sensitive to inhibition with CDK4/6 inhibitors such as palbociclib and abemaciclib (PMID: 25028469, 23569312)..CDK4, an intracellular kinase, is altered by amplification or mutation in various cancer types including soft tissue sarcomas and gliomas...23569312|28303264|25028469|20534551|8101826|10970848..Amplification1019CDK4GRCh38.CNA..CDK4 amplification is known to be oncogenic.FalseLEVEL_Fda3CDK4 amplification results from the gain of the CDK4 gene on chromosome 12q13-14. Often, this leads to the overexpression of CDK4 protein, which has been demonstrated to induce hyperplasia and malignant transformation of human fibroblasts and astrocytes (PMID: 8101826, 10970848, 20534551). CDK4 overexpression is mutually exclusive with other genetic events in the same pathway, such as truncating mutations in RB1 or CDKN2A, and leads to the constitutive activation of the cell cycle. Mechanistically, increased availability of CDK4 results in the formation of CDK4/6-cyclin D complexes that are able to overcome p16-mediated inhibition and lead to cell cycle progression (PMID: 28303264). CDK4-amplified tumors are sensitive to inhibition with CDK4/6 inhibitors such as palbociclib and abemaciclib (PMID: 25028469, 23569312).['23569312', '28303264', '25028469', '20534551', '8101826', '10970848']['Amplification']PalbociclibLEVEL_4LEVEL_Fda3['37343202', '27124835', '23569312']Palbociclib and abemaciclib are small molecule inhibitors of cyclin-dependent kinases 4 and 6 (CDK4/6) that prevent downstream degradation of the RB tumor suppressor protein and are FDA-approved for use in patients with estrogen receptor-positive breast cancer. The NCCN recommends palbociclib as category 2A for patients with well-differentiated/dedifferentiated liposarcoma (WD-DDLS) based on the results of a Phase II study of palbociclib in CDK4-amplified, RB-positive WD-DDLS which showed a twelve-week progression-free survival of 66%, significantly exceeding the progression-free survival (PFS) goal of 40% (PMID: 23569312). A second phase II trial of palbociclib in patients with CDK4-amplified, RB-positive WD-DDLS showed that even with a lower dose of palbociclib, progression-free survival at twelve weeks was 57.2% (95% CI=42.4%-68.8%), which included one patient with a complete response (PMID: 27124835). In a case report, a patient with CDK4-amplified and MDM2-amplified WD-DDLS was treated with abemaciclib and demonstrated partial radiologic and near-complete pathological response (PMID: 37343202).514.0DDLSLightYellowDedifferentiated LiposarcomaSoft Tissue SarcomaMIXEDSoft TissueLIPO3.0SOLID['Amplification']PalbociclibLEVEL_4LEVEL_Fda3['37343202', '27124835', '23569312']Palbociclib and abemaciclib are small molecule inhibitors of cyclin-dependent kinases 4 and 6 (CDK4/6) that prevent downstream degradation of the RB tumor suppressor protein and are FDA-approved for use in patients with estrogen receptor-positive breast cancer. The NCCN recommends palbociclib as category 2A for patients with well-differentiated/dedifferentiated liposarcoma (WD-DDLS) based on the results of a Phase II study of palbociclib in CDK4-amplified, RB-positive WD-DDLS which showed a twelve-week progression-free survival of 66%, significantly exceeding the progression-free survival (PFS) goal of 40% (PMID: 23569312). A second phase II trial of palbociclib in patients with CDK4-amplified, RB-positive WD-DDLS showed that even with a lower dose of palbociclib, progression-free survival at twelve weeks was 57.2% (95% CI=42.4%-68.8%), which included one patient with a complete response (PMID: 27124835). In a case report, a patient with CDK4-amplified and MDM2-amplified WD-DDLS was treated with abemaciclib and demonstrated partial radiologic and near-complete pathological response (PMID: 37343202).647.0WDLSLightYellowWell-Differentiated LiposarcomaSoft Tissue SarcomaMIXEDSoft TissueLIPO3.0SOLID['Amplification']AbemaciclibLEVEL_4LEVEL_Fda3['37343202', '27124835', '23569312']Palbociclib and abemaciclib are small molecule inhibitors of cyclin-dependent kinases 4 and 6 (CDK4/6) that prevent downstream degradation of the RB tumor suppressor protein and are FDA-approved for use in patients with estrogen receptor-positive breast cancer. The NCCN recommends palbociclib as category 2A for patients with well-differentiated/dedifferentiated liposarcoma (WD-DDLS) based on the results of a Phase II study of palbociclib in CDK4-amplified, RB-positive WD-DDLS which showed a twelve-week progression-free survival of 66%, significantly exceeding the progression-free survival (PFS) goal of 40% (PMID: 23569312). A second phase II trial of palbociclib in patients with CDK4-amplified, RB-positive WD-DDLS showed that even with a lower dose of palbociclib, progression-free survival at twelve weeks was 57.2% (95% CI=42.4%-68.8%), which included one patient with a complete response (PMID: 27124835). In a case report, a patient with CDK4-amplified and MDM2-amplified WD-DDLS was treated with abemaciclib and demonstrated partial radiologic and near-complete pathological response (PMID: 37343202).514.0DDLSLightYellowDedifferentiated LiposarcomaSoft Tissue SarcomaMIXEDSoft TissueLIPO3.0SOLID['Amplification']AbemaciclibLEVEL_4LEVEL_Fda3['37343202', '27124835', '23569312']Palbociclib and abemaciclib are small molecule inhibitors of cyclin-dependent kinases 4 and 6 (CDK4/6) that prevent downstream degradation of the RB tumor suppressor protein and are FDA-approved for use in patients with estrogen receptor-positive breast cancer. The NCCN recommends palbociclib as category 2A for patients with well-differentiated/dedifferentiated liposarcoma (WD-DDLS) based on the results of a Phase II study of palbociclib in CDK4-amplified, RB-positive WD-DDLS which showed a twelve-week progression-free survival of 66%, significantly exceeding the progression-free survival (PFS) goal of 40% (PMID: 23569312). A second phase II trial of palbociclib in patients with CDK4-amplified, RB-positive WD-DDLS showed that even with a lower dose of palbociclib, progression-free survival at twelve weeks was 57.2% (95% CI=42.4%-68.8%), which included one patient with a complete response (PMID: 27124835). In a case report, a patient with CDK4-amplified and MDM2-amplified WD-DDLS was treated with abemaciclib and demonstrated partial radiologic and near-complete pathological response (PMID: 37343202).647.0WDLSLightYellowWell-Differentiated LiposarcomaSoft Tissue SarcomaMIXEDSoft TissueLIPO3.0SOLID23569312;28303264;25028469;20534551;8101826;10970848Palbociclib,Abemaciclib32,2413,10
TUMORp.L3101RENSP00000369497.3:p.Leu3101Argchr1332394734TGPASSNM_000059missense_variantMODERATEBRCA225/27c.9302T>Grs28897758SNVdeleterious(0)possibly_damaging(0.888)4.857e-056.568e-066.206e-05gnomADe_NFE0.000.000.000.000.6718.0300e-01NICE_approved_PARP_inhibitor_treatment&Inherited_breast_cancer_and_ovarian_cancer&BRCA2-related_cancer_predisposition&Hereditary_cancer-predisposing_syndrome&Breast_and/or_ovarian_cancer&not_provided&Hereditary_breast_ovarian_cancer_syndrome&Breast-ovarian_cancer&_familial&_susceptibility_to&_2&Familial_cancer_of_breastNC_000013.11:g.32394734T>Gcriteria_provided&_multiple_submitters&_no_conflictsPathogenic/Likely_pathogenic1v7.0.LEVEL_Fda2False06/11/2024LEVEL_1TrueTrueTrueLikely Loss-of-functionLikely OncogenicNiraparib,Niraparib+Abiraterone Acetate+Prednisone,Olaparib,Olaparib+Abiraterone+Prednisone,Rucaparib,Talazoparib+Enzalutamide,Olaparib+BevacizumabOlaparib,Rucaparib,NiraparibOlaparib,TalazoparibLEVEL_1LEVEL_165,250/10.2777777777777778GRCh38BRCA2TGMissense_MutationSNPT32394734BRCA2_L3101R.GT:AD:AF:DP0/1:65,25:0.28:90GENSG00000139618TranscriptENST00000380152protein_coding950193023101L/RcTg/cGg1HGNCHGNC:1101YESMANE_SelectNM_000059.45A2CCDS9344.1ENSP00000369497P51587.244UPI00001FCBCCEnsemblTT1Gene3D:2.40.50.140&Pfam:PF09104&PIRSF:PIRSF002397&PANTHER:PTHR11289&Superfamily:SSF50249&CDD:cd044952.987e-05000006.206e-051.656e-05000000001.47e-0500pathogenic/likely_pathogenic&likely_pathogenic&pathogenic125741868&10923033&19043619&36061650FAIL-45-18-241BRCA23823046786.&.&MONDO:MONDO:0700269&MedGen:CN377758&MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MedGen:CN221562&MedGen:C3661900&MONDO:MONDO:0003582&MeSH:D061325&MedGen:C0677776&Orphanet:145&MONDO:MONDO:0012933&MedGen:C2675520&OMIM:612555&Orphanet:145&MONDO:MONDO:0016419&MedGen:C0346153&OMIM:114480&Orphanet:227535SCV000073800&SCV000213068&SCV000567965&SCV000800821&SCV000903964&SCV001362773&SCV001474032&SCV002041912&SCV004212907&SCV004220650&SCV004846155&SCV005068350&SCV005196391&SCV006277502single_nucleotide_variantSO:0001483ClinGen:CA026098BRCA2:675SO:0001583&missense_variant28897758.True.The BRCA2 L3101R mutation is located in the DNA-binding domain of the protein (PMID: 35736817). In vitro studies have demonstrated that this mutation is inactivating as measured by loss of homology-directed DNA repair (HDR) in an in vitro HDR assay (PMID: 35736817). Germline BRCA2 L3101R mutations are considered likely pathogenic by the ACMG framework classification (PMID: 35736817)..BRCA2, a tumor suppressor involved in the DNA damage response, is mutated in various cancer types...35736817..L3101R675BRCA2GRCh38.MUTATION..The BRCA2 L3101R mutation is likely oncogenic.FalseLEVEL_Fda2The BRCA2 L3101R mutation is located in the DNA-binding domain of the protein (PMID: 35736817). In vitro studies have demonstrated that this mutation is inactivating as measured by loss of homology-directed DNA repair (HDR) in an in vitro HDR assay (PMID: 35736817). Germline BRCA2 L3101R mutations are considered likely pathogenic by the ACMG framework classification (PMID: 35736817).['35736817']['Oncogenic Mutations']NiraparibLEVEL_1LEVEL_Fda2['30948273', '27717299', '31562799']Niraparib, a small molecule PARP inhibitor, is FDA-approved as maintenance therapy for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status such as by harboring a deleterious or suspected deleterious BRCA mutation. FDA approval was based on the Phase III NOVA trial of niraparib versus placebo in patients with platinum-sensitive, recurrent ovarian cancer with or without BRCA1/2 mutations in which patients in the germline BRCA mutant cohort (n=203) experienced significantly longer progression-free survival with niraparib than those in the placebo group (21.0 vs. 5.5 months, HR=0.27, 95% CI = 0.17-0.41) (PMID: 27717299). FDA approval of niraparib in the non-germline BRCA mutant patient cohort (n=350) was based on the results of improved progression-free survival with niraparib versus placebo as maintenance therapy (9.3 months vs. 3.9 months, HR=0.45, 95% CI= 0.34-0.61) in the overall non-germline BRCA cohort. However, the overall non-germline BRCA cohort included patients with somatic BRCA mutation (PMID: 27717299). Further studies have shown the efficacy of niraparib in patients with homologous-recombination-deficient, platinum-sensitive ovarian cancer, including patients with BRCA mutation (PMID: 30948273, 31562799). The NCCN v5.2022 lists niraparib as a maintenance therapy for patients with BRCA1/2-mutant ovarian cancer.224.0PSECGreenPeritoneal Serous CarcinomaPeritoneal Cancer, NOSSOLIDPeritoneumPERITONEUM2.0SOLID['Oncogenic Mutations']NiraparibLEVEL_1LEVEL_Fda2['30948273', '27717299', '31562799']Niraparib, a small molecule PARP inhibitor, is FDA-approved as maintenance therapy for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status such as by harboring a deleterious or suspected deleterious BRCA mutation. FDA approval was based on the Phase III NOVA trial of niraparib versus placebo in patients with platinum-sensitive, recurrent ovarian cancer with or without BRCA1/2 mutations in which patients in the germline BRCA mutant cohort (n=203) experienced significantly longer progression-free survival with niraparib than those in the placebo group (21.0 vs. 5.5 months, HR=0.27, 95% CI = 0.17-0.41) (PMID: 27717299). FDA approval of niraparib in the non-germline BRCA mutant patient cohort (n=350) was based on the results of improved progression-free survival with niraparib versus placebo as maintenance therapy (9.3 months vs. 3.9 months, HR=0.45, 95% CI= 0.34-0.61) in the overall non-germline BRCA cohort. However, the overall non-germline BRCA cohort included patients with somatic BRCA mutation (PMID: 27717299). Further studies have shown the efficacy of niraparib in patients with homologous-recombination-deficient, platinum-sensitive ovarian cancer, including patients with BRCA mutation (PMID: 30948273, 31562799). The NCCN v5.2022 lists niraparib as a maintenance therapy for patients with BRCA1/2-mutant ovarian cancer.152.0OVARYLightBlueOvary/Fallopian TubeOvarian/Fallopian Tube CancerSOLIDOvary/Fallopian TubeTISSUE1.0SOLID['Oncogenic Mutations']NiraparibLEVEL_1LEVEL_Fda2['30948273', '27717299', '31562799']Niraparib, a small molecule PARP inhibitor, is FDA-approved as maintenance therapy for the treatment of adult patients with advanced ovarian, fallopian tube, or primary peritoneal cancer who have been treated with three or more prior chemotherapy regimens and whose cancer is associated with homologous recombination deficiency (HRD) positive status such as by harboring a deleterious or suspected deleterious BRCA mutation. FDA approval was based on the Phase III NOVA trial of niraparib versus placebo in patients with platinum-sensitive, recurrent ovarian cancer with or without BRCA1/2 mutations in which patients in the germline BRCA mutant cohort (n=203) experienced significantly longer progression-free survival with niraparib than those in the placebo group (21.0 vs. 5.5 months, HR=0.27, 95% CI = 0.17-0.41) (PMID: 27717299). FDA approval of niraparib in the non-germline BRCA mutant patient cohort (n=350) was based on the results of improved progression-free survival with niraparib versus placebo as maintenance therapy (9.3 months vs. 3.9 months, HR=0.45, 95% CI= 0.34-0.61) in the overall non-germline BRCA cohort. However, the overall non-germline BRCA cohort included patients with somatic BRCA mutation (PMID: 27717299). Further studies have shown the efficacy of niraparib in patients with homologous-recombination-deficient, platinum-sensitive ovarian cancer, including patients with BRCA mutation (PMID: 30948273, 31562799). The NCCN v5.2022 lists niraparib as a maintenance therapy for patients with BRCA1/2-mutant ovarian cancer.60.0LightBlueOvarian CancerSOLIDOvary/Fallopian Tube0.0SOLID['Oncogenic Mutations']Niraparib + Abiraterone Acetate + PrednisoneLEVEL_1LEVEL_Fda2['41057655', '36952634']Niraparib, a small molecule PARP inhibitor, and abiraterone acetate, a CYP17 inhibitor, are FDA-approved in combination with prednisone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated metastatic castration-resistant prostate cancer (mCRPC), based on an FDA-approved test. BRCA2 mutations for treatment with niraparib and abiraterone acetate plus prednisone were detected with the FoundationOne CDx and FoundationOne Liquid CDx. FDA approval was based on the results of the Phase III MAGNITUDE (NCT03748641) trial of niraparib versus placebo, both with combination abiraterone acetate and prednisone, in 423 patients with homologous recombination repair gene-mutated mCRPC. _In the Phase III MAGNITUDE (NCT03748641) trial for patients with BRCA1/2 mutations, the niraparib and abiraterone acetate plus prednisone cohort (n=113) demonstrated a median radiographic progression-free survival (rPFS) of 16.6 months (95% CI=13-NE) versus 10.9 months (95% CI = 8.3, 13.8) in the placebo and abiraterone acetate plus prednisone cohort (n=112) (HR=0.53 [95% CI=0.36-0.79], p<0.0014) (PMID: 36952634). In an exploratory overall survival (OS) analysis of the BRCA1/2 mutant subgroups, the niraparib cohort demonstrated a median OS of 30.4 months (95% CI=27.6-NE) versus 28.6 months (95% CI=23.8-33.0) (HR=0.79 (95% CI=0.55-1.12) (PMID: 36952634)._Niraparib with abiraterone acetate and prednisone is also FDA-approved for the treatment of adult patients with deleterious or suspected deleterious BRCA2-mutated metastatic castration-sensitive prostate cancer (mCSPC), based on an FDA-approved test. BRCA2 mutations for treatment with niraparib and abiraterone acetate plus prednisone in mCSPC were detected with the FoundationOne CDx and FoundationOne Liquid CDx. FDA approval for mCSPC was based on the Phase III AMPLITUDE (NCT04497844) trial of niraparib versus placebo, both with combination abiraterone acetate and prednisone, in 696 patients with homologous recombination repair (HRR) gene-mutated (HRRm) mCSPC._In the Phase III AMPLITUDE (NCT04497844) trial for patients with BRCA2 mutations (n=323), the niraparib and abiraterone acetate plus prednisone cohort demonstrated a median rPFS that was not estimable (95% CI=41-NE) versus 26 months (95% CI = 18-28) in the placebo and abiraterone acetate plus prednisone cohort (HR=0.46 (95% CI: 0.32-0.66)) (PMID: 41057655).88.0CyanProstate CancerSOLIDProstate0.0SOLID['Oncogenic Mutations']OlaparibLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434'][{'abstract': 'Penson et al. Abstract# 5506, ASCO 2019.', 'link': 'https://meetinglibrary.asco.org/record/173435/abstract'}]Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).224.0PSECGreenPeritoneal Serous CarcinomaPeritoneal Cancer, NOSSOLIDPeritoneumPERITONEUM2.0SOLID['Oncogenic Mutations']OlaparibLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434'][{'abstract': 'Penson et al. Abstract# 5506, ASCO 2019.', 'link': 'https://meetinglibrary.asco.org/record/173435/abstract'}]Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).152.0OVARYLightBlueOvary/Fallopian TubeOvarian/Fallopian Tube CancerSOLIDOvary/Fallopian TubeTISSUE1.0SOLID['Oncogenic Mutations']OlaparibLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434'][{'abstract': 'Penson et al. Abstract# 5506, ASCO 2019.', 'link': 'https://meetinglibrary.asco.org/record/173435/abstract'}]Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).60.0LightBlueOvarian CancerSOLIDOvary/Fallopian Tube0.0SOLID['Oncogenic Mutations']OlaparibLEVEL_1LEVEL_Fda2['32343890']Olaparib is an orally available, small molecule PARP inhibitor that is FDA-approved for the treatment of adult patients with deleterious or suspected deleterious germline or somatic homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC) who have progressed following prior treatment with enzalutamide or abiraterone, based on an FDA-approved companion diagnostic. BRCA2 mutations for treatment with olaparib were detected by the FoundationOne CDx, BRACAnalysis CDx or the FoundationOne Liquid CDx. FDA approval was based on the results of the Phase III PROfound (NCT02987543) trial of olaparib in adult patients with mCRPC who had disease progression while receiving a new hormonal agent and who had a deleterious or suspected deleterious mutation in a homologous recombination repair gene. _In the Phase III PROfound (NCT02987543) trial, the BRCA2 (n=128) and BRCA1 (n=13) mutation cohorts treated with olaparib demonstrated a progression-free survival (PFS) of 9.8 months versus 3.0 months in the placebo cohorts (HR= 0.22 [95% CI=0.15-0.32]) (PMID: 32343890). The median overall survival was 19.1 months and 15.1 months (HR=0.61 [95% CI=0.37-1.01]) in the olaparib cohort versus placebo cohort, respectively (PMID: 32343890).88.0CyanProstate CancerSOLIDProstate0.0SOLID['Oncogenic Mutations']Olaparib + Abiraterone + PrednisoneLEVEL_1LEVEL_Fda2['37714168']Olaparib is an orally available, small-molecule PARP inhibitor that is FDA-approved in combination with abiraterone and prednisone/prednisolone for the treatment of adult patients with deleterious or suspected deleterious BRCA-mutated (BRCAm) metastatic castration-resistant prostate cancer (mCRPC), as determined by an FDA-approved companion diagnostic test. BRCA mutations for treatment with olaparib were detected with the FoundationOne CDx or the FoundationOne Liquid CDx. FDA approval was based on the results of the Phase III PROpel (NCT03732820) trial of olaparib plus abiraterone and prednisone/prednisolone in 796 adult patients with mCRPC undergoing first-line treatment after failure of primary androgen deprivation therapy. _In the Phase III PROpel (NCT03732820) trial, patients with BRCAm mCRPC in the olaparib plus abiraterone and prednisone/prednisolone cohort (n=47) did not reach a median radiological progression-free survival (rPFS) (95% CI=NR-NR) and demonstrated a median overall survival (OS) of 42.1 months (95% CI=38.4-NR) (PMID: 37714168). Patients with BRCAm mCRPC in the placebo plus abiraterone and prednisone/prednisolone cohort (n=38) demonstrated a median rPFS of 8 months (95% CI=6-15) (HR=0.24 [95% CI=0.12-0.45]) and a median OS of 34.7 months (95% CI=31.0-39.3)(HR=0.81 [95% CI=0.67-1.00], p=0.054) (PMID: 37714168).88.0CyanProstate CancerSOLIDProstate0.0SOLID['Oncogenic Mutations']RucaparibLEVEL_1LEVEL_Fda2['35658487', '40580808']Rucaparib is an orally available, small-molecule PARP inhibitor that is FDA-approved for the maintenance treatment of adult patients with a deleterious BRCA mutation (germline and/or somatic)- associated recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in a complete or partial response to platinum-based chemotherapy. BRCA1 mutations for maintenance treatment with rucaparib were detected by the BRACAnalysis CDx or the FoundationFocus CDxBRCA Assay. FDA approval was based on the results of the Phase III ARIEL3 (NCT01968213) trial of rucaparib versus placebo in 564 patients with epithelial ovarian, fallopian tube, or primary peritoneal cancer. Additionally, rucaparib is NCCN-recommended as a first-line maintenance treatment in newly diagnosed patients with advanced ovarian cancer based on the results of the Phase III ATHENA-MONO (NCT03522246) trial of rucaparib versus placebo in patients with newly diagnosed BRCA-mutated ovarian cancer.__In the Phase III ARIEL3 (NCT01968213) trial, the rucaparib cohort (n=375 [BRCA1 mutated, n=80, BRCA2 mutated, n=50, Germline BRCA1 and BRCA2 mutated, n=82, Somatic BRCA1 and BRCA2 mutated, n=40]) (epithelial ovarian cancer, n=312, fallopian tube cancer, n=32, primary peritoneal cancer, n=31) demonstrated a median OS of 45.9 months (95% CI-37.7-59.6) and a median time to disease progression on subsequent therapy or death (PFS2) of 26.1 months (95% CI=22.8-32.8) in the BRCA-mutated subgroup (PMID: 40580808). In the placebo cohort (n=189 [BRCA1 mutated, n=37, BRCA2 mutated, n=29, Germline BRCA1 and BRCA2 mutated, n=48, Somatic BRCA1 and BRCA2 mutated, n=16]) (epithelial ovarian cancer, n=159, fallopian tube cancer, n=10, primary peritoneal cancer, n=19, high-grade serous adenocarcinoma, n=1), the median OS was 47.8 months. (95% CI=43.2-55.8) (HR=0.83 [95% CI=0.58-1.19]) and the median PFS2 was 18.2 months (95% CI=15.7-24.4) (HR=0.67 [95% CI=0.48-0.94]) in the BRCA-mutated subgroup (PMID: 40580808).__In the Phase III ATHENA-MONO (NCT03522246) trial, the homologous recombination deficiency (HRD) population was treated with either rucaparib (n=185 [BRCA mutated, n=91, BRCA wildtype/loss of heterozygosity [LOH] high, n=94] or placebo (n=49 [BRCA mutated, n=24, BRCA wildtype/LOH high, n=25] (PMID: 35658487). Of the rucaparib cohort, the median progression-free survival (PFS) was 28.7 months (95% CI=23.0-NR) and the objective response rate (ORR) was 58.8% (95% CI=32.9-81.6), with a 58.8% (n=10) partial response (PR) rate, 35.3% (n=6) stable disease (SD) rate and 5.9% (n=1) progressive disease (PD) rate (PMID: 35658487). Of the placebo cohort, the median PFS was 11.3 months (95% CI=9.1-22.1) (HR=0.47 [95% CI=0.31-22.1], p=0.0004) and the ORR was 20.0% (95% CI=0.5-71.6), with a 20% (n=1) PR rate, 40% (n=2) SD rate and 40% (n=2) PD rate (PMID: 35658487).224.0PSECGreenPeritoneal Serous CarcinomaPeritoneal Cancer, NOSSOLIDPeritoneumPERITONEUM2.0SOLID['Oncogenic Mutations']RucaparibLEVEL_1LEVEL_Fda2['35658487', '40580808']Rucaparib is an orally available, small-molecule PARP inhibitor that is FDA-approved for the maintenance treatment of adult patients with a deleterious BRCA mutation (germline and/or somatic)- associated recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in a complete or partial response to platinum-based chemotherapy. BRCA1 mutations for maintenance treatment with rucaparib were detected by the BRACAnalysis CDx or the FoundationFocus CDxBRCA Assay. FDA approval was based on the results of the Phase III ARIEL3 (NCT01968213) trial of rucaparib versus placebo in 564 patients with epithelial ovarian, fallopian tube, or primary peritoneal cancer. Additionally, rucaparib is NCCN-recommended as a first-line maintenance treatment in newly diagnosed patients with advanced ovarian cancer based on the results of the Phase III ATHENA-MONO (NCT03522246) trial of rucaparib versus placebo in patients with newly diagnosed BRCA-mutated ovarian cancer.__In the Phase III ARIEL3 (NCT01968213) trial, the rucaparib cohort (n=375 [BRCA1 mutated, n=80, BRCA2 mutated, n=50, Germline BRCA1 and BRCA2 mutated, n=82, Somatic BRCA1 and BRCA2 mutated, n=40]) (epithelial ovarian cancer, n=312, fallopian tube cancer, n=32, primary peritoneal cancer, n=31) demonstrated a median OS of 45.9 months (95% CI-37.7-59.6) and a median time to disease progression on subsequent therapy or death (PFS2) of 26.1 months (95% CI=22.8-32.8) in the BRCA-mutated subgroup (PMID: 40580808). In the placebo cohort (n=189 [BRCA1 mutated, n=37, BRCA2 mutated, n=29, Germline BRCA1 and BRCA2 mutated, n=48, Somatic BRCA1 and BRCA2 mutated, n=16]) (epithelial ovarian cancer, n=159, fallopian tube cancer, n=10, primary peritoneal cancer, n=19, high-grade serous adenocarcinoma, n=1), the median OS was 47.8 months. (95% CI=43.2-55.8) (HR=0.83 [95% CI=0.58-1.19]) and the median PFS2 was 18.2 months (95% CI=15.7-24.4) (HR=0.67 [95% CI=0.48-0.94]) in the BRCA-mutated subgroup (PMID: 40580808).__In the Phase III ATHENA-MONO (NCT03522246) trial, the homologous recombination deficiency (HRD) population was treated with either rucaparib (n=185 [BRCA mutated, n=91, BRCA wildtype/loss of heterozygosity [LOH] high, n=94] or placebo (n=49 [BRCA mutated, n=24, BRCA wildtype/LOH high, n=25] (PMID: 35658487). Of the rucaparib cohort, the median progression-free survival (PFS) was 28.7 months (95% CI=23.0-NR) and the objective response rate (ORR) was 58.8% (95% CI=32.9-81.6), with a 58.8% (n=10) partial response (PR) rate, 35.3% (n=6) stable disease (SD) rate and 5.9% (n=1) progressive disease (PD) rate (PMID: 35658487). Of the placebo cohort, the median PFS was 11.3 months (95% CI=9.1-22.1) (HR=0.47 [95% CI=0.31-22.1], p=0.0004) and the ORR was 20.0% (95% CI=0.5-71.6), with a 20% (n=1) PR rate, 40% (n=2) SD rate and 40% (n=2) PD rate (PMID: 35658487).152.0OVARYLightBlueOvary/Fallopian TubeOvarian/Fallopian Tube CancerSOLIDOvary/Fallopian TubeTISSUE1.0SOLID['Oncogenic Mutations']RucaparibLEVEL_1LEVEL_Fda2['35658487', '40580808']Rucaparib is an orally available, small-molecule PARP inhibitor that is FDA-approved for the maintenance treatment of adult patients with a deleterious BRCA mutation (germline and/or somatic)- associated recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are in a complete or partial response to platinum-based chemotherapy. BRCA1 mutations for maintenance treatment with rucaparib were detected by the BRACAnalysis CDx or the FoundationFocus CDxBRCA Assay. FDA approval was based on the results of the Phase III ARIEL3 (NCT01968213) trial of rucaparib versus placebo in 564 patients with epithelial ovarian, fallopian tube, or primary peritoneal cancer. Additionally, rucaparib is NCCN-recommended as a first-line maintenance treatment in newly diagnosed patients with advanced ovarian cancer based on the results of the Phase III ATHENA-MONO (NCT03522246) trial of rucaparib versus placebo in patients with newly diagnosed BRCA-mutated ovarian cancer.__In the Phase III ARIEL3 (NCT01968213) trial, the rucaparib cohort (n=375 [BRCA1 mutated, n=80, BRCA2 mutated, n=50, Germline BRCA1 and BRCA2 mutated, n=82, Somatic BRCA1 and BRCA2 mutated, n=40]) (epithelial ovarian cancer, n=312, fallopian tube cancer, n=32, primary peritoneal cancer, n=31) demonstrated a median OS of 45.9 months (95% CI-37.7-59.6) and a median time to disease progression on subsequent therapy or death (PFS2) of 26.1 months (95% CI=22.8-32.8) in the BRCA-mutated subgroup (PMID: 40580808). In the placebo cohort (n=189 [BRCA1 mutated, n=37, BRCA2 mutated, n=29, Germline BRCA1 and BRCA2 mutated, n=48, Somatic BRCA1 and BRCA2 mutated, n=16]) (epithelial ovarian cancer, n=159, fallopian tube cancer, n=10, primary peritoneal cancer, n=19, high-grade serous adenocarcinoma, n=1), the median OS was 47.8 months. (95% CI=43.2-55.8) (HR=0.83 [95% CI=0.58-1.19]) and the median PFS2 was 18.2 months (95% CI=15.7-24.4) (HR=0.67 [95% CI=0.48-0.94]) in the BRCA-mutated subgroup (PMID: 40580808).__In the Phase III ATHENA-MONO (NCT03522246) trial, the homologous recombination deficiency (HRD) population was treated with either rucaparib (n=185 [BRCA mutated, n=91, BRCA wildtype/loss of heterozygosity [LOH] high, n=94] or placebo (n=49 [BRCA mutated, n=24, BRCA wildtype/LOH high, n=25] (PMID: 35658487). Of the rucaparib cohort, the median progression-free survival (PFS) was 28.7 months (95% CI=23.0-NR) and the objective response rate (ORR) was 58.8% (95% CI=32.9-81.6), with a 58.8% (n=10) partial response (PR) rate, 35.3% (n=6) stable disease (SD) rate and 5.9% (n=1) progressive disease (PD) rate (PMID: 35658487). Of the placebo cohort, the median PFS was 11.3 months (95% CI=9.1-22.1) (HR=0.47 [95% CI=0.31-22.1], p=0.0004) and the ORR was 20.0% (95% CI=0.5-71.6), with a 20% (n=1) PR rate, 40% (n=2) SD rate and 40% (n=2) PD rate (PMID: 35658487).60.0LightBlueOvarian CancerSOLIDOvary/Fallopian Tube0.0SOLID['Oncogenic Mutations']RucaparibLEVEL_1LEVEL_Fda2['32795228', '36795891']Rucaparib is an orally available, small molecule PARP inhibitor that is FDA-approved for the treatment of adult patients with a deleterious BRCA mutation (germline and/or somatic)-associated metastatic castration-resistant prostate cancer (mCRPC), as detected by an FDA-approved companion diagnostic, who have been treated with androgen receptor-directed therapy and a taxane-based chemotherapy or androgen receptor-directed therapy alone. BRCA2 mutations for treatment with rucaparib were detected by the FoundationOne Liquid CDx. FDA approval was based on the results of the Phase II TRITON2 (NCT02952534) trial of rucaparib in 62 eligible patients with pre-treated BRCA-mutated mCRPC and the results of the Phase III TRITON3 (NCT02975934) trial of rucaparib in 405 eligible patients with mCRPC pre-treated with androgen receptor-directed therapy who could not have received prior chemotherapy in the castration-resistant setting._In the Phase II TRITON2 (NCT02952534) trial, the objective response rate was 44% (95% CI=31-57), with fifteen of 27 (56%) patients with a confirmed objective response demonstrating a duration of response of 6 months (PMID: 32795228)._In the Phase III TRITON3 trial of rucaparib versus physician's choice in patients with pre-treated BRCA-mutated mCRPC, patients treated with rucaparib (n=201) demonstrated a median progression-free survival of 11.2 months (95% CI=9.2, 13.8) compared to 6.4 months (95% CI=5.4, 8.3) for patients treated with physician's choice (n=101) (HR=0.05, 95% CI=0.36, 0.69) (PMID: 36795891). In addition, patients treated with rucaparib (n=201) demonstrated a median overall survival of 23.2 months (95% CI=19.1, 25.2) compared to 21.2 months (95% CI= 18.0, 23.1) for patients treated with physician's choice (n=101) (HR=0.91, 95% CI=0.68, 1.20) (PMID: 36795891).88.0CyanProstate CancerSOLIDProstate0.0SOLID['Oncogenic Mutations']Talazoparib + EnzalutamideLEVEL_1LEVEL_Fda2['37285865']Talazoparib is an orally available, small molecule PARP inhibitor that is FDA-approved in combination with enzalutamide for the treatment of adult patients with homologous recombination repair (HRR) gene-mutated metastatic castration-resistant prostate cancer (mCRPC). FDA approval was based on the results of the Phase III TALAPRO-2 (NCT03395197) trial of talazoparib plus enzalutamide in 399 adult patients with asymptomatic or mildly symptomatic mCRPC harboring HRR gene alterations receiving ongoing androgen deprivation therapy. _In the Phase III TALAPRO-2 (NCT03395197) trial, the talazoparib plus enzalutamide cohort (n=200) demonstrated a radiographic progression-free survival (rPFS) that was not evaluable (95% CI=21.9-NE) versus 13.8 months (95% CI=11.0-16.7) in the placebo plus enzalutamide cohort (n=199) (HR=0.45 [95% CI=0.33-0.61], p<0.0001) (PMID: 37285865). Of patients with BRCA1/2 mutations (n=155), the talazoparib plus enzalutamide cohort (n=71) demonstrated a rPFS that was not evaluable (95% CI=NE-NE) versus 11.0 months (95% CI=16.4-NE) in the placebo plus enzalutamide group (n=84) (HR=0.20 [95% CI=0.11-0.36]) (PMID: 37285865). Of patients harboring only BRCA2 mutations (n=115), the talazoparib plus enzalutamide cohort (n=71) demonstrated a rPFS that was not evaluable (95% CI=NE-NE) versus 11.0 months in the placebo plus enzalutamide cohort (n=60) (HR=0.19 [95% CI=0.10, 0.38], p<0.0001) (PMID: 37285865).88.0CyanProstate CancerSOLIDProstate0.0SOLID['Oncogenic Mutations']Olaparib + BevacizumabLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434'][{'abstract': 'Penson et al. Abstract# 5506, ASCO 2019.', 'link': 'https://meetinglibrary.asco.org/record/173435/abstract'}]Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).224.0PSECGreenPeritoneal Serous CarcinomaPeritoneal Cancer, NOSSOLIDPeritoneumPERITONEUM2.0SOLID['Oncogenic Mutations']Olaparib + BevacizumabLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434'][{'abstract': 'Penson et al. Abstract# 5506, ASCO 2019.', 'link': 'https://meetinglibrary.asco.org/record/173435/abstract'}]Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).152.0OVARYLightBlueOvary/Fallopian TubeOvarian/Fallopian Tube CancerSOLIDOvary/Fallopian TubeTISSUE1.0SOLID['Oncogenic Mutations']Olaparib + BevacizumabLEVEL_1LEVEL_Fda2['25366685', '30285518', '30345884', '24882434'][{'abstract': 'Penson et al. Abstract# 5506, ASCO 2019.', 'link': 'https://meetinglibrary.asco.org/record/173435/abstract'}]Olaparib, a small molecule PARP inhibitor, is FDA-approved with or without bevacizumab for the treatment of patients with advanced ovarian cancer who have deleterious germline BRCA mutations and have been treated with three or more lines of chemotherapy or as maintenance therapy for patients with recurrent epithelial ovarian, fallopian tube, or primary peritoneal cancer who are having partial or complete responses to platinum-based chemotherapy. This drug is considered standard-of-care for the treatment of patients with somatic BRCA1/2 mutations. Initial FDA approval was based on Phase I and Phase II clinical trials evaluating patients with ovarian cancer harboring known BRCA1 or BRCA2 germline mutations, in which treatment with olaparib demonstrated a clear clinical benefit. Specifically, in a Phase II trial evaluating olaparib in patients with platinum-resistant ovarian cancer and a confirmed germline BRCA1 or BRCA2 mutation (n=193), tumor response rate was 31% (95% CI=24.6 to 38.1), and stable disease (at 8 weeks) was seen in 40% of patients (95% CI=33.4 to 47.7) (PMID: 25366685). More recent FDA approval was based on a planned retrospective analysis of Phase II trial data in which patients with deleterious BRCA mutations had significantly longer progression-free survival with olaparib maintenance therapy than patients given placebo (11.2 months vs 4.3 months, HR=0.18, p=00001)(PMID: 24882434). The use of maintenance olaparib versus placebo increased progression-free survival, with a 70% lower risk of disease progression or death with olaparib (PMID: 30285518, 30345884)(Abstract: Penson et al. Abstract# 5506, ASCO 2019. https://meetinglibrary.asco.org/record/173435/abstract).60.0LightBlueOvarian CancerSOLIDOvary/Fallopian Tube0.0SOLID['Oncogenic Mutations']OlaparibLEVEL_2LEVEL_Fda3['33970096', '32299819']Olaparib, niraparib, and rucaparib are small-molecule PARP inhibitors that are FDA-approved for use in patients with breast and ovarian cancer, among others. The Uterine Cancer NCCN v1.2023 lists olaparib, niraparib, and rucaparib as recommended therapies for patients with BRCA2 mutations. In a clinical cohort, six patients with BRCA2-mutated or BRCA2-deleted uterine cancers had partial responses to treatment with PARP inhibitors (PMID: 32299819). In an additional case report, a single patient with uterine leiomyosarcoma harboring BRCA2/TP53/PTEN deletion had a rapid partial response to treatment with olaparib (PMID: 33970096).12.0PeachPuffUterine SarcomaSOLIDUterus0.0SOLID['Oncogenic Mutations']RucaparibLEVEL_2LEVEL_Fda3['33970687', '17444865', '30051098', '34351646'][{'abstract': 'Brown et al. Abstract# 734, ASCO 2023.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.4_suppl.734'}, {'abstract': 'Reiss Binder et al. Abstract# CT234, AACR 2019.', 'link': 'https://cancerres.aacrjournals.org/content/79/13_Supplement/CT234'}]Rucaparib, a small molecule PARP inhibitor, is FDA-approved for the treatment of patients with deleterious BRCA1/2 mutated advanced ovarian cancer who have been treated with two or more lines of chemotherapy. In the Phase II RUCAPANC study of rucaparib in nineteen patients with advanced pancreatic adenocarcinoma harboring deleterious germline or somatic BRCA1/2 mutations, two of three patients with somatic BRCA2 mutations had objective responses to treatment with rucaparib (complete response, n=1, partial response, n=1) and three BRCA2-mutant patients of sixteen patients with germine BRCA1/2 mutations had an objective response (PMID: 30051098). In a separate Phase II trial of rucaparib as maintenance therapy in patients with platinum-sensitive pancreatic cancer harboring BRCA1/2 or PALB2 mutations, seven of nineteen patients evaluable at interim analysis had a response to rucaparib (complete response, n=1, partial response, n=6, overall response rate = 36.8%), with responses seen in four patients with germline BRCA2 mutations, two patients with germline PALB2 mutations and one patient with somatic BRCA2 mutation (Abstract: Reiss Binder et al. Abstract# CT234, AACR 2019. https://cancerres.aacrjournals.org/content/79/13_Supplement/CT234). In vitro studies in pancreatic cancer cell lines demonstrated that PARP inhibition in combination with chemotherapy was more effective at inhibiting pancreatic cell growth in vitro or in xenograft models compared to chemotherapy alone (PMID: 17444865). (PMID: 33970687, 34351646) In a Phase II study to assess maintenance rucaparib treatment and reversion mutations in 42 patients with advanced pancreatic cancer harboring germline or somatic variants in BRCA1/2 or PALB2, the progression-free survival for patients with progression with no KRAS reversion mutations (n=23) compared to progression with acquired KRAS reversion mutations (n=5) was 279 days (95% CI, 225 to 428) versus 112 days (95% CI, 46 to 156) and the median overall survival rate was 701 days (95% CI, 586 to 829) versus 283 days (95% CI, 128 to 436), respectively (Abstract: Brown et al. Abstract# 734, ASCO 2023. https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.4_suppl.734).225.0PAADPurplePancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasPANCREAS2.0SOLID['Oncogenic Mutations']RucaparibLEVEL_2LEVEL_Fda3['33970687', '17444865', '30051098', '34351646'][{'abstract': 'Brown et al. Abstract# 734, ASCO 2023.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.4_suppl.734'}, {'abstract': 'Reiss Binder et al. Abstract# CT234, AACR 2019.', 'link': 'https://cancerres.aacrjournals.org/content/79/13_Supplement/CT234'}]Rucaparib, a small molecule PARP inhibitor, is FDA-approved for the treatment of patients with deleterious BRCA1/2 mutated advanced ovarian cancer who have been treated with two or more lines of chemotherapy. In the Phase II RUCAPANC study of rucaparib in nineteen patients with advanced pancreatic adenocarcinoma harboring deleterious germline or somatic BRCA1/2 mutations, two of three patients with somatic BRCA2 mutations had objective responses to treatment with rucaparib (complete response, n=1, partial response, n=1) and three BRCA2-mutant patients of sixteen patients with germine BRCA1/2 mutations had an objective response (PMID: 30051098). In a separate Phase II trial of rucaparib as maintenance therapy in patients with platinum-sensitive pancreatic cancer harboring BRCA1/2 or PALB2 mutations, seven of nineteen patients evaluable at interim analysis had a response to rucaparib (complete response, n=1, partial response, n=6, overall response rate = 36.8%), with responses seen in four patients with germline BRCA2 mutations, two patients with germline PALB2 mutations and one patient with somatic BRCA2 mutation (Abstract: Reiss Binder et al. Abstract# CT234, AACR 2019. https://cancerres.aacrjournals.org/content/79/13_Supplement/CT234). In vitro studies in pancreatic cancer cell lines demonstrated that PARP inhibition in combination with chemotherapy was more effective at inhibiting pancreatic cell growth in vitro or in xenograft models compared to chemotherapy alone (PMID: 17444865). (PMID: 33970687, 34351646) In a Phase II study to assess maintenance rucaparib treatment and reversion mutations in 42 patients with advanced pancreatic cancer harboring germline or somatic variants in BRCA1/2 or PALB2, the progression-free survival for patients with progression with no KRAS reversion mutations (n=23) compared to progression with acquired KRAS reversion mutations (n=5) was 279 days (95% CI, 225 to 428) versus 112 days (95% CI, 46 to 156) and the median overall survival rate was 701 days (95% CI, 586 to 829) versus 283 days (95% CI, 128 to 436), respectively (Abstract: Brown et al. Abstract# 734, ASCO 2023. https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.4_suppl.734).228.0PAACPurpleAcinar Cell Carcinoma of the PancreasPancreatic CancerSOLIDPancreasPANCREAS2.0SOLID['Oncogenic Mutations']RucaparibLEVEL_2LEVEL_Fda3['33970096', '32299819']Olaparib, niraparib, and rucaparib are small-molecule PARP inhibitors that are FDA-approved for use in patients with breast and ovarian cancer, among others. The Uterine Cancer NCCN v1.2023 lists olaparib, niraparib, and rucaparib as recommended therapies for patients with BRCA2 mutations. In a clinical cohort, six patients with BRCA2-mutated or BRCA2-deleted uterine cancers had partial responses to treatment with PARP inhibitors (PMID: 32299819). In an additional case report, a single patient with uterine leiomyosarcoma harboring BRCA2/TP53/PTEN deletion had a rapid partial response to treatment with olaparib (PMID: 33970096).12.0PeachPuffUterine SarcomaSOLIDUterus0.0SOLID['Oncogenic Mutations']NiraparibLEVEL_2LEVEL_Fda3['33970096', '32299819']Olaparib, niraparib, and rucaparib are small-molecule PARP inhibitors that are FDA-approved for use in patients with breast and ovarian cancer, among others. The Uterine Cancer NCCN v1.2023 lists olaparib, niraparib, and rucaparib as recommended therapies for patients with BRCA2 mutations. In a clinical cohort, six patients with BRCA2-mutated or BRCA2-deleted uterine cancers had partial responses to treatment with PARP inhibitors (PMID: 32299819). In an additional case report, a single patient with uterine leiomyosarcoma harboring BRCA2/TP53/PTEN deletion had a rapid partial response to treatment with olaparib (PMID: 33970096).12.0PeachPuffUterine SarcomaSOLIDUterus0.0SOLID['Oncogenic Mutations']OlaparibLEVEL_3ALEVEL_Fda3['37992259', '33119476']Olaparib is an orally available, small molecule PARP inhibitor that is FDA-approved for the treatment of patients with deleterious or suspected deleterious germline BRCA-mutated, HER2-negative metastatic breast cancer who have been treated with chemotherapy either in the neoadjuvant, adjuvant, or metastatic setting. There are promising clinical data of response to olaparib in patients with breast cancer harboring somatic BRCA1/2 mutations. _Olaparib is recommended in the NCCN Breast Cancer Guidelines (V3.2025) under "Emerging Biomarkers And Novel Therapies For Patients With Stage IV (M1) Disease" as a category 2B treatment recommendation for patients with somatic BRCA1/2 mutations. NCCN recommendation is based on the results of the Phase II TBCRC 048 (NCT03344965) study of olaparib in 54 patients with somatic BRCA1/2 mutations or germline/somatic mutations in homologous recombination (HR)-related genes other than BRCA1/2. In the Phase II TBCRC 048 (NCT03344965) study, patients with somatic BRCA1/2 mutations demonstrated an overall response rate (ORR) of 50% (90% CI=28-72) and a median progression-free survival (PFS) of 6.3 months (90% CI=4.4-NA) (PMID: 33119476)._In a retrospective study of 24 patients with BRCA1/2 somatic-mutated HER2-negative metastatic breast cancer treated with PARP inhibitors, the median real-world PFS was 4.6 months (95% CI=3.0 to 8.1) and the median real-world overall survival (OS) was 21.2 months (95% CI=13.8 to NR) while patients harboring BRCA1/2 germline mutations (n=71) demonstrated a median real-world PFS of 6.0 months (95% CI=4.6 to 8.2) and a median real-world OS of 21.2 months (95% CI=14.2 to NR) (PMID: 37992259).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Oncogenic Mutations']OlaparibLEVEL_3ALEVEL_Fda3['31157963', '32444418'][{'abstract': 'Ahn et al. JCO, Volume 8, 2024.', 'link': 'https://ascopubs.org/doi/10.1200/PO.23.00240#abstract'}]Olaparib, a small molecule PARP inhibitor, is NCCN-listed and FDA-approved for the maintenance treatment of adult patients with deleterious or suspected deleterious germline BRCA-mutated (gBRCAm) metastatic pancreatic adenocarcinoma (PAAD) whose disease has not progressed on at least sixteen weeks of a first-line platinum-based chemotherapy regimen. In a randomized, double-blind, placebo-controlled, phase III trial (POLO, NCT02184195) of olaparib in 154 patients with gBRCAm metastatic PAAD that did not progress during first-line platinum-based chemotherapy, the median progression-free survival (PFS) was significantly longer in the olaparib group (n = 92 patients) than in the placebo group (n = 62 patients) (7.4 months vs. 3.8 months, HR for disease progression or death=0.53, 95% CI=0.35-0.82, p = 0.004), and an interim analysis of overall survival (OS) showed no difference between the olaparib and placebo groups (median, 18.9 months vs. 18.1 months, HR for death=0.91, 95% CI=0.56-1.46, p = 0.68) (PMID: 31157963). In a study looking at PFS and OS of 262 advanced-stage PAAD patients that underwent both germline and somatic targeted-gene sequencing to identify homologous recombination (HR)-gene mutations, including BRCA1/2, HR-deficient (HRD) patients treated with first-line platinum (n=35 patients) had a superior median OS compared to patients with no HRD treated with or without first line platinum (25.1 [21.6-NR] vs. 15.3 [14.220.3] or 13 [10.116.9] months, respectively) (PMID: 32444418). In the Phase II TAPUR (NCT02693535) trial of olaparib in 30 patients with BRCA1/2-mutated advanced PAAD (n=9, BRCA1 only, n=18, BRCA2 only, n=3, BRCA1 and BRCA2), the disease control rate was 31% (90% CI=18-40, p=0.04), the objective response rate was 18% (95% CI=6-37), with two patients achieving complete response, three patients achieving partial response and three patients achieving stable disease of at least 16 weeks duration, the median PFS was eight weeks (95% CI=8-15) and the median OS was 38 weeks (95% CI=21-65) (Abstract: Ahn et al. JCO, Volume 8, 2024. https://ascopubs.org/doi/10.1200/PO.23.00240#abstract).225.0PAADPurplePancreatic AdenocarcinomaPancreatic CancerSOLIDPancreasPANCREAS2.0SOLID['Oncogenic Mutations']OlaparibLEVEL_3ALEVEL_Fda3['31157963', '32444418'][{'abstract': 'Ahn et al. JCO, Volume 8, 2024.', 'link': 'https://ascopubs.org/doi/10.1200/PO.23.00240#abstract'}]Olaparib, a small molecule PARP inhibitor, is NCCN-listed and FDA-approved for the maintenance treatment of adult patients with deleterious or suspected deleterious germline BRCA-mutated (gBRCAm) metastatic pancreatic adenocarcinoma (PAAD) whose disease has not progressed on at least sixteen weeks of a first-line platinum-based chemotherapy regimen. In a randomized, double-blind, placebo-controlled, phase III trial (POLO, NCT02184195) of olaparib in 154 patients with gBRCAm metastatic PAAD that did not progress during first-line platinum-based chemotherapy, the median progression-free survival (PFS) was significantly longer in the olaparib group (n = 92 patients) than in the placebo group (n = 62 patients) (7.4 months vs. 3.8 months, HR for disease progression or death=0.53, 95% CI=0.35-0.82, p = 0.004), and an interim analysis of overall survival (OS) showed no difference between the olaparib and placebo groups (median, 18.9 months vs. 18.1 months, HR for death=0.91, 95% CI=0.56-1.46, p = 0.68) (PMID: 31157963). In a study looking at PFS and OS of 262 advanced-stage PAAD patients that underwent both germline and somatic targeted-gene sequencing to identify homologous recombination (HR)-gene mutations, including BRCA1/2, HR-deficient (HRD) patients treated with first-line platinum (n=35 patients) had a superior median OS compared to patients with no HRD treated with or without first line platinum (25.1 [21.6-NR] vs. 15.3 [14.220.3] or 13 [10.116.9] months, respectively) (PMID: 32444418). In the Phase II TAPUR (NCT02693535) trial of olaparib in 30 patients with BRCA1/2-mutated advanced PAAD (n=9, BRCA1 only, n=18, BRCA2 only, n=3, BRCA1 and BRCA2), the disease control rate was 31% (90% CI=18-40, p=0.04), the objective response rate was 18% (95% CI=6-37), with two patients achieving complete response, three patients achieving partial response and three patients achieving stable disease of at least 16 weeks duration, the median PFS was eight weeks (95% CI=8-15) and the median OS was 38 weeks (95% CI=21-65) (Abstract: Ahn et al. JCO, Volume 8, 2024. https://ascopubs.org/doi/10.1200/PO.23.00240#abstract).228.0PAACPurpleAcinar Cell Carcinoma of the PancreasPancreatic CancerSOLIDPancreasPANCREAS2.0SOLID['Oncogenic Mutations']TalazoparibLEVEL_3ALEVEL_Fda3['30110579', '36394867', '37992259', '30563931'][{'abstract': 'Dhawan et al. Abstract# 2527, ASCO 2017.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2527'}]Talazoparib, a small molecule PARP inhibitor, is FDA-approved for patients with deleterious or suspected deleterious germline BRCA-mutated, HER2-negative locally advanced or metastatic breast cancer. FDA approval was based on the results from the Phase III EMBRACA trial of talazoparib (1 mg once daily) versus standard single-agent chemotherapy (2:1) in 431 patients with advanced, BRCA1/2 germline-mutated breast cancer in which the median progression-free survival was 8.6 months in the talazoparib group versus 5.6 months in the chemotherapy group (HR= 0.54, 95%CI=0.41 to 0.71, p<0.001) and the objective response rate was 62.6% in the talazoparib group versus 27.2% in the chemotherapy group (p<0.001) (PMID: 30110579). In the Phase II study of talazoparib in patients with germline BRCA-mutant breast cancer who had a prior response to platinum agents, the overall response rate was 21-37% (depending on cohort) (PMID: 30563931). In a Phase I study of talazoparib plus carboplatin in patients with and without DNA repair mutations, three patients with somatic BRCA mutations had stable disease beyond four months (Abstract: Dhawan et al. Abstract# 2527, ASCO 2017. https://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2527). In the Phase IIb tumor-agnostic JAVELIN BRCA/ATM trial of combination talazoparib and avelumab in 159 patients with BRCA1/2-altered solid tumors, the objective response was observed in 42 patients (26.4%, 95% CI = 19.7%34.0%) and the median duration of response was 10.9 months (95% CI = 6.2 months to not estimable) (PMID: 36394867). In a retrospective study for 24 patients with BRCA1/2 somatic-mutated HER2-negative metastatic breast cancer treated with PARP inhibitors, the median real-world PFS was 4.6 months (95% CI=3.0 to 8.1) and the median real-world overall survival was 21.2 months (95% CI=13.8 to NR) while patients harboring BRCA1/2 germline mutations (n=71) demonstrated a median real-world PFS of 6.0 months (95% CI=4.6 to 8.2) and a median real-world overall survival of 21.2 months (95% CI=14.2 to NR) (PMID: 37992259).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID3573681730948273;27717299;31562799;41057655;36952634;25366685;30285518;30345884;24882434;Penson et al. Abstract# 5506, ASCO 2019.(https://meetinglibrary.asco.org/record/173435/abstract);32343890;37714168;35658487;40580808;32795228;36795891;37285865;33970096;32299819;33970687;17444865;30051098;34351646;Brown et al. Abstract# 734, ASCO 2023.(https://ascopubs.org/doi/abs/10.1200/JCO.2023.41.4_suppl.734);Reiss Binder et al. Abstract# CT234, AACR 2019.(https://cancerres.aacrjournals.org/content/79/13_Supplement/CT234);37992259;33119476;31157963;32444418;Ahn et al. JCO, Volume 8, 2024.(https://ascopubs.org/doi/10.1200/PO.23.00240#abstract);30110579;36394867;30563931;Dhawan et al. Abstract# 2527, ASCO 2017.(https://ascopubs.org/doi/abs/10.1200/JCO.2017.35.15_suppl.2527)90
TUMORp.E1705*NP_085124.2:p.Glu1705Terchr1495094139GAPASSNM_030621stop_gainedHIGHDICER126/29c.5113G>TCOSV58615252&COSV58618257SNV2.7500e-01v7.0..False04/15/2025.TrueTrueFalseLikely Loss-of-functionLikely Oncogenic60,300/10.3333333333333333GRCh38DICER1GANonsense_MutationSNPG95094139DICER1_E1705K.GT:AD:AF:DP0/1:60,30:0.33:90A23405TranscriptNM_030621.4protein_coding540551131705E/*Gaa/Taa-1EntrezGeneHGNC:17098NP_085124.2RefSeqGCOK1&11&1.False.The mutation effect description for truncating mutations in DICER1 is: DICER1 germline truncating mutations result in various forms of C-terminally truncated DICER1 protein and the loss of DICER1 protein function. These mutations have been identified in pleuropulmonary blastoma (PMID: 21266384, 21501861). In vitro studies with DICER1-deficient mouse myeloid progenitor cells demonstrated that loss of DICER1 is inactivating as measured by blocked monocyte differentiation, depleted macrophages and induced myeloid dysplasia compared to wildtype (PMID: 22353998, 20305640)..DICER1, an endoribonuclease, is altered in various cancer types...20305640|22353998|21266384|21501861..E1705*23405DICER1GRCh38.MUTATION..The DICER1 E1705* is a truncating mutation in a tumor suppressor gene, and therefore is likely oncogenic.False.The mutation effect description for truncating mutations in DICER1 is: DICER1 germline truncating mutations result in various forms of C-terminally truncated DICER1 protein and the loss of DICER1 protein function. These mutations have been identified in pleuropulmonary blastoma (PMID: 21266384, 21501861). In vitro studies with DICER1-deficient mouse myeloid progenitor cells demonstrated that loss of DICER1 is inactivating as measured by blocked monocyte differentiation, depleted macrophages and induced myeloid dysplasia compared to wildtype (PMID: 22353998, 20305640).['20305640', '22353998', '21266384', '21501861']20305640;22353998;21266384;2150186190
TUMORp.R248WENSP00000269305.4:p.Arg248Trpchr177674221GAPASSNM_000546missense_variantMODERATETP537/11c.742C>Trs121912651&CM010465&CM900211&COSV52662035&COSV52797251&COSV53097881SNVdeleterious(0)6.157e-0602.236e-05gnomADe_AMR0.000.000.000.000.9274.4900e-01TP53-related_disorder&Gallbladder_cancer&Congenital_fibrosarcoma&Lip_and_oral_cavity_carcinoma&Gastric_cancer&Breast_and/or_ovarian_cancer&Familial_pancreatic_carcinoma&Malignant_lymphoma&_large_B-cell&_diffuse&Hereditary_cancer-predisposing_syndrome&not_provided&Ovarian_neoplasm&Adrenocortical_carcinoma&_hereditary&Choroid_plexus_carcinoma&Li-Fraumeni_syndrome_1&Li-Fraumeni_syndromeNC_000017.11:g.7674221G>Areviewed_by_expert_panelPathogenicOncogeniccriteria_provided&_single_submitter35criteria_provided&_single_submitterTier_I_-_StrongTP53R248Wchr17:7674221-7674221v7.0..✓ Hotspot06/11/2024.TrueTrueTrueLoss-of-functionLikely OncogenicLEVEL_Px148,400/1R248W0.45454545454545453GRCh38TP53GAMissense_MutationSNPG7674221TP53_R248W.GT:AD:AF:DP0/1:48,40:0.45:88AENSG00000141510TranscriptENST00000269305protein_coding884742248R/WCgg/Tgg-1HGNCHGNC:11998YESMANE_SelectNM_000546.61P1CCDS11118.1ENSP00000269305P04637.307K7PPA8.92UPI000002ED67P04637-1EnsemblGG1PDB-ENSP_mappings:1gzh.A&PDB-ENSP_mappings:1gzh.C&PDB-ENSP_mappings:1kzy.A&PDB-ENSP_mappings:1kzy.B&PDB-ENSP_mappings:1tsr.A&PDB-ENSP_mappings:1tsr.B&PDB-ENSP_mappings:1tsr.C&PDB-ENSP_mappings:1tup.A&PDB-ENSP_mappings:1tup.B&PDB-ENSP_mappings:1tup.C&PDB-ENSP_mappings:1uol.A&PDB-ENSP_mappings:1uol.B&PDB-ENSP_mappings:1ycs.A&PDB-ENSP_mappings:2ac0.A&PDB-ENSP_mappings:2ac0.B&PDB-ENSP_mappings:2ac0.C&PDB-ENSP_mappings:2ac0.D&PDB-ENSP_mappings:2ady.A&PDB-ENSP_mappings:2ady.B&PDB-ENSP_mappings:2ahi.A&PDB-ENSP_mappings:2ahi.B&PDB-ENSP_mappings:2ahi.C&PDB-ENSP_mappings:2ahi.D&PDB-ENSP_mappings:2ata.A&PDB-ENSP_mappings:2ata.B&PDB-ENSP_mappings:2ata.C&PDB-ENSP_mappings:2ata.D&PDB-ENSP_mappings:2bim.A&PDB-ENSP_mappings:2bim.B&PDB-ENSP_mappings:2bin.A&PDB-ENSP_mappings:2bio.A&PDB-ENSP_mappings:2bip.A&PDB-ENSP_mappings:2biq.A&PDB-ENSP_mappings:2fej.A&PDB-ENSP_mappings:2h1l.M&PDB-ENSP_mappings:2h1l.N&PDB-ENSP_mappings:2h1l.O&PDB-ENSP_mappings:2h1l.P&PDB-ENSP_mappings:2h1l.Q&PDB-ENSP_mappings:2h1l.R&PDB-ENSP_mappings:2h1l.S&PDB-ENSP_mappings:2h1l.T&PDB-ENSP_mappings:2h1l.U&PDB-ENSP_mappings:2h1l.V&PDB-ENSP_mappings:2h1l.W&PDB-ENSP_mappings:2h1l.X&PDB-ENSP_mappings:2j1w.A&PDB-ENSP_mappings:2j1w.B&PDB-ENSP_mappings:2j1x.A&PDB-ENSP_mappings:2j1x.B&PDB-ENSP_mappings:2j1y.A&PDB-ENSP_mappings:2j1y.B&PDB-ENSP_mappings:2j1y.C&PDB-ENSP_mappings:2j1y.D&PDB-ENSP_mappings:2j1z.A&PDB-ENSP_mappings:2j1z.B&PDB-ENSP_mappings:2j20.A&PDB-ENSP_mappings:2j20.B&PDB-ENSP_mappings:2j21.A&PDB-ENSP_mappings:2j21.B&PDB-ENSP_mappings:2mej.B&PDB-ENSP_mappings:2ocj.A&PDB-ENSP_mappings:2ocj.B&PDB-ENSP_mappings:2ocj.C&PDB-ENSP_mappings:2ocj.D&PDB-ENSP_mappings:2pcx.A&PDB-ENSP_mappings:2vuk.A&PDB-ENSP_mappings:2vuk.B&PDB-ENSP_mappings:2wgx.A&PDB-ENSP_mappings:2wgx.B&PDB-ENSP_mappings:2x0u.A&PDB-ENSP_mappings:2x0u.B&PDB-ENSP_mappings:2x0v.A&PDB-ENSP_mappings:2x0v.B&PDB-ENSP_mappings:2x0w.A&PDB-ENSP_mappings:2x0w.B&PDB-ENSP_mappings:2xwr.A&PDB-ENSP_mappings:2xwr.B&PDB-ENSP_mappings:2ybg.A&PDB-ENSP_mappings:2ybg.B&PDB-ENSP_mappings:2ybg.C&PDB-ENSP_mappings:2ybg.D&PDB-ENSP_mappings:3d05.A&PDB-ENSP_mappings:3d06.A&PDB-ENSP_mappings:3d07.A&PDB-ENSP_mappings:3d07.B&PDB-ENSP_mappings:3d08.A&PDB-ENSP_mappings:3d09.A&PDB-ENSP_mappings:3d0a.A&PDB-ENSP_mappings:3d0a.B&PDB-ENSP_mappings:3d0a.C&PDB-ENSP_mappings:3d0a.D&PDB-ENSP_mappings:3igk.A&PDB-ENSP_mappings:3igl.A&PDB-ENSP_mappings:3kmd.A&PDB-ENSP_mappings:3kmd.B&PDB-ENSP_mappings:3kmd.C&PDB-ENSP_mappings:3kmd.D&PDB-ENSP_mappings:3kz8.A&PDB-ENSP_mappings:3kz8.B&PDB-ENSP_mappings:3q01.A&PDB-ENSP_mappings:3q01.B&PDB-ENSP_mappings:3q05.A&PDB-ENSP_mappings:3q05.B&PDB-ENSP_mappings:3q05.C&PDB-ENSP_mappings:3q05.D&PDB-ENSP_mappings:3q06.A&PDB-ENSP_mappings:3q06.B&PDB-ENSP_mappings:3q06.C&PDB-ENSP_mappings:3q06.D&PDB-ENSP_mappings:3ts8.A&PDB-ENSP_mappings:3ts8.B&PDB-ENSP_mappings:3ts8.C&PDB-ENSP_mappings:3ts8.D&PDB-ENSP_mappings:3zme.A&PDB-ENSP_mappings:3zme.B&PDB-ENSP_mappings:4agl.A&PDB-ENSP_mappings:4agl.B&PDB-ENSP_mappings:4agm.A&PDB-ENSP_mappings:4agm.B&PDB-ENSP_mappings:4agn.A&PDB-ENSP_mappings:4agn.B&PDB-ENSP_mappings:4ago.A&PDB-ENSP_mappings:4ago.B&PDB-ENSP_mappings:4agp.A&PDB-ENSP_mappings:4agp.B&PDB-ENSP_mappings:4agq.A&PDB-ENSP_mappings:4agq.B&PDB-ENSP_mappings:4hje.A&PDB-ENSP_mappings:4hje.B&PDB-ENSP_mappings:4hje.C&PDB-ENSP_mappings:4hje.D&PDB-ENSP_mappings:4ibq.A&PDB-ENSP_mappings:4ibq.B&PDB-ENSP_mappings:4ibq.C&PDB-ENSP_mappings:4ibq.D&PDB-ENSP_mappings:4ibs.A&PDB-ENSP_mappings:4ibs.B&PDB-ENSP_mappings:4ibs.C&PDB-ENSP_mappings:4ibs.D&PDB-ENSP_mappings:4ibt.A&PDB-ENSP_mappings:4ibt.B&PDB-ENSP_mappings:4ibt.C&PDB-ENSP_mappings:4ibt.D&PDB-ENSP_mappings:4ibu.A&PDB-ENSP_mappings:4ibu.B&PDB-ENSP_mappings:4ibu.C&PDB-ENSP_mappings:4ibu.D&PDB-ENSP_mappings:4ibv.A&PDB-ENSP_mappings:4ibw.A&PDB-ENSP_mappings:4iby.A&PDB-ENSP_mappings:4iby.B&PDB-ENSP_mappings:4ibz.A&PDB-ENSP_mappings:4ibz.B&PDB-ENSP_mappings:4ibz.C&PDB-ENSP_mappings:4ibz.D&PDB-ENSP_mappings:4ijt.A&PDB-ENSP_mappings:4kvp.A&PDB-ENSP_mappings:4kvp.B&PDB-ENSP_mappings:4kvp.C&PDB-ENSP_mappings:4kvp.D&PDB-ENSP_mappings:4lo9.A&PDB-ENSP_mappings:4lo9.B&PDB-ENSP_mappings:4lo9.C&PDB-ENSP_mappings:4lo9.D&PDB-ENSP_mappings:4loe.A&PDB-ENSP_mappings:4loe.B&PDB-ENSP_mappings:4loe.C&PDB-ENSP_mappings:4loe.D&PDB-ENSP_mappings:4lof.A&PDB-ENSP_mappings:4mzi.A&PDB-ENSP_mappings:4mzr.A&PDB-ENSP_mappings:4mzr.B&PDB-ENSP_mappings:4mzr.C&PDB-ENSP_mappings:4mzr.D&PDB-ENSP_mappings:4qo1.B&PDB-ENSP_mappings:4xr8.C&PDB-ENSP_mappings:4xr8.D&PDB-ENSP_mappings:5a7b.A&PDB-ENSP_mappings:5a7b.B&PDB-ENSP_mappings:5ab9.A&PDB-ENSP_mappings:5ab9.B&PDB-ENSP_mappings:5aba.A&PDB-ENSP_mappings:5aba.B&PDB-ENSP_mappings:5aoi.A&PDB-ENSP_mappings:5aoi.B&PDB-ENSP_mappings:5aoj.A&PDB-ENSP_mappings:5aoj.B&PDB-ENSP_mappings:5aok.A&PDB-ENSP_mappings:5aok.B&PDB-ENSP_mappings:5aol.A&PDB-ENSP_mappings:5aol.B&PDB-ENSP_mappings:5aom.A&PDB-ENSP_mappings:5aom.B&PDB-ENSP_mappings:5bua.A&PDB-ENSP_mappings:5ecg.A&PDB-ENSP_mappings:5ecg.B&PDB-ENSP_mappings:5g4m.A&PDB-ENSP_mappings:5g4m.B&PDB-ENSP_mappings:5g4n.A&PDB-ENSP_mappings:5g4n.B&PDB-ENSP_mappings:5g4o.A&PDB-ENSP_mappings:5g4o.B&PDB-ENSP_mappings:5lap.A&PDB-ENSP_mappings:5lap.B&PDB-ENSP_mappings:5lgy.A&PDB-ENSP_mappings:5lgy.B&PDB-ENSP_mappings:5lgy.C&PDB-ENSP_mappings:5lgy.D&PDB-ENSP_mappings:5mct.A&PDB-ENSP_mappings:5mct.B&PDB-ENSP_mappings:5mcu.A&PDB-ENSP_mappings:5mcu.B&PDB-ENSP_mappings:5mcv.A&PDB-ENSP_mappings:5mcv.B&PDB-ENSP_mappings:5mcw.A&PDB-ENSP_mappings:5mcw.B&PDB-ENSP_mappings:5mf7.A&PDB-ENSP_mappings:5mf7.B&PDB-ENSP_mappings:5mg7.A&PDB-ENSP_mappings:5mg7.B&PDB-ENSP_mappings:5o1a.A&PDB-ENSP_mappings:5o1a.B&PDB-ENSP_mappings:5o1b.A&PDB-ENSP_mappings:5o1b.B&PDB-ENSP_mappings:5o1c.A&PDB-ENSP_mappings:5o1c.B&PDB-ENSP_mappings:5o1d.A&PDB-ENSP_mappings:5o1d.B&PDB-ENSP_mappings:5o1e.A&PDB-ENSP_mappings:5o1e.B&PDB-ENSP_mappings:5o1f.A&PDB-ENSP_mappings:5o1f.B&PDB-ENSP_mappings:5o1g.A&PDB-ENSP_mappings:5o1g.B&PDB-ENSP_mappings:5o1h.A&PDB-ENSP_mappings:5o1h.B&PDB-ENSP_mappings:5o1i.A&PDB-ENSP_mappings:5o1i.B&PDB-ENSP_mappings:5xzc.B&PDB-ENSP_mappings:5xzc.C&PDB-ENSP_mappings:5xzc.D&PDB-ENSP_mappings:5xzc.E&PDB-ENSP_mappings:6ff9.A&PDB-ENSP_mappings:6ff9.B&PDB-ENSP_mappings:6ff9.C&PDB-ENSP_mappings:6ff9.D&PDB-ENSP_mappings:6fj5.A&PDB-ENSP_mappings:6fj5.B&PDB-ENSP_mappings:6fj5.C&PDB-ENSP_mappings:6fj5.D&PDB-ENSP_mappings:6gga.A&PDB-ENSP_mappings:6gga.B&PDB-ENSP_mappings:6ggb.A&PDB-ENSP_mappings:6ggb.B&PDB-ENSP_mappings:6ggc.A&PDB-ENSP_mappings:6ggc.B&PDB-ENSP_mappings:6ggd.A&PDB-ENSP_mappings:6ggd.B&PDB-ENSP_mappings:6gge.A&PDB-ENSP_mappings:6gge.B&PDB-ENSP_mappings:6ggf.A&PDB-ENSP_mappings:6ggf.B&PDB-ENSP_mappings:6lhd.A&PDB-ENSP_mappings:6lhd.B&PDB-ENSP_mappings:6rz3.A&PDB-ENSP_mappings:6shz.A&PDB-ENSP_mappings:6shz.B&PDB-ENSP_mappings:6si0.A&PDB-ENSP_mappings:6si0.B&PDB-ENSP_mappings:6si1.A&PDB-ENSP_mappings:6si1.B&PDB-ENSP_mappings:6si2.A&PDB-ENSP_mappings:6si2.B&PDB-ENSP_mappings:6si3.A&PDB-ENSP_mappings:6si3.B&PDB-ENSP_mappings:6si4.A&PDB-ENSP_mappings:6si4.B&PDB-ENSP_mappings:6sl6.A&PDB-ENSP_mappings:6xre.M&PDB-ENSP_mappings:6znc.A&PDB-ENSP_mappings:7b46.A&PDB-ENSP_mappings:7b46.B&PDB-ENSP_mappings:7b46.C&PDB-ENSP_mappings:7b46.D&PDB-ENSP_mappings:7b47.A&PDB-ENSP_mappings:7b47.B&PDB-ENSP_mappings:7b47.C&PDB-ENSP_mappings:7b47.D&PDB-ENSP_mappings:7b48.A&PDB-ENSP_mappings:7b48.B&PDB-ENSP_mappings:7b48.C&PDB-ENSP_mappings:7b48.D&PDB-ENSP_mappings:7b49.A&PDB-ENSP_mappings:7b49.B&PDB-ENSP_mappings:7b4a.A&PDB-ENSP_mappings:7b4a.B&PDB-ENSP_mappings:7b4b.A&PDB-ENSP_mappings:7b4b.B&PDB-ENSP_mappings:7b4b.C&PDB-ENSP_mappings:7b4b.D&PDB-ENSP_mappings:7b4c.A&PDB-ENSP_mappings:7b4c.B&PDB-ENSP_mappings:7b4c.C&PDB-ENSP_mappings:7b4c.D&PDB-ENSP_mappings:7b4d.A&PDB-ENSP_mappings:7b4e.A&PDB-ENSP_mappings:7b4f.A&PDB-ENSP_mappings:7b4g.A&PDB-ENSP_mappings:7b4h.A&PDB-ENSP_mappings:7b4n.A&PDB-ENSP_mappings:7dhy.A&PDB-ENSP_mappings:7dhy.B&PDB-ENSP_mappings:7dhy.C&PDB-ENSP_mappings:7dhy.D&PDB-ENSP_mappings:7dhz.A&PDB-ENSP_mappings:7dhz.B&PDB-ENSP_mappings:7dvd.A&PDB-ENSP_mappings:7dvd.B&PDB-ENSP_mappings:7dvd.C&PDB-ENSP_mappings:7dvd.D&PDB-ENSP_mappings:7eax.A&PDB-ENSP_mappings:7eax.B&PDB-ENSP_mappings:7eax.C&PDB-ENSP_mappings:7eax.D&PDB-ENSP_mappings:7eds.A&PDB-ENSP_mappings:7eeu.A&PDB-ENSP_mappings:7eeu.B&PDB-ENSP_mappings:7eeu.C&PDB-ENSP_mappings:7eeu.D&PDB-ENSP_mappings:7eeu.E&PDB-ENSP_mappings:7eeu.F&PDB-ENSP_mappings:7eeu.G&PDB-ENSP_mappings:7eeu.H&PDB-ENSP_mappings:7v97.A&PDB-ENSP_mappings:7v97.B&PDB-ENSP_mappings:7v97.C&PDB-ENSP_mappings:7v97.D&PDB-ENSP_mappings:7xzx.K&PDB-ENSP_mappings:7xzx.L&PDB-ENSP_mappings:7xzx.M&PDB-ENSP_mappings:7xzx.N&PDB-ENSP_mappings:7xzz.K&PDB-ENSP_mappings:7xzz.L&PDB-ENSP_mappings:7xzz.M&PDB-ENSP_mappings:7xzz.N&PDB-ENSP_mappings:7ygi.A&PDB-ENSP_mappings:7ygi.B&PDB-ENSP_mappings:8a31.A&PDB-ENSP_mappings:8a31.B&PDB-ENSP_mappings:8a32.A&PDB-ENSP_mappings:8a32.B&PDB-ENSP_mappings:8a92.A&PDB-ENSP_mappings:8a92.B&PDB-ENSP_mappings:8cg7.A&PDB-ENSP_mappings:8cg7.B&PDB-ENSP_mappings:8dc4.A&PDB-ENSP_mappings:8dc4.B&PDB-ENSP_mappings:8dc4.C&PDB-ENSP_mappings:8dc4.D&PDB-ENSP_mappings:8dc6.A&PDB-ENSP_mappings:8dc6.B&PDB-ENSP_mappings:8dc6.C&PDB-ENSP_mappings:8dc6.D&PDB-ENSP_mappings:8dc7.A&PDB-ENSP_mappings:8dc8.A&PDB-ENSP_mappings:8e7a.A&PDB-ENSP_mappings:8e7b.A&PDB-ENSP_mappings:8e7b.B&PDB-ENSP_mappings:8f2h.A&PDB-ENSP_mappings:8f2h.B&PDB-ENSP_mappings:8f2i.A&PDB-ENSP_mappings:8gcr.B&PDB-ENSP_mappings:8hll.A&PDB-ENSP_mappings:8hlm.A&PDB-ENSP_mappings:8hln.A&PDB-ENSP_mappings:8j8n.A&PDB-ENSP_mappings:8j8n.B&PDB-ENSP_mappings:8j8n.C&PDB-ENSP_mappings:8j8n.D&PDB-ENSP_mappings:8qwk.A&PDB-ENSP_mappings:8qwl.A&PDB-ENSP_mappings:8qwm.A&PDB-ENSP_mappings:8qwm.B&PDB-ENSP_mappings:8qwn.A&PDB-ENSP_mappings:8qwo.A&PDB-ENSP_mappings:8qwo.B&PDB-ENSP_mappings:8qwp.A&PDB-ENSP_mappings:8qwp.B&PDB-ENSP_mappings:8r1f.C&PDB-ENSP_mappings:8r1g.C&PDB-ENSP_mappings:8r1g.F&PDB-ENSP_mappings:8wd2.A&PDB-ENSP_mappings:8wd2.B&PDB-ENSP_mappings:8xp5.A&PDB-ENSP_mappings:8xp5.B&Superfamily:SSF49417&Prints:PR00386&PROSITE_patterns:PS00348&Gene3D:2.60.40.720&Pfam:PF00870&PANTHER:PTHR11447&CDD:cd08367&AFDB-ENSP_mappings:AF-P04637-F102.236e-0500006.296e-0601.159e-050000000000uncertain_significance&pathogenic&pathogenic/likely_pathogenic&likely_pathogenic0&1&1&1&1&11&1&1&1&1&125741868&24033266&26900293&32293552&25157968&26619011&25105660&16489069&17606709&30744407&1631137&1978757&21343334&8099841&8425176&8527048&9598730&9825943&12826609&17427234&20013323&28664506&37182128&34771529&34178683&36866106&35483882&37391803&38310289&38413718FAIL492230-40TP53123470.0000127386.&MONDO:MONDO:0005411&MedGen:C0153452&MONDO:MONDO:0004557&MedGen:C0334459&MONDO:MONDO:0023644&MedGen:C0220641&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&MedGen:CN221562&MONDO:MONDO:0015278&MedGen:C2931038&OMIM:260350&Orphanet:1333&MONDO:MONDO:0018905&MeSH:D016403&MedGen:C0079744&Orphanet:544&MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MedGen:C3661900&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&MONDO:MONDO:0008734&MedGen:C1859972&OMIM:202300&Orphanet:1501&Human_Phenotype_Ontology:HP:0030392&MONDO:MONDO:0016718&MedGen:C0431109&Orphanet:251899&Gene:553989&MedGen:C1835398&OMIM:151623&Orphanet:524&MONDO:MONDO:0018875&MedGen:C0085390&OMIM:PS151623&Orphanet:524SCV001142555single_nucleotide_variantSO:0001483ClinGen:CA000382&OMIM:191170.0001&UniProtKB:P04637#VAR_005984TP53:7157SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV005094410121912651Breast_phyllodes_tumor&Diffuse_glioma&_H3_G34_mutant&Medulloblastoma_SHH_activated_and_TP53_mutant&Diffuse_pediatric-type_high-grade_glioma&_H3-wildtype_and_IDH-wildtype&Colorectal_cancerMONDO:MONDO:0021047&MedGen:C0238031&MONDO:MONDO:0957197&MedGen:CN377580&MONDO:MONDO:0956964&MedGen:CN377553&MONDO:MONDO:0858939&MedGen:C5669918&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500SCV007104830&SCV007105490&SCV007105612&SCV00710563617:7674221-76742211TP53p.R248W.True.The TP53 R248W mutation is located in the protein's DNA binding domain. This mutation has been found in Li-Fraumeni syndrome (PMID: 25584008). In vitro studies have demonstrated that this mutation is inactivating, as evidenced by increased p53-mediated transactivation and failure to suppress colony growth in the mutant compared to wildtype (PMID: 18762571, 10229196, 25584008)..TP53, a tumor suppressor in the DNA damage pathway, is the most frequently mutated gene in cancer...25584008|18762571|10229196LEVEL_Px1.R248W7157TP53GRCh38.MUTATION..The TP53 R248W mutation is likely oncogenic.False.The TP53 R248W mutation is located in the protein's DNA binding domain. This mutation has been found in Li-Fraumeni syndrome (PMID: 25584008). In vitro studies have demonstrated that this mutation is inactivating, as evidenced by increased p53-mediated transactivation and failure to suppress colony growth in the mutant compared to wildtype (PMID: 18762571, 10229196, 25584008).['25584008', '18762571', '10229196']25584008;18762571;10229196MDS,AMLMRC,TMN,CLLSLL,PMF,AML,MPN,ETMCL21714648;25092778;24220272;25412851;25860933;25412846;25952993;23243274;24004666;20697090;19188171;24652989;25516983;22052707;22887079;22186996;18596741;8639789;7579380;28819011;24684350;26022239;24478400;2929669288Amissense_variantTP537157GeneENST00000269305.4ENST00000269305.4:c.742C>TNP_000537.3:p.Arg248Trp118ARG248TRP/RS121912651https://civicdb.org/links/variants/118TP53_R248W118NM_000546.5:c.742C>T/NP_000537.3:p.Arg248Trp/NC_000017.10:g.7577539G>A/ENST00000269305.4:c.742C>TCA00038212347
TUMORp.R175HENSP00000269305.4:p.Arg175Hischr177675088CTPASSNM_000546missense_variantMODERATETP535/11c.524G>Ars28934578&CM062017&CM951224&COSV52661038&COSV52677601&COSV52731306&COSV53801286SNVtolerated(0.08)4.104e-066.57e-061.47e-05gnomADg_NFE0.000.000.010.000.9224.4900e-01TP53-related_disorder&Colorectal_cancer&Nasopharyngeal_carcinoma&Bone_osteosarcoma&Hepatocellular_carcinoma&Li-Fraumeni_syndrome_1&Glioma_susceptibility_1&Bone_marrow_failure_syndrome_5&Basal_cell_carcinoma&_susceptibility_to&_7&Adrenocortical_carcinoma&_hereditary&Carcinoma_of_pancreas&Choroid_plexus_papilloma&Familial_cancer_of_breast&Lip_and_oral_cavity_carcinoma&Gastric_cancer&Hereditary_cancer-predisposing_syndrome&not_provided&Ovarian_neoplasm&Malignant_tumor_of_esophagus&Li-Fraumeni_syndrome&Squamous_cell_carcinoma_of_the_head_and_neckNC_000017.11:g.7675088C>Treviewed_by_expert_panelPathogenicOncogeniccriteria_provided&_single_submitter19criteria_provided&_single_submitterTier_I_-_StrongTP53R175Hchr17:7675088-7675088v7.0..✓ Hotspot06/11/2024.TrueTrueTrueLoss-of-functionOncogenicLEVEL_Px143,450/1R175H0.5113636363636364GRCh38TP53CTMissense_MutationSNPC7675088TP53_R175H.GT:AD:AF:DP0/1:43,45:0.51:88TENSG00000141510TranscriptENST00000269305protein_coding666524175R/HcGc/cAc-1HGNCHGNC:11998YESMANE_SelectNM_000546.61P1CCDS11118.1ENSP00000269305P04637.307K7PPA8.92UPI000002ED67P04637-1EnsemblCC1PDB-ENSP_mappings:1gzh.A&PDB-ENSP_mappings:1gzh.C&PDB-ENSP_mappings:1kzy.A&PDB-ENSP_mappings:1kzy.B&PDB-ENSP_mappings:1tsr.A&PDB-ENSP_mappings:1tsr.B&PDB-ENSP_mappings:1tsr.C&PDB-ENSP_mappings:1tup.A&PDB-ENSP_mappings:1tup.B&PDB-ENSP_mappings:1tup.C&PDB-ENSP_mappings:1uol.A&PDB-ENSP_mappings:1uol.B&PDB-ENSP_mappings:1ycs.A&PDB-ENSP_mappings:2ac0.A&PDB-ENSP_mappings:2ac0.B&PDB-ENSP_mappings:2ac0.C&PDB-ENSP_mappings:2ac0.D&PDB-ENSP_mappings:2ady.A&PDB-ENSP_mappings:2ady.B&PDB-ENSP_mappings:2ahi.A&PDB-ENSP_mappings:2ahi.B&PDB-ENSP_mappings:2ahi.C&PDB-ENSP_mappings:2ahi.D&PDB-ENSP_mappings:2ata.A&PDB-ENSP_mappings:2ata.B&PDB-ENSP_mappings:2ata.C&PDB-ENSP_mappings:2ata.D&PDB-ENSP_mappings:2bim.A&PDB-ENSP_mappings:2bim.B&PDB-ENSP_mappings:2bin.A&PDB-ENSP_mappings:2bio.A&PDB-ENSP_mappings:2bip.A&PDB-ENSP_mappings:2biq.A&PDB-ENSP_mappings:2fej.A&PDB-ENSP_mappings:2h1l.M&PDB-ENSP_mappings:2h1l.N&PDB-ENSP_mappings:2h1l.O&PDB-ENSP_mappings:2h1l.P&PDB-ENSP_mappings:2h1l.Q&PDB-ENSP_mappings:2h1l.R&PDB-ENSP_mappings:2h1l.S&PDB-ENSP_mappings:2h1l.T&PDB-ENSP_mappings:2h1l.U&PDB-ENSP_mappings:2h1l.V&PDB-ENSP_mappings:2h1l.W&PDB-ENSP_mappings:2h1l.X&PDB-ENSP_mappings:2j1w.A&PDB-ENSP_mappings:2j1w.B&PDB-ENSP_mappings:2j1x.A&PDB-ENSP_mappings:2j1x.B&PDB-ENSP_mappings:2j1y.A&PDB-ENSP_mappings:2j1y.B&PDB-ENSP_mappings:2j1y.C&PDB-ENSP_mappings:2j1y.D&PDB-ENSP_mappings:2j1z.A&PDB-ENSP_mappings:2j1z.B&PDB-ENSP_mappings:2j20.A&PDB-ENSP_mappings:2j20.B&PDB-ENSP_mappings:2j21.A&PDB-ENSP_mappings:2j21.B&PDB-ENSP_mappings:2mej.B&PDB-ENSP_mappings:2ocj.A&PDB-ENSP_mappings:2ocj.B&PDB-ENSP_mappings:2ocj.C&PDB-ENSP_mappings:2ocj.D&PDB-ENSP_mappings:2pcx.A&PDB-ENSP_mappings:2vuk.A&PDB-ENSP_mappings:2vuk.B&PDB-ENSP_mappings:2wgx.A&PDB-ENSP_mappings:2wgx.B&PDB-ENSP_mappings:2x0u.A&PDB-ENSP_mappings:2x0u.B&PDB-ENSP_mappings:2x0v.A&PDB-ENSP_mappings:2x0v.B&PDB-ENSP_mappings:2x0w.A&PDB-ENSP_mappings:2x0w.B&PDB-ENSP_mappings:2xwr.A&PDB-ENSP_mappings:2xwr.B&PDB-ENSP_mappings:2ybg.A&PDB-ENSP_mappings:2ybg.B&PDB-ENSP_mappings:2ybg.C&PDB-ENSP_mappings:2ybg.D&PDB-ENSP_mappings:3d05.A&PDB-ENSP_mappings:3d06.A&PDB-ENSP_mappings:3d07.A&PDB-ENSP_mappings:3d07.B&PDB-ENSP_mappings:3d08.A&PDB-ENSP_mappings:3d09.A&PDB-ENSP_mappings:3d0a.A&PDB-ENSP_mappings:3d0a.B&PDB-ENSP_mappings:3d0a.C&PDB-ENSP_mappings:3d0a.D&PDB-ENSP_mappings:3igk.A&PDB-ENSP_mappings:3igl.A&PDB-ENSP_mappings:3kmd.A&PDB-ENSP_mappings:3kmd.B&PDB-ENSP_mappings:3kmd.C&PDB-ENSP_mappings:3kmd.D&PDB-ENSP_mappings:3kz8.A&PDB-ENSP_mappings:3kz8.B&PDB-ENSP_mappings:3q01.A&PDB-ENSP_mappings:3q01.B&PDB-ENSP_mappings:3q05.A&PDB-ENSP_mappings:3q05.B&PDB-ENSP_mappings:3q05.C&PDB-ENSP_mappings:3q05.D&PDB-ENSP_mappings:3q06.A&PDB-ENSP_mappings:3q06.B&PDB-ENSP_mappings:3q06.C&PDB-ENSP_mappings:3q06.D&PDB-ENSP_mappings:3ts8.A&PDB-ENSP_mappings:3ts8.B&PDB-ENSP_mappings:3ts8.C&PDB-ENSP_mappings:3ts8.D&PDB-ENSP_mappings:3zme.A&PDB-ENSP_mappings:3zme.B&PDB-ENSP_mappings:4agl.A&PDB-ENSP_mappings:4agl.B&PDB-ENSP_mappings:4agm.A&PDB-ENSP_mappings:4agm.B&PDB-ENSP_mappings:4agn.A&PDB-ENSP_mappings:4agn.B&PDB-ENSP_mappings:4ago.A&PDB-ENSP_mappings:4ago.B&PDB-ENSP_mappings:4agp.A&PDB-ENSP_mappings:4agp.B&PDB-ENSP_mappings:4agq.A&PDB-ENSP_mappings:4agq.B&PDB-ENSP_mappings:4hje.A&PDB-ENSP_mappings:4hje.B&PDB-ENSP_mappings:4hje.C&PDB-ENSP_mappings:4hje.D&PDB-ENSP_mappings:4ibq.A&PDB-ENSP_mappings:4ibq.B&PDB-ENSP_mappings:4ibq.C&PDB-ENSP_mappings:4ibq.D&PDB-ENSP_mappings:4ibs.A&PDB-ENSP_mappings:4ibs.B&PDB-ENSP_mappings:4ibs.C&PDB-ENSP_mappings:4ibs.D&PDB-ENSP_mappings:4ibt.A&PDB-ENSP_mappings:4ibt.B&PDB-ENSP_mappings:4ibt.C&PDB-ENSP_mappings:4ibt.D&PDB-ENSP_mappings:4ibu.A&PDB-ENSP_mappings:4ibu.B&PDB-ENSP_mappings:4ibu.C&PDB-ENSP_mappings:4ibu.D&PDB-ENSP_mappings:4ibv.A&PDB-ENSP_mappings:4ibw.A&PDB-ENSP_mappings:4iby.A&PDB-ENSP_mappings:4iby.B&PDB-ENSP_mappings:4ibz.A&PDB-ENSP_mappings:4ibz.B&PDB-ENSP_mappings:4ibz.C&PDB-ENSP_mappings:4ibz.D&PDB-ENSP_mappings:4ijt.A&PDB-ENSP_mappings:4kvp.A&PDB-ENSP_mappings:4kvp.B&PDB-ENSP_mappings:4kvp.C&PDB-ENSP_mappings:4kvp.D&PDB-ENSP_mappings:4lo9.A&PDB-ENSP_mappings:4lo9.B&PDB-ENSP_mappings:4lo9.C&PDB-ENSP_mappings:4lo9.D&PDB-ENSP_mappings:4loe.A&PDB-ENSP_mappings:4loe.B&PDB-ENSP_mappings:4loe.C&PDB-ENSP_mappings:4loe.D&PDB-ENSP_mappings:4lof.A&PDB-ENSP_mappings:4mzi.A&PDB-ENSP_mappings:4mzr.A&PDB-ENSP_mappings:4mzr.B&PDB-ENSP_mappings:4mzr.C&PDB-ENSP_mappings:4mzr.D&PDB-ENSP_mappings:4qo1.B&PDB-ENSP_mappings:4xr8.C&PDB-ENSP_mappings:4xr8.D&PDB-ENSP_mappings:5a7b.A&PDB-ENSP_mappings:5a7b.B&PDB-ENSP_mappings:5ab9.A&PDB-ENSP_mappings:5ab9.B&PDB-ENSP_mappings:5aba.A&PDB-ENSP_mappings:5aba.B&PDB-ENSP_mappings:5aoi.A&PDB-ENSP_mappings:5aoi.B&PDB-ENSP_mappings:5aoj.A&PDB-ENSP_mappings:5aoj.B&PDB-ENSP_mappings:5aok.A&PDB-ENSP_mappings:5aok.B&PDB-ENSP_mappings:5aol.A&PDB-ENSP_mappings:5aol.B&PDB-ENSP_mappings:5aom.A&PDB-ENSP_mappings:5aom.B&PDB-ENSP_mappings:5bua.A&PDB-ENSP_mappings:5ecg.A&PDB-ENSP_mappings:5ecg.B&PDB-ENSP_mappings:5g4m.A&PDB-ENSP_mappings:5g4m.B&PDB-ENSP_mappings:5g4n.A&PDB-ENSP_mappings:5g4n.B&PDB-ENSP_mappings:5g4o.A&PDB-ENSP_mappings:5g4o.B&PDB-ENSP_mappings:5lap.A&PDB-ENSP_mappings:5lap.B&PDB-ENSP_mappings:5lgy.A&PDB-ENSP_mappings:5lgy.B&PDB-ENSP_mappings:5lgy.C&PDB-ENSP_mappings:5lgy.D&PDB-ENSP_mappings:5mct.A&PDB-ENSP_mappings:5mct.B&PDB-ENSP_mappings:5mcu.A&PDB-ENSP_mappings:5mcu.B&PDB-ENSP_mappings:5mcv.A&PDB-ENSP_mappings:5mcv.B&PDB-ENSP_mappings:5mcw.A&PDB-ENSP_mappings:5mcw.B&PDB-ENSP_mappings:5mf7.A&PDB-ENSP_mappings:5mf7.B&PDB-ENSP_mappings:5mg7.A&PDB-ENSP_mappings:5mg7.B&PDB-ENSP_mappings:5o1a.A&PDB-ENSP_mappings:5o1a.B&PDB-ENSP_mappings:5o1b.A&PDB-ENSP_mappings:5o1b.B&PDB-ENSP_mappings:5o1c.A&PDB-ENSP_mappings:5o1c.B&PDB-ENSP_mappings:5o1d.A&PDB-ENSP_mappings:5o1d.B&PDB-ENSP_mappings:5o1e.A&PDB-ENSP_mappings:5o1e.B&PDB-ENSP_mappings:5o1f.A&PDB-ENSP_mappings:5o1f.B&PDB-ENSP_mappings:5o1g.A&PDB-ENSP_mappings:5o1g.B&PDB-ENSP_mappings:5o1h.A&PDB-ENSP_mappings:5o1h.B&PDB-ENSP_mappings:5o1i.A&PDB-ENSP_mappings:5o1i.B&PDB-ENSP_mappings:5xzc.B&PDB-ENSP_mappings:5xzc.C&PDB-ENSP_mappings:5xzc.D&PDB-ENSP_mappings:5xzc.E&PDB-ENSP_mappings:6ff9.A&PDB-ENSP_mappings:6ff9.B&PDB-ENSP_mappings:6ff9.C&PDB-ENSP_mappings:6ff9.D&PDB-ENSP_mappings:6fj5.A&PDB-ENSP_mappings:6fj5.B&PDB-ENSP_mappings:6fj5.C&PDB-ENSP_mappings:6fj5.D&PDB-ENSP_mappings:6gga.A&PDB-ENSP_mappings:6gga.B&PDB-ENSP_mappings:6ggb.A&PDB-ENSP_mappings:6ggb.B&PDB-ENSP_mappings:6ggc.A&PDB-ENSP_mappings:6ggc.B&PDB-ENSP_mappings:6ggd.A&PDB-ENSP_mappings:6ggd.B&PDB-ENSP_mappings:6gge.A&PDB-ENSP_mappings:6gge.B&PDB-ENSP_mappings:6ggf.A&PDB-ENSP_mappings:6ggf.B&PDB-ENSP_mappings:6lhd.A&PDB-ENSP_mappings:6lhd.B&PDB-ENSP_mappings:6rz3.A&PDB-ENSP_mappings:6shz.A&PDB-ENSP_mappings:6shz.B&PDB-ENSP_mappings:6si0.A&PDB-ENSP_mappings:6si0.B&PDB-ENSP_mappings:6si1.A&PDB-ENSP_mappings:6si1.B&PDB-ENSP_mappings:6si2.A&PDB-ENSP_mappings:6si2.B&PDB-ENSP_mappings:6si3.A&PDB-ENSP_mappings:6si3.B&PDB-ENSP_mappings:6si4.A&PDB-ENSP_mappings:6si4.B&PDB-ENSP_mappings:6sl6.A&PDB-ENSP_mappings:6vqo.P&PDB-ENSP_mappings:6vqo.Q&PDB-ENSP_mappings:6vr1.P&PDB-ENSP_mappings:6vr1.Q&PDB-ENSP_mappings:6vr5.P&PDB-ENSP_mappings:6vr5.Q&PDB-ENSP_mappings:6vrm.P&PDB-ENSP_mappings:6vrn.P&PDB-ENSP_mappings:6w51.C&PDB-ENSP_mappings:6w51.F&PDB-ENSP_mappings:6w51.I&PDB-ENSP_mappings:6w51.L&PDB-ENSP_mappings:6xre.M&PDB-ENSP_mappings:6znc.A&PDB-ENSP_mappings:7b46.A&PDB-ENSP_mappings:7b46.B&PDB-ENSP_mappings:7b46.C&PDB-ENSP_mappings:7b46.D&PDB-ENSP_mappings:7b47.A&PDB-ENSP_mappings:7b47.B&PDB-ENSP_mappings:7b47.C&PDB-ENSP_mappings:7b47.D&PDB-ENSP_mappings:7b48.A&PDB-ENSP_mappings:7b48.B&PDB-ENSP_mappings:7b48.C&PDB-ENSP_mappings:7b48.D&PDB-ENSP_mappings:7b49.A&PDB-ENSP_mappings:7b49.B&PDB-ENSP_mappings:7b4a.A&PDB-ENSP_mappings:7b4a.B&PDB-ENSP_mappings:7b4b.A&PDB-ENSP_mappings:7b4b.B&PDB-ENSP_mappings:7b4b.C&PDB-ENSP_mappings:7b4b.D&PDB-ENSP_mappings:7b4c.A&PDB-ENSP_mappings:7b4c.B&PDB-ENSP_mappings:7b4c.C&PDB-ENSP_mappings:7b4c.D&PDB-ENSP_mappings:7b4d.A&PDB-ENSP_mappings:7b4e.A&PDB-ENSP_mappings:7b4f.A&PDB-ENSP_mappings:7b4g.A&PDB-ENSP_mappings:7b4h.A&PDB-ENSP_mappings:7b4n.A&PDB-ENSP_mappings:7dhy.A&PDB-ENSP_mappings:7dhy.B&PDB-ENSP_mappings:7dhy.C&PDB-ENSP_mappings:7dhy.D&PDB-ENSP_mappings:7dhz.A&PDB-ENSP_mappings:7dhz.B&PDB-ENSP_mappings:7dvd.A&PDB-ENSP_mappings:7dvd.B&PDB-ENSP_mappings:7dvd.C&PDB-ENSP_mappings:7dvd.D&PDB-ENSP_mappings:7eax.A&PDB-ENSP_mappings:7eax.B&PDB-ENSP_mappings:7eax.C&PDB-ENSP_mappings:7eax.D&PDB-ENSP_mappings:7eds.A&PDB-ENSP_mappings:7eeu.A&PDB-ENSP_mappings:7eeu.B&PDB-ENSP_mappings:7eeu.C&PDB-ENSP_mappings:7eeu.D&PDB-ENSP_mappings:7eeu.E&PDB-ENSP_mappings:7eeu.F&PDB-ENSP_mappings:7eeu.G&PDB-ENSP_mappings:7eeu.H&PDB-ENSP_mappings:7rm4.C&PDB-ENSP_mappings:7rm4.H&PDB-ENSP_mappings:7rm4.M&PDB-ENSP_mappings:7rm4.R&PDB-ENSP_mappings:7v97.A&PDB-ENSP_mappings:7v97.B&PDB-ENSP_mappings:7v97.C&PDB-ENSP_mappings:7v97.D&PDB-ENSP_mappings:7xzx.K&PDB-ENSP_mappings:7xzx.L&PDB-ENSP_mappings:7xzx.M&PDB-ENSP_mappings:7xzx.N&PDB-ENSP_mappings:7xzz.K&PDB-ENSP_mappings:7xzz.L&PDB-ENSP_mappings:7xzz.M&PDB-ENSP_mappings:7xzz.N&PDB-ENSP_mappings:7ygi.A&PDB-ENSP_mappings:7ygi.B&PDB-ENSP_mappings:8a31.A&PDB-ENSP_mappings:8a31.B&PDB-ENSP_mappings:8a32.A&PDB-ENSP_mappings:8a32.B&PDB-ENSP_mappings:8a92.A&PDB-ENSP_mappings:8a92.B&PDB-ENSP_mappings:8cg7.A&PDB-ENSP_mappings:8cg7.B&PDB-ENSP_mappings:8dc4.A&PDB-ENSP_mappings:8dc4.B&PDB-ENSP_mappings:8dc4.C&PDB-ENSP_mappings:8dc4.D&PDB-ENSP_mappings:8dc6.A&PDB-ENSP_mappings:8dc6.B&PDB-ENSP_mappings:8dc6.C&PDB-ENSP_mappings:8dc6.D&PDB-ENSP_mappings:8dc7.A&PDB-ENSP_mappings:8dc8.A&PDB-ENSP_mappings:8e7a.A&PDB-ENSP_mappings:8e7b.A&PDB-ENSP_mappings:8e7b.B&PDB-ENSP_mappings:8f2h.A&PDB-ENSP_mappings:8f2h.B&PDB-ENSP_mappings:8f2i.A&PDB-ENSP_mappings:8gcr.B&PDB-ENSP_mappings:8hll.A&PDB-ENSP_mappings:8hlm.A&PDB-ENSP_mappings:8hln.A&PDB-ENSP_mappings:8j8n.A&PDB-ENSP_mappings:8j8n.B&PDB-ENSP_mappings:8j8n.C&PDB-ENSP_mappings:8j8n.D&PDB-ENSP_mappings:8qwk.A&PDB-ENSP_mappings:8qwl.A&PDB-ENSP_mappings:8qwm.A&PDB-ENSP_mappings:8qwm.B&PDB-ENSP_mappings:8qwn.A&PDB-ENSP_mappings:8qwo.A&PDB-ENSP_mappings:8qwo.B&PDB-ENSP_mappings:8qwp.A&PDB-ENSP_mappings:8qwp.B&PDB-ENSP_mappings:8r1f.C&PDB-ENSP_mappings:8r1g.C&PDB-ENSP_mappings:8r1g.F&PDB-ENSP_mappings:8wd2.A&PDB-ENSP_mappings:8wd2.B&PDB-ENSP_mappings:8xp5.A&PDB-ENSP_mappings:8xp5.B&Superfamily:SSF49417&Prints:PR00386&Gene3D:2.60.40.720&Pfam:PF00870&PANTHER:PTHR11447&CDD:cd08367&AFDB-ENSP_mappings:AF-P04637-F10000005.396e-060000000001.47e-0500pathogenic&not_provided&likely_pathogenic0&1&1&1&1&1&11&1&1&1&1&1&126900293&34239995&25157968&21264207&34203389&21305319&32000721&25105660&16489069&17606709&18511570&23161690&33076847&24929325&21761402&16401470&8649785&9047394&11101847&15977174&18391940&19881536&20128691&20689556&21343334&22233476&22698404&23792586&24573247&36531003&31907277&31371350&34964846&33174010&35328276&32467344&36077746&28163917&34771529&35867400&23639312&25404506&37304756&36866106&34514028&30709875&30816478&12619118&37435187&38459566&38310289&38156855FAIL112811-35TP53123740.0000127413.&MONDO:MONDO:0005575&MedGen:C0346629&OMIM:114500&MONDO:MONDO:0015459&MedGen:C2931822&OMIM:607107&Orphanet:150&MONDO:MONDO:0002629&MedGen:C0585442&OMIM:259500&Orphanet:668&Human_Phenotype_Ontology:HP:0001402&Human_Phenotype_Ontology:HP:0002899&Human_Phenotype_Ontology:HP:0003007&Human_Phenotype_Ontology:HP:0006750&MONDO:MONDO:0007256&MedGen:C2239176&OMIM:114550&Orphanet:88673&Gene:553989&MedGen:C1835398&OMIM:151623&Orphanet:524&MONDO:MONDO:0024498&MedGen:C2750850&OMIM:137800&MONDO:MONDO:0032573&MedGen:C4748488&OMIM:618165&MONDO:MONDO:0013876&MedGen:C3553606&OMIM:614740&MONDO:MONDO:0008734&MedGen:C1859972&OMIM:202300&Orphanet:1501&MONDO:MONDO:0005192&MedGen:C0235974&Orphanet:1333&Orphanet:217074&Human_Phenotype_Ontology:HP:0200022&MONDO:MONDO:0009837&MedGen:C0205770&OMIM:260500&Orphanet:251899&Orphanet:2807&MONDO:MONDO:0016419&MedGen:C0346153&OMIM:114480&Orphanet:227535&MONDO:MONDO:0023644&MedGen:C0220641&Human_Phenotype_Ontology:HP:0012126&MONDO:MONDO:0001056&MeSH:D013274&MedGen:C0024623&OMIM:613659&MONDO:MONDO:0015356&MeSH:D009386&MedGen:C0027672&Orphanet:140162&MedGen:C3661900&Human_Phenotype_Ontology:HP:0100615&MONDO:MONDO:0021068&MeSH:D010051&MedGen:C0919267&MONDO:MONDO:0007576&MedGen:C0546837&OMIM:133239&Orphanet:99977&MONDO:MONDO:0018875&MedGen:C0085390&OMIM:PS151623&Orphanet:524&MONDO:MONDO:0010150&MeSH:D000077195&MedGen:C1168401&OMIM:275355&Orphanet:67037SCV005201131single_nucleotide_variantSO:0001483ClinGen:CA000251&OMIM:191170.0030&UniProtKB:P04637#VAR_005932TP53:7157SO:0001583&missense_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV00509444028934578Diffuse_midline_glioma&_H3_K27M-mutant&Undifferentiated_embryonal_sarcoma_of_the_liver&Small_intestine_adenocarcinoma&IDH-wildtype_glioblastoma&Medulloblastoma_SHH_activated_and_TP53_mutant&Astrocytoma_IDH-mutant&NeuroblastomaMONDO:MONDO:0957196&MedGen:C4289688&MONDO:MONDO:0015795&MedGen:C2205345&Orphanet:178315&Human_Phenotype_Ontology:HP:0040274&MONDO:MONDO:0003198&MedGen:C0278803&Orphanet:104075&MONDO:MONDO:0850335&MedGen:CN372125&MONDO:MONDO:0956964&MedGen:CN377553&MedGen:C5669733&Human_Phenotype_Ontology:HP:0003006&Human_Phenotype_Ontology:HP:0006738&MONDO:MONDO:0005072&MeSH:D009447&MedGen:C0027819&Orphanet:635SCV007104864&SCV007105303&SCV007105574&SCV007105584&SCV007105618&SCV00710562717:7675088-76750881TP53p.R175H.True.The TP53 R175H mutation is located in the protein's DNA binding domain. This mutation has been found in acute myeloid leukemia (PMID: 31068365). In vitro and in vivo studies have demonstrated that this mutation is inactivating and oncogenic, as measured by the reduced ability to induce apoptosis and form colonies, as well as increased cell migration and faster progression of hematopoietic malignancy of the mutant compared to TP53 wildtype or deletion (PMID: 15781620, 25584008, 31068365). Structural studies have also shown that this mutant is defective in protein folding and DNA binding (PMID: 10713666, 21445056)..TP53, a tumor suppressor in the DNA damage pathway, is the most frequently mutated gene in cancer...25584008|15781620|10713666|21445056|31068365LEVEL_Px1.R175H7157TP53GRCh38.MUTATION..The TP53 R175H mutation is known to be oncogenic.False.The TP53 R175H mutation is located in the protein's DNA binding domain. This mutation has been found in acute myeloid leukemia (PMID: 31068365). In vitro and in vivo studies have demonstrated that this mutation is inactivating and oncogenic, as measured by the reduced ability to induce apoptosis and form colonies, as well as increased cell migration and faster progression of hematopoietic malignancy of the mutant compared to TP53 wildtype or deletion (PMID: 15781620, 25584008, 31068365). Structural studies have also shown that this mutant is defective in protein folding and DNA binding (PMID: 10713666, 21445056).['25584008', '15781620', '10713666', '21445056', '31068365']25584008;15781620;10713666;21445056;31068365MDS,AMLMRC,TMN,CLLSLL,PMF,AML,MPN,ETMCL21714648;25092778;24220272;25412851;25860933;25412846;25952993;23243274;24004666;20697090;19188171;24652989;25516983;22052707;22887079;22186996;18596741;8639789;7579380;28819011;24684350;26022239;24478400;2929669288Tmissense_variantTP537157GeneENST00000269305.4ENST00000269305.4:c.524G>ANP_000537.3:p.Arg175His116ARG175HIS/RS28934578/R43H/R136Hhttps://civicdb.org/links/variants/116TP53_R175H116NM_000546.5:c.524G>A/NP_000537.3:p.Arg175His/NC_000017.10:g.7578406C>T/ENST00000269305.4:c.524G>ACA00025112374
TUMORchr1739687914N<DUP>PASSNM_004448transcript_amplificationHIGHERBB2nanduplicationv7.0.LEVEL_Fda2False03/20/2026LEVEL_142512DUPTrueTrueTrueGain-of-functionOncogenicAdo-Trastuzumab Emtansine,Lapatinib,Capecitabine,Margetuximab,Chemotherapy,Neratinib,Pembrolizumab,Trastuzumab,Trastuzumab Deruxtecan,Pertuzumab,Tucatinib,LetrozoleAdo-Trastuzumab Emtansine,Lapatinib,Trastuzumab,Trastuzumab Deruxtecan,Carboplatin-Taxol Regimen,Pertuzumab,Tucatinib,DocetaxelTrastuzumab Deruxtecan,ZanidatamabLEVEL_1.0/1GRCh38ERBB2N<DUP>transcript_amplificationINSN39687914MantaDUP:ERBB2_AMP.GT:PR:SR0/1:25,18:10,8duplicationENSG00000141736TranscriptENST00000269571protein_coding1HGNCHGNC:3430YESMANE_SelectNM_004448.41P1CCDS32642.1ENSP00000269571P04626.275X5DNK3.71UPI000003F55FP04626-1Ensembl10,10,139730426{'abstract': 'Mondaca et al. JCO PO, 2019.', 'link': 'https://ascopubs.org/doi/full/10.1200/PO.19.00223'}False.ERBB2 amplification results in overexpression of the HER2 protein. Overexpression of HER2 (ERBB2) in murine fibroblasts and in the mammary glands of genetically engineered mouse models have demonstrated that it is activating as measured by increased pathway activation and tumor growth (PMID: 23204226, 12124352, 11571643, 10716706, 2885917). In vitro studies have demonstrated that this mutation is sensitive to trastuzumab when expressed in biliary tract cancer cell lines as measured by decreased proliferation upon drug treatment (PMID: 30659304). One patient with biliary tract cancer overexpressing ERBB2 had a partial response to an ERBB2-targeting antibody linked to a cytotoxic agent, ado-trastuzumab emtansine (Abstract: Mondaca et al. JCO PO, 2019. https://ascopubs.org/doi/full/10.1200/PO.19.00223)..ERBB2, a receptor tyrosine kinase, is altered by mutation, amplification and/or overexpression in various cancer types, most frequently in breast, esophagogastric and endometrial cancers...30659304|12124352|2885917|10716706|23204226|11571643..Amplification2064ERBB2GRCh38.CNA..ERBB2 amplification is known to be oncogenic.FalseLEVEL_Fda2ERBB2 amplification results in overexpression of the HER2 protein. Overexpression of HER2 (ERBB2) in murine fibroblasts and in the mammary glands of genetically engineered mouse models have demonstrated that it is activating as measured by increased pathway activation and tumor growth (PMID: 23204226, 12124352, 11571643, 10716706, 2885917). In vitro studies have demonstrated that this mutation is sensitive to trastuzumab when expressed in biliary tract cancer cell lines as measured by decreased proliferation upon drug treatment (PMID: 30659304). One patient with biliary tract cancer overexpressing ERBB2 had a partial response to an ERBB2-targeting antibody linked to a cytotoxic agent, ado-trastuzumab emtansine (Abstract: Mondaca et al. JCO PO, 2019. https://ascopubs.org/doi/full/10.1200/PO.19.00223).['30659304', '12124352', '2885917', '10716706', '23204226', '11571643'][{'abstract': 'Mondaca et al. JCO PO, 2019.', 'link': 'https://ascopubs.org/doi/full/10.1200/PO.19.00223'}]['Amplification']Ado-Trastuzumab EmtansineLEVEL_1LEVEL_Fda2['23020162']Ado-trastuzumab emtansine (T-DM1) is an intravenously infused, ERBB2-targeted antibody and microtubule inhibitory conjugate that is FDA-approved for the treatment of patients with HER2-positive metastatic breast cancer who previously received trastuzumab and a taxane, separately or in combination. HER2-positive status was defined as immunohistochemistry (IHC) 3+ or FISH amplification ratio 2.0 in breast tumor samples. FDA approval was based on the results from the Phase III EMILIA (NCT00829166) trial of T-DM1 versus lapatinib plus capecitabine in 991 patients with HER2-positive advanced breast cancer who had prior treatment with trastuzumab and a taxane (PMID: 23020162). In the Phase III EMILIA (NCT00829166) trial, the T-DM1 treated cohort (n=495) demonstrated a median progression-free survival (PFS) of 9.6 months, a median overall survival (OS) of 30.9 months and an objective response rate (ORR) of 43.6% (n=173). The lapatinib plus capecitabine treated cohort (n=496) demonstrated a median PFS of 6.4 months (HR=0.650 [95% CI=0.549-0.771], p<0.0001), a median OS of 25.1 months (HR=0.682 [95% CI=0.548-0.849], p=0.0006) and an ORR of 30.8% (n=120) (12.7% ORR difference [95% CI=6.0-19.4]) (PMID: 23020162).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Lapatinib + CapecitabineLEVEL_1LEVEL_Fda2['19786658', '17192538']Lapatinib is an oral, ATP-competitive, reversible tyrosine kinase inhibitor that targets both EGFR and ERBB2 and is FDA-approved in combination with capecitabine for patients with advanced or metastatic ERBB2-overexpressing breast cancer who had received prior therapy with an anthracycline, a taxane or trastuzumab. FDA approval was based on results from a randomized, Phase III trial in which eligible patients treated with lapatinib and capecitabine had a shorter time-to-progression (TTP) (8.4 months vs. 4.4, hazard ratio, 0.47, p<0.001) compared to patients that received capecitabine alone (PMID: 17192538). Lapatinib is also FDA-approved in combination with letrozole for the treatment of metastatic, postmenopausal breast cancer that is both ERBB2-positive and hormone receptor-positive. FDA approval in this context was based on evidence from the EGF30008 trial in which eligible patients treated with lapatinib plus letrozole showed a significantly improved progression-free survival (PFS) (median PFS, 8.2 vs. 3.0 months) compared to patients treated with letrozole plus placebo (PMID: 19786658). Treatment with lapatinib also significantly improved clinical benefit rates (CBR) (48% with letrozole-lapatinib vs. 29% with letrozole alone) and was associated with a trend toward improvement in overall survival (OS) (PMID: 19786658).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Margetuximab + ChemotherapyLEVEL_1LEVEL_Fda2['33480963']Margetuximab, a monoclonal antibody targeting the HER2 protein, is FDA-approved in combination with chemotherapy for the treatment of adult patients with metastatic HER2-positive breast cancer who have received two or more prior anti-HER2 regimens, at least one of which was for metastatic disease. FDA approval was based on the randomized, open-label Phase III SOPHIA trial of Margetuximab-cmkb + chemotherapy versus Trastuzumab + chemotherapy in 536 patients with HER2+ breast cancer who had received two or more prior anti-HER2 regimens, in which the progression-free survival was 5.8 months (95% CI= 5.5-7.0) versus 4.9 months (95% CI:=4.2-5.6) [HR=76 (0.59, 0.98)], and the objective response rate was 22% (95% CI=17-27) versus 16% (95% CI=12-20), respectively (PMID: 33480963)66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']NeratinibLEVEL_1LEVEL_Fda2['29146401', '30274983', '26874901', '30860945']Neratinib is a small molecule inhibitor of the ERBB2 and EGFR kinases that is FDA-approved for HER2-positive breast cancer previously treated with adjuvant trastuzumab. FDA approval was based on results from the Phase III ExteNET trial of neratinib in 2,840 patients with HER2-positive breast cancer who had been previously treated with trastuzumab in which the two-year disease-free survival rate was 93.9% (95% CI= 92.4-95.2) in the neratinib group versus 91.0% (95% CI= 89.3-92.5) in the placebo group (HR= 0.63, p=00017) following one year of drug administration (PMID: 26874901). Five-year follow-up of patients from the ExteNET trial demonstrated that the benefit of neratinib treatment continues past the two-year follow-up, with the five-year invasive disease-free survival being 90.2% (95% CI= 88.3-91.8) in the neratinib group versus 87.7% (95% CI= 85.7-89.4) in the placebo group (PMID: 29146401). In vitro studies in mice have demonstrated that sustained ER inhibition can lead to ERBB2 pathway activation, suggesting a mechanism for neratinib utility in this context (PMID: 30274983). Neratinib with the addition of chemotherapy (capecitabine) has been shown to be active in patients with ERBB2-positive breast cancer with brain metastases (PMID: 30860945).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Pembrolizumab + Trastuzumab + ChemotherapyLEVEL_1LEVEL_Fda2['37871604', '34912120'][{'abstract': 'Janjigian et al. Abstract# 1400O, ESMO 2024.', 'link': 'https://www.annalsofoncology.org/article/S0923-7534(24)02985-5/fulltext'}]Pembrolizumab is an intravenously administered, anti-PD-1 antibody that is FDA-approved in combination with trastuzumab, fluoropyrimidine- and platinum-containing chemotherapy for the first-line treatment of adults with locally advanced unresectable or metastatic HER2-positive gastric or gastroesophageal junction (GEJ) adenocarcinoma whose tumors express PD-L1 (combined positive score [CPS] 1) as determined by an FDA-approved test. PD-L1 protein expression for treatment with pembrolizumab plus trastuzumab and chemotherapy was detected through the PD-L1 IHC 22C3 pharmDx kit. FDA approval was based on results from the Phase III KEYNOTE-811 (NCT03615326) trial of pembrolizumab plus trastuzumab and chemotherapy versus placebo plus trastuzumab and chemotherapy in patients with HER2-positive (defined as immunohistochemistry [IHC] 3+ or IHC 2+ with positive in-situ hybridization [ISH] or fluorescence in-situ hybridization [FISH]) gastric or GEJ adenocarcinoma. _In the initial analysis of the Phase III KEYNOTE-811 (NCT03615326) trial, the pembrolizumab cohort (n=133) demonstrated an overall response rate (ORR) of 74.4% (95% CI= 66.2-81.6), with fifteen (11.3%) complete responses (CR), 84 (63.2%) partial responses (PR) and 29 (21.8%) stable disease (SD) responses, versus 51.9% (95% CI= 43.0-60.7) in the placebo cohort (n=131), with four (3.1%) CRs, 64 (48.9%) PRs and 49 (37.4%) SD responses (PMID: 34912120). _In the 38-month interim analysis for the Phase III KEYNOTE-811 (NCT03615326) trial, 286 (82%) patients of the pembrolizumab cohort (n=350) and 304 (88%) patients of the placebo cohort (n=346) discontinued treatment due to disease progression (PMID: 37871604). The pembrolizumab group demonstrated a median progression-free survival (PFS) of 10.0 months (95% CI=8.6-12.2) and a median overall survival (OS) of 20.0 months (95% CI=17.8-22.1). The placebo cohort demonstrated a median PFS of 8.1 months (95% CI=7.1-8.6) (HR=0.73 [95% CI=0.61-0.87]) and a median OS of 16.9 months (95% CI=15.0-18.7) (HR=0.84 [95% CI=0.70-1.01]) (PMID: 37871604)._In the final analysis of the Phase III KEYNOTE-811 (NCT03615326) trial of patients with PD-L1 (CPS 1) status, the pembrolizumab cohort (n=298) demonstrated a median PFS of 10.9 months and a median OS of 20.1 months (Abstract: Janjigian et al. Abstract# 1400O, ESMO 2024. https://www.annalsofoncology.org/article/S0923-7534(24)02985-5/fulltext). The placebo cohort (n=296) demonstrated a median PFS of 7.3 months (HR=0.72 [95% CI=0.60-0.87]) and a median OS of 15.7 months (HR=0.79 [95% CI=0.66-0.95]) (Abstract: Janjigian et al. Abstract# 1400O, ESMO 2024. https://www.annalsofoncology.org/article/S0923-7534(24)02985-5/fulltext).186.0EGCLightSkyBlueEsophagogastric AdenocarcinomaEsophagogastric CancerSOLIDEsophagus/StomachSTOMACH2.0SOLID['Amplification']TrastuzumabLEVEL_1LEVEL_Fda2['16236738']Trastuzumab, a humanized, recombinant monoclonal antibody that targets the HER2 receptor, is FDA approved for the adjuvant treatment of HER2-overexpressing breast cancer. FDA approval was based on two Phase III trials (NSABP B31 and NCCTG N9831) of trastuzumab in 3,752 patients with HER2-overexpressing breast cancer in which disease-free survival at four years was 85.3% in the trastuzumab group versus 67.1% in the control group, and overall survival at four years was 91.4% in the trastuzumab group versus 86.6% in the control group (HR=0.48, 95% CI= 0.39-0.59)(PMID: 16236738).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Trastuzumab DeruxtecanLEVEL_1LEVEL_Fda2['38092229', '31825192']Trastuzumab deruxtecan (T-DXd) is a HER2-directed antibody and topoisomerase inhibitor conjugate that is FDA-approved for patients with unresectable or metastatic HER2-positive (defined as immunohistochemistry (IHC) 3+) breast cancer previously treated with anti-HER2-based regimens in the metastatic setting. FDA approval was based on the results of the Phase II DESTINY-Breast01 (NCT03248492) trial of T-DXd in 184 adult patients with HER2-positive (IHC 3+ or ISH-positive) metastatic breast cancer. __In the Phase II DESTINY-Breast01 (NCT03248492) trial, response to T-DXd was observed in 112 of 184 patients (60.9%) (95% CI=53.4-68.0) and the median progression-free survival (PFS) was 16.4 months (95% CI=12.7-NR) (PMID: 31825192). __In the updated survival results from the Phase II DESTINY-Breast01 (NCT03248492) trial, the overall response rate (ORR) by independent central review was 62.0% (95% CI=54.5-69.0), the median overall survival was 29.1 months (95% CI=24.6-36.1), the median PFS was 19.4 months (95% CI=14.1-25.0) and the median duration of response (DOR) was 18.2 months (95 %CI=15.0-NE) (PMID: 38092229).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Trastuzumab DeruxtecanLEVEL_1LEVEL_Fda2['32469182', '37329891']Trastuzumab Deruxtecan is a HER2-directed antibody and topoisomerase inhibitor conjugate that is FDA-approved for patients with locally advanced or metastatic HER2-positive gastric or gastroesophageal (GEJ) adenocarcinoma who have received a prior trastuzumab-based regimen. FDA approval was based on the multicenter, open-label, randomized DESTINY-Gastric01 trial of trastuzumab deruxtecan versus irinotecan or paclitaxel in 188 patients with HER2+ locally advanced or metastatic gastric or GEJ adenocarcinoma in which the median overall survival was 12.5 months (95% CI: 9.6-14.3) versus 8.4 months (95% CI= 6.9-10.7)(HR= 0.59 [0.39-0.88], p = 0.0097) and the overall response rate was 40.5% (95% CI= 31.8-49.6) versus 11.3% (95% CI= 4.7-21.9) (PMID: 32469182). In the single-arm, Phase II DESTINY-Gastric02 trial of trastuzumab deruxtecan in 79 patients with HER2-positive unresectable or metastatic gastric or GEJ adenocarcinoma, the objective response rate was 42% (33/79, 95% CI: 30.853.4) with 5% complete response (4/79) and 37% partial response (29/79) (PMID: 37329891).186.0EGCLightSkyBlueEsophagogastric AdenocarcinomaEsophagogastric CancerSOLIDEsophagus/StomachSTOMACH2.0SOLID['Amplification']Trastuzumab Deruxtecan + PertuzumabLEVEL_1LEVEL_Fda2['41160818']Trastuzumab deruxtecan (T-DXd) is a HER2-directed antibody and topoisomerase inhibitor conjugate that is FDA-approved in combination with pertuzumab for the first-line treatment of adult patients with unresectable or metastatic HER2-positive (defined as immunohistochemistry (IHC) 3+ or in situ hybridization (ISH) positive) breast cancer as determined by an FDA-approved test. HER2-positive (IHC3+ or ISH-positive) was detected by the PATHWAY anti-HER-2/neu (4B5) Rabbit Monoclonal Primary Antibody and HER2 Dual ISH DNA Probe Cocktail companion diagnostic devices. FDA approval was based on the results of the Phase III DESTINY-Breast09 (NCT04784715) trial of T-DXd in 1157 adults with HER2-positive (IHC3+ or ISH-positive) advanced or metastatic breast cancer who had not received prior chemotherapy or HER2-targeted therapy or had received neoadjuvant or adjuvant HER2-targeted therapy more than six months before the diagnosis of advanced or metastatic disease. __In the Phase III DESTINY-Breast09 (NCT04784715) trial, the T-DXd plus pertuzumab cohort (n=383) demonstrated an overall response rate (ORR) of 85.1% (95% CI=81.2-88.5), with a complete response (CR) of 15.1% (n=58), partial response (PR) of 70% (n=268), stable disease (SD) rate of 9.9% (n=38) and progressive disease (PD) rate of 3.4% (n=13), the median progression-free survival (PFS) was 40.7 months (95% CI=36.5-NC) and median duration of response (DOR) was 39.2 months (95% CI=35.1-NC) (PMID: 41160818). In the taxane (docetaxel or paclitaxel), trastuzumab and pertuzumab cohort (n=387), the ORR was 78.6% (95% CI=74.1-82.5), with a CR of 8.5% (n=33), PR of 70% (n=271), SD rate of 14.5% (n=56) and PD rate of 3.1% (n=12), the median PFS was 26.9 months (95% CI=21.8-NC) and the median DOR was 26.4 months (95% CI=22.3-NC) (PMID: 41160818).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Trastuzumab + ChemotherapyLEVEL_1LEVEL_Fda2['20728210']Trastuzumab, a humanized, recombinant monoclonal antibody that targets the HER2 receptor, is FDA-approved in combination with cisplatin and a fluoropyrimidine for the treatment of patients with HER2-overexpressing metastatic gastric or gastroesophageal (GE) junction adenocarcinoma who have not been treated previously for metastatic disease. FDA approval is based on results from the randomized, Phase III ToGA trial in which 584 patients with advanced gastric or GE cancer that was positive for HER2 overexpression received chemotherapy (cisplatin with either capecitabine or 5-fluorouracil, n=290) with or without trastuzumab (n=294) (PMID: 20728210). The inclusion of trastuzumab improved median overall survival (13.8 months vs. 11.1 months, HR=0.74, p=0.0046) compared to chemotherapy alone (PMID: 20728210).186.0EGCLightSkyBlueEsophagogastric AdenocarcinomaEsophagogastric CancerSOLIDEsophagus/StomachSTOMACH2.0SOLID['Amplification']Trastuzumab + Pertuzumab + ChemotherapyLEVEL_1LEVEL_Fda2['28581356', '27179402', '39259927', '23704196', '32171426', '35681574']Pertuzumab and trastuzumab are intravenously administered, humanized monoclonal HER2-targeted antibodies that are FDA-approved in combination with docetaxel as treatment for patients with HER2-positive metastatic breast cancer who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease. Pertuzumab and trastuzumab are also FDA-approved in combination with chemotherapy as neoadjuvant treatment of patients with HER2-positive, locally advanced, inflammatory, or early-stage breast cancer (either greater than 2 cm in diameter or node-positive) as part of a complete treatment regimen for early breast cancer and adjuvant treatment of patients with HER2-positive early breast cancer at high risk of recurrence. HER2-positive status was defined as immunohistochemistry (IHC) 3+ or FISH amplification ratio 2.0 in breast tumor samples. FDA approval for the treatment of HER2-positive metastatic breast cancer was based on results from the Phase III CLEOPATRA (NCT00567190) trial of trastuzumab and pertuzumab plus docetaxel versus placebo and trastuzumab plus docetaxel in 808 patients with HER2-positive metastatic breast cancer (IHC +3 or FISH amplification ratio 2.0). FDA approval for the neoadjuvant and adjuvant treatment of HER2-positive early breast cancer was based on the results of the Phase II NeoSphere (NCT00545688), Phase II TRYPHAENA (NCT00976989), Phase II BERENICE (NCT02132949) and Phase III APHINITY (NCT01358877) trials of pertuzumab and trastuzumab plus chemotherapy. __In the Phase III CLEOPATRA (NCT00567190) trial, the pertuzumab and trastuzumab with docetaxel cohort (n=402) demonstrated an objective response rate (ORR) of 80.2%, with a 5.5% (n=19) complete response (CR) rate and 74.6% (n=256) partial response (PR) rate, a median progression-free survival (PFS) of 18.5 months and a final analysis median overall survival (OS) of 56.5 months (PMID: 32171426). The placebo and trastuzumab with docetaxel cohort (n=406) demonstrated an ORR of 69.3% (ORR difference=10.8% [95% CI=4.2-17.5], p=0.0011), with a 4.2% (n=14) CR rate and 65.2% (n=219) PR rate, a median PFS of 12.4 months (HR=0.62 [95% CI=0.51-0.75], p<0.0001) and a final analysis median OS of 40.8 months (HR=0.68 [95% CI=0.56-0.84], p=0.0002) (PMID: 32171426).__In the Phase II NeoSphere (NCT00545688) trial of neoadjuvant regimens for 417 patients with HER2-positive breast cancer (IHC 3+ or FISH amplification ratio 2.0), the pertuzumab and trastuzumab with docetaxel cohort (n=107) demonstrated an overall pathological CR (pCR) rate of 39.3% (95% CI=30.0-49.2) (PMID: 27179402). The trastuzumab plus docetaxel cohort (n=107), pertuzumab plus trastuzumab cohort (n=107) and pertuzumab plus docetaxel (n=96) demonstrated overall pCR rates of 21.5% (95% CI=14.1-30.5), 11.2% (95% CI=5.9-18.8) and 17.7% (95% CI=10.7-26.8), respectively (PMID: 27179402).__In the Phase II TRYPHAENA (NCT00976989) trial of neoadjuvant regimens for 225 patients with HER2-positive breast cancer (IHC 3+ or FISH amplification ratio 2.0), cohort A (3 cycles of 5-fluorouracil, epirubicin and cyclophosphamide [FEC] followed by 3 cycles of docetaxel, all in combination with pertuzumab and trastuzumab, n=72), cohort B (3 cycles of FEC alone followed by 3 cycles of docetaxel and trastuzumab in combination with pertuzumab, n=75) and cohort C (6 cycles of docetaxel, carboplatin and trastuzumab in combination with pertuzumab, n=76) demonstrated pCR rates of 56.2% (95% CI=44.1-67.8), 54.7% (95% CI=42.7-66.2) and 63.6% (95% CI=51.9-74.3), respectively (PMID: 23704196). __In the Phase II BERENICE (NCT02132949) trial of neoadjuvant regimens for 401 patients with locally advanced, inflammatory or early-stage HER2-positive breast cancer (IHC 3+ or ISH amplification ratio 2.0), cohort A (4 cycles of pertuzumab in combination with trastuzumab and weekly paclitaxel for 12 weeks) and cohort B (12 weeks or 4 cycles of FEC followed by 4 cycles of pertuzumab in combination with trastuzumab and docetaxel) demonstrated pCR rates of 61.8% (95% CI=54.7-68.6) and 60.7% (95% CI=53.6-67.5), respectively (PMID: 35681574).__In the Phase III APHINITY (NCT01358877) trial of pertuzumab and trastuzumab plus chemotherapy versus placebo and trastuzumab plus chemotherapy to standard adjuvant chemotherapy in 4804 patients with HER2-positive early breast cancer who had their primary tumor excised, the pertuzumab cohort (n=2400) demonstrated an invasive disease-free survival (IDFS) of 7.1%, a disease-free survival (DFS) of 8.0% and an OS of 3.3% (PMID: 28581356). The placebo cohort (n=2404) demonstrated an IDFS of 8.7% (HR=0.82 [95% CI=0.67-1.00], p=0.047), a DFS of 9.8% (HR=0.82 [95% CI=0.68-0.99]) and an OS of 3.7% (HR=0.89 [95% CI=0.66-1.21]) (PMID: 28581356). In the third interim analysis, the 8-year OS and IDFS were 92.7% and 86.1% in the pertuzumab cohort versus 92.0% (HR=0.83 [95% CI=0.68-1.02, p=0.078) and 81.2% (HR=0.72 [95% CI=0.60-0.87]) in the placebo cohort, respectively (PMID: 39259927).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Trastuzumab + Tucatinib + CapecitabineLEVEL_1LEVEL_Fda2['31825569'][{'abstract': 'Curigliano et al. Abstract# 1043, ASCO 2021.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2021.39.15_suppl.1043'}]Tucatinib is a small molecule inhibitor of HER2 that is FDA-approved in combination with trastuzumab and capecitabine for the treatment of adult patients with advanced, pretreated HER2-positive breast cancer that cant be removed with surgery or has spread to other parts of the body. FDA approval was based on the results of the Phase II HER2CLIMB trial of tucatinib plus trastuzumab and capecitabine versus trastuzumab and capecitabine plus placebo in 612 patients with HER2-positive metastatic breast cancer who were pretreated with trastuzumab, pertuzumab, and trastuzumab emtansine in which one-year progression-free survival was 33.1% in the tucatinib combination group and 12.3% in the placebo combination group (HR, 0.54, 95% CI, 0.42 to 0.71, P<0.001), the median overall survival was 21.9 months and 17.4 months, respectively (PMID: 31825569). Of the 291 patients with brain metastases, the median progression-free survival in the tucatinib group versus the placebo group was 7.6 months (95% CI= 6.2 to 9.5) versus 5.4 months (95% CI= 4.1 to 5.7), respectively (PMID: 31825569). Updated results from the Phase II HER2CLIMB trial showed that after a median follow-up of 29.6 months, the median overall survival was 21.6 months (95% CI=18.1-28.5) in the tucatinib combination group versus 12.5 months (95% CI= 11.2-16.9) in the trastuzumab and capecitabine-combination group in patients with active and stable brain metastases (n=291) (Abstract: Curigliano et al. Abstract# 1043, ASCO 2021. https://ascopubs.org/doi/abs/10.1200/JCO.2021.39.15_suppl.1043).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Tucatinib + TrastuzumabLEVEL_1LEVEL_Fda2['37142372']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. In the open-label MOUNTAINEER Phase II trial of tucatinib and trastuzumab, 84 metastatic colorectal cancer patients with RAS wildtype, HER2 amplification received combination treatment and 30 patients received tucatinib monotherapy (PMID: 37142372). In the combination therapy cohort, the objective response rate was 38.1% (95% CI, 27.7%-49.3%), with three patients (4%) reported to have a complete response and 29 patients (35%) reported to have a partial response. The median duration of response was 12.4 months (95% CI, 8.3-25.5), the median progression-free survival was 8.2 months (95% CI, 4.2-10.3), and the median overall survival was 24.1 months (95% CI, 20.3-36.7) (PMID: 37142372). In the tucatinib monotherapy cohort the objective response rate was 3.3% (95% CI, 0.1%-17.2%), with one patient reported to have a partial response. Twenty-eight of the 30 patients (93%) in the tucatinib monotherapy cohort crossed over to receive combination tucatinib and trastuzumab therapy and achieved an objective response rate of 17.9% (95% CI, 6.1-36.9%) with a median overall survival of 21.1 months (95% CI 18.6not estimable) (PMID: 37142372).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Amplification']Lapatinib + LetrozoleLEVEL_1LEVEL_Fda2['19786658', '17192538']Lapatinib is an oral, ATP-competitive, reversible tyrosine kinase inhibitor that targets both EGFR and ERBB2 and is FDA-approved in combination with capecitabine for patients with advanced or metastatic ERBB2-overexpressing breast cancer who had received prior therapy with an anthracycline, a taxane or trastuzumab. FDA approval was based on results from a randomized, Phase III trial in which eligible patients treated with lapatinib and capecitabine had a shorter time-to-progression (TTP) (8.4 months vs. 4.4, hazard ratio, 0.47, p<0.001) compared to patients that received capecitabine alone (PMID: 17192538). Lapatinib is also FDA-approved in combination with letrozole for the treatment of metastatic, postmenopausal breast cancer that is both ERBB2-positive and hormone receptor-positive. FDA approval in this context was based on evidence from the EGF30008 trial in which eligible patients treated with lapatinib plus letrozole showed a significantly improved progression-free survival (PFS) (median PFS, 8.2 vs. 3.0 months) compared to patients treated with letrozole plus placebo (PMID: 19786658). Treatment with lapatinib also significantly improved clinical benefit rates (CBR) (48% with letrozole-lapatinib vs. 29% with letrozole alone) and was associated with a trend toward improvement in overall survival (OS) (PMID: 19786658).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Neratinib + CapecitabineLEVEL_1LEVEL_Fda2['29146401', '30274983', '26874901', '30860945']Neratinib is a small molecule inhibitor of the ERBB2 and EGFR kinases that is FDA-approved for HER2-positive breast cancer previously treated with adjuvant trastuzumab. FDA approval was based on results from the Phase III ExteNET trial of neratinib in 2,840 patients with HER2-positive breast cancer who had been previously treated with trastuzumab in which the two-year disease-free survival rate was 93.9% (95% CI= 92.4-95.2) in the neratinib group versus 91.0% (95% CI= 89.3-92.5) in the placebo group (HR= 0.63, p=00017) following one year of drug administration (PMID: 26874901). Five-year follow-up of patients from the ExteNET trial demonstrated that the benefit of neratinib treatment continues past the two-year follow-up, with the five-year invasive disease-free survival being 90.2% (95% CI= 88.3-91.8) in the neratinib group versus 87.7% (95% CI= 85.7-89.4) in the placebo group (PMID: 29146401). In vitro studies in mice have demonstrated that sustained ER inhibition can lead to ERBB2 pathway activation, suggesting a mechanism for neratinib utility in this context (PMID: 30274983). Neratinib with the addition of chemotherapy (capecitabine) has been shown to be active in patients with ERBB2-positive breast cancer with brain metastases (PMID: 30860945).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Trastuzumab + ChemotherapyLEVEL_1LEVEL_Fda2['16236738']Trastuzumab, a humanized, recombinant monoclonal antibody that targets the HER2 receptor, is FDA approved for the adjuvant treatment of HER2-overexpressing breast cancer. FDA approval was based on two Phase III trials (NSABP B31 and NCCTG N9831) of trastuzumab in 3,752 patients with HER2-overexpressing breast cancer in which disease-free survival at four years was 85.3% in the trastuzumab group versus 67.1% in the control group, and overall survival at four years was 91.4% in the trastuzumab group versus 86.6% in the control group (HR=0.48, 95% CI= 0.39-0.59)(PMID: 16236738).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Amplification']Ado-Trastuzumab EmtansineLEVEL_2LEVEL_Fda2['31504139'][{'abstract': 'Liu, D. et al. Abstract# 3025, JCO 2023.', 'link': 'https://ascopubs.org/doi/10.1200/JCO.2023.41.16_suppl.3025'}]Ado-trastuzumab emtansine (T-DM1) is an intravenously infused, HER2-targeted antibody and microtubule inhibitory conjugate that is FDA-approved for the treatment of patients with HER2-positive metastatic breast cancer who previously received trastuzumab and a taxane, separately or in combination. The NCCN Head and Neck Cancer Guidelines (V3.2024) lists trastuzumab, trastuzumab plus docetaxel, T-DM1, trastuzumab deruxtecan and trastuzumab plus pertuzumab as HER2-targeted therapies for the treatment of patients with HER2-positive (defined as immunohistochemistry [IHC] 3+) salivary gland cancer. In the Phase II (NCT02675829) trial of T-DM1 in patients with HER2-positive (defined as ERBB2 copy number >7) solid tumors (n=15, patients with salivary gland cancer), the salivary gland cancer cohort demonstrated an objective response rate of 87% (n=13), with a 53.3% (n=8) complete response (CR) rate and 33.3% (n=5) partial response (PR) rate (Abstract: Liu, D. et al. Abstract# 3025, JCO 2023. https://ascopubs.org/doi/10.1200/JCO.2023.41.16_suppl.3025). In the Phase II NCI-MATCH (NCT02465060) trial of T-DM1 in patients with HER2-positive (IHC 3+ or HER2/CEP17 2 by FISH) tumors (n=3, patients with salivary gland cancer), the salivary gland cancer cohort achieved a PR in two patients (PMID: 31504139).9.0DarkRedSalivary Gland CancerSOLIDHead and Neck0.0SOLID['Amplification']Lapatinib + TrastuzumabLEVEL_2LEVEL_Fda2['27108243']Trastuzumab, a humanized, recombinant monoclonal antibody that targets the HER2 receptor, and lapatinib, a small molecule tyrosine kinase inhibitor of HER2/EGFR, are NCCN-compendium listed in combination for the treatment of patients with ERBB2-amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Results from the multicenter Phase II HERACLES trial in which 27 patients with previously treated HER2+, KRAS wildtype tumors were treated with trastuzumab plus lapatinib demonstrated an overall response rate of 30% (95% CI= 14-50), which included one patient with complete response (4%), seven patients with partial responses (26%) and twelve patients with stable disease (44%) (PMID: 27108243).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Amplification']TrastuzumabLEVEL_2LEVEL_Fda2['28006087', '30452336']Trastuzumab is an intravenously infused, anti-HER2 monoclonal antibody that is FDA-approved as a single agent and in combination with docetaxel for the treatment of patients with HER2-overexpressing breast cancer. The NCCN Head and Neck Cancer Guidelines (V3.2024) lists trastuzumab, trastuzumab plus docetaxel, ado-trastuzumab emtansine, trastuzumab deruxtecan and trastuzumab plus pertuzumab as HER2 targeted therapies for the treatment of patients with HER2-positive (defined as immunohistochemistry [IHC] 3+) salivary gland cancer. In a case report of two patients with HER2-positive salivary gland cancer treated with trastuzumab monotherapy, one patient with HER2-positive (IHC 3+) salivary duct carcinoma achieved a complete response (CR) and one patient with HER2-amplified (FISH amplification ratio 5.6) carcinoma ex pleomorphic adenoma demonstrated disease control for over 21 months (PMID: 28006087). In a pooled analysis of a Phase II trial of trastuzumab plus docetaxel in 57 patients with HER2-positive (IHC 3+) advanced salivary duct carcinoma, the overall response rate was 70.2% (95% CI=56.6-81.6), with a 14% (n=8) CR rate and 56.1% (n=32) partial response rate, and the median progression-free survival was 8.9 months (95% CI=7.8-9.9) (PMID: 30452336).9.0DarkRedSalivary Gland CancerSOLIDHead and Neck0.0SOLID['Amplification']Trastuzumab DeruxtecanLEVEL_2LEVEL_Fda2['33961795'][{'abstract': 'Siena et al. Abstract# 4000, ASCO 2020.', 'link': 'https://ascopubs.org/doi/abs/10.1200/JCO.2020.38.15_suppl.4000'}]Trastuzumab Deruxtecan is a HER2-directed antibody and topoisomerase inhibitor conjugate that is FDA-approved for patients with HER2-positive breast and gastric cancer. The NCCN (Colorectal Cancer, v2.2021) lists trastuzumab deruxtecan as a category 2A recommendation for patients with ERBB2-amplified colorectal cancer. In a Phase II study of trastuzumab deruxtecan in 53 patients with HER2-expressing (IHC 3+) colorectal cancer, the overall response rate was 45.3% (95% CI=31.6%-59.6%) with one patient having a complete response and 23 patients having partial responses (Abstract: Siena et al. Abstract# 4000, ASCO 2020. https://ascopubs.org/doi/abs/10.1200/JCO.2020.38.15_suppl.4000). In an open-label, phase II study (DESTINY-CRC01, NCT03384940) of trastuzumab deruxtecan in 53 evaluable patients with HER2-expressing metastatic colorectal cancer that had progressed on two or more previous regimens, the objective response rate was 45.3% (95% CI=316596), with one (2%) patient achieving a complete response, 23 (43%) achieving a partial response, twenty (38%) achieving stable disease, and five (9%) exhibiting disease progression (PMID: 33961795).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Amplification']Trastuzumab DeruxtecanLEVEL_2LEVEL_Fda2['38231777']Trastuzumab deruxtecan (T-DXd) is an intravenously infused, HER2-targeted antibody and topoisomerase inhibitor conjugate that is FDA-approved for the treatment of adult patients with unresectable or metastatic HER2-positive breast cancer previously treated with anti-HER2-based regimens in the metastatic setting. The NCCN Head and Neck Cancer Guidelines (V3.2024) lists trastuzumab, trastuzumab plus docetaxel, ado-trastuzumab emtansine, T-DXd and trastuzumab plus pertuzumab as HER2 targeted therapies for the treatment of patients with HER2-positive (defined as immunohistochemistry (IHC) 3+) salivary gland cancer. In a pooled analysis from the results of the Phase I first-in-human study (NCT02564900) and the Phase I drug-drug interaction (NCT03383692) trials of T-DXd in seventeen patients with HER2-positive (IHC 1+/in situ hybridization [ISH]+) salivary gland cancer, the overall response rate was 58.8% (95% CI=32.9-81.6), with ten patients achieving a partial response and a median progression-free survival of 20.5 months (95% CI=11.1-NE) (PMID: 38231777).9.0DarkRedSalivary Gland CancerSOLIDHead and Neck0.0SOLID['Amplification']Trastuzumab + Carboplatin-Taxol RegimenLEVEL_2LEVEL_Fda2['29584549']Trastuzumab, a humanized, recombinant monoclonal antibody that targets the HER2 receptor, is FDA approved for the adjuvant treatment of ERBB2-overexpressing breast cancer. Trastuzumab plus carboplatin-paclitaxel is listed in the NCCN as a category 2A therapeutic for ERBB2-amplified uterine cancer. In a phase II trial of carboplatin-paclitaxel with or without trastuzumab in 58 patients with ERBB2-overexpressing uterine serous carcinoma, overall progression-free survival was 12.6 months versus 8 months with the addition of paclitaxel, with the largest benefit seen in patients with stage III/IV advanced disease (17.9 months versus 9.3 months, p=0.013, HR=0.4 (90% CI 0.2-0.8)) (PMID: 29584549).653.0USCPeachPuffUterine Serous Carcinoma/Uterine Papillary Serous CarcinomaEndometrial CancerSOLIDUterusUCEC3.0SOLID['Amplification']Trastuzumab + PertuzumabLEVEL_2LEVEL_Fda2['34339623']Trastuzumab and pertuzumab, both HER2-targeted antibodies, are NCCN-compendium listed in combination for the treatment of patients with HER2-positive biliary tract cancers. In the multicenter, open-label, Phase IIa MyPathway multiple basket study of trastuzumab and pertuzumab in patients with previously treated HER2-amplified and/or HER2 overexpression metastatic biliary tract cancer (n=39), the objective response rate was 23% (95% CI, 11-39%) with nine patients achieving partial response and eleven patients demonstrating stable disease (PMID: 34339623).153.0BILIARY_TRACTGreenBiliary TractBiliary Tract CancerSOLIDBiliary TractTISSUE1.0SOLID['Amplification']Trastuzumab + PertuzumabLEVEL_2LEVEL_Fda2['34339623']Trastuzumab and pertuzumab, both HER2-targeted antibodies, are NCCN-compendium listed in combination for the treatment of patients with HER2-positive biliary tract cancers. In the multicenter, open-label, Phase IIa MyPathway multiple basket study of trastuzumab and pertuzumab in patients with previously treated HER2-amplified and/or HER2 overexpression metastatic biliary tract cancer (n=39), the objective response rate was 23% (95% CI, 11-39%) with nine patients achieving partial response and eleven patients demonstrating stable disease (PMID: 34339623).15.0MIXEDHepatobiliary CancerSOLIDMIXED0.0SOLID['Amplification']Trastuzumab + PertuzumabLEVEL_2LEVEL_Fda2['37793085', '36315917', '30857956']Trastuzumab and pertuzumab, both HER2-targeted antibodies, are NCCN-compendium listed in combination for the treatment of patients with HER2-amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. Results from the MyPathway Phase IIa multiple basket study in which patients with previously treated HER2-amplified metastatic colorectal cancer were treated with trastuzumab plus pertuzumab demonstrated an overall response rate of 40% (95% CI= 25-56) in patients with wildtype KRAS (n=43), with a median progression-free survival of 5.3 months (95% CI= 2.7-6.1) and a median overall survival of 14.0 months (95% CI= 8.0-NE) (PMID: 30857956). Updated data from the MyPathway study in 69 patients with HER2-amplified colorectal cancer demonstrate an objective response rate of 31.9%, with one patient demonstrating a complete response (PMID: 37793085). In the Phase II TAPUR Study basket trial of trastuzumab plus pertuzumab in 28 patients with HER2-amplified advanced tumors, the overall response rate was 25%, with a median progression-free survival of 17.2 weeks (95% CI= 11.1-27.4) and a median overall survival of 60.0 weeks (95% CI= 32.1-102.3) (PMID: 36315917).21.0SaddleBrownColorectal CancerSOLIDBowel0.0SOLID['Amplification']Trastuzumab + PertuzumabLEVEL_2LEVEL_Fda2['32067683']Trastuzumab and pertuzumab are intravenously infused, anti-HER2 monoclonal antibodies that are FDA-approved in combination for the treatment of patients with HER2-positive metastatic breast cancer who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease. The NCCN Head and Neck Cancer Guidelines (V3.2024) lists trastuzumab, trastuzumab plus docetaxel, ado-trastuzumab emtansine, trastuzumab deruxtecan and trastuzumab plus pertuzumab as HER2 targeted therapies for the treatment of patients with HER2-positive salivary gland cancer. In the Phase IIa MyPathway _(NCT02091141) trial of trastuzumab plus pertuzumab in fifteen patients with HER2 amplification-positive (HER2/CEP17 ratio > 2.0 or NGS determined copy number gain) and/or overexpression (IHC 3+)-positive salivary gland cancer, the objective response rate was 60% (95% CI=32-84), with a 6.7% (n=1) complete response rate and 53.3% (n=8) partial response rate, with a median progression-free survival of 8.6 months (95% CI=2.3-NE) and a median overall survival of 20.4 months (95% CI=8.2-NE) (PMID: 32067683).9.0DarkRedSalivary Gland CancerSOLIDHead and Neck0.0SOLID['Amplification']Trastuzumab + PertuzumabLEVEL_2LEVEL_Fda2['30857956']Trastuzumab and pertuzumab are intravenously infused, anti-HER2 monoclonal antibodies that are FDA-approved in combination for the treatment of patients with HER2-positive metastatic breast cancer who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease. The NCCN Small Bowel Adenocarcinoma Guidelines (V1.2026) lists trastuzumab plus pertuzumab and trastuzumab plus tucatinib as HER2 targeted therapies for the treatment of patients with RAS and BRAF wildtype, HER2 overexpressed/amplified small bowel adenocarcinoma. NCCN recommendation is based on the results of the Phase IIA MyPathway (NCT02091141) trial of trastuzumab plus pertuzumab in 57 patients with HER2-positive metastatic colorectal cancer (HER2 amplification/no overexpression, n=8, HER2 amplification/unknown overexpression, n=22, HER2 amplification+overexpression, n=27). HER2 positive status was defined as FISH/CISH amplification ratio >2.0 or HER2 copy number >6.0, HER2 amplification based on next-generation sequencing and/or immunohistochemistry (IHC) 3+ in patient tissue samples._In the Phase IIA MyPathway (NCT02091141) trial, the overall response rate was 32% (95% CI=20-45), the clinical benefit rate was 44% (95% CI=31-58), the median duration of response was 5.9 months (95% CI=2.8-11.1), the median progression-free survival was 2.9 months (95% CI=1.4-5.3) and the median overall survival was 11.5 months (95% CI=7.7-NE) (PMID: 30857956).94.0SaddleBrownSmall Bowel CancerSOLIDBowel0.0SOLID['Amplification']Trastuzumab + TucatinibLEVEL_2LEVEL_Fda2['41526345']Tucatinib, a small molecular inhibitor of HER2, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of patients with HER2 amplified metastatic colorectal cancer whose tumors are also RAS and BRAF wildtype. The NCCN Small Bowel Adenocarcinoma Guidelines (V1.2026) lists trastuzumab plus pertuzumab and trastuzumab plus tucatinib as HER2 targeted therapies for the treatment of patients with RAS and BRAF wildtype, HER2 overexpressed/amplified small bowel adenocarcinoma. NCCN recommendation is based on the results of the Phase II MOUNTAINEER (NCT03043313) trial of trastuzumab plus tucatinib in patients with RAS wildtype, HER2-positive or HER2-negative unresectable or metastatic colorectal cancer. HER2 positive status was defined as immunohistochemistry (IHC) 3+ or IHC 2+ with FISH amplification while HER2 negative status was defined as IHC 0, IHC 1 or IHC 2+ without FISH amplification in patient tissue samples._In the Phase II MOUNTAINEER (NCT03043313) trial, the HER2 positive cohort (n=60) demonstrated a median progression-free survival (PFS) of 10.1 months (95% CI=4.1-14.5), a median duration of response (DOR) of 16.6 months (95% CI=11.4-25.5) and a confirmed overall response rate (cORR) of 41.7% (95% CI=29.1-55.1), with five complete responses (CR), twenty partial responses (PR), twenty one cases of stable disease (SD) and thirteen cases of progressive disease (PD) (PMID: 41526345). In the HER2 negative cohort (n=10), the median PFS was 2.8 months (95% CI=1.2-6.3) and the cORR was 10.0% (95% CI=0.3-44.5), with one PR, four cases of SD and five cases of PD (PMID: 41526345).94.0SaddleBrownSmall Bowel CancerSOLIDBowel0.0SOLID['Amplification']Tucatinib + TrastuzumabLEVEL_2LEVEL_Fda2['37751561']Tucatinib, a small molecule HER2-targeted kinase inhibitor, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of adult patients with RAS wild-type HER2-positive unresectable or metastatic colorectal cancer that has progressed following treatment with fluoropyrimidine-, oxaliplatin- and irinotecan-based chemotherapy. The NCCN Biliary Tract Cancers Guidelines (V2.2024) lists tucatinib plus trastuzumab under "Subsequent-Line Therapy for Biliary Tract Cancers if Disease Progression" for patients with HER2-positive biliary tract cancer. NCCN recommendation was based on the results of the Phase II SGNTUC-019 (NCT04579380) trial of tucatinib plus trastuzumab in 30 patients with HER2-positive metastatic biliary tract cancer. In the Phase II SGNTUC-019 (NCT04579380) trial, the confirmed overall response rate was 46.7% (14/30) (90% CI=30.8-63.0), with a 3.3% (1/30) complete response rate, 43.3% (13/30) partial response rate and 30% (9/30) stable disease rate, the median progression-free survival was 5.5 months (90% CI=3.9-8.1) and the median overall survival was 15.5 months (90% CI=6.5-16.7) (PMID: 37751561).153.0BILIARY_TRACTGreenBiliary TractBiliary Tract CancerSOLIDBiliary TractTISSUE1.0SOLID['Amplification']Tucatinib + TrastuzumabLEVEL_2LEVEL_Fda2['37751561']Tucatinib, a small molecule HER2-targeted kinase inhibitor, and trastuzumab, a HER2-targeted antibody, are FDA-approved in combination for the treatment of adult patients with RAS wild-type HER2-positive unresectable or metastatic colorectal cancer that has progressed following treatment with fluoropyrimidine-, oxaliplatin- and irinotecan-based chemotherapy. The NCCN Biliary Tract Cancers Guidelines (V2.2024) lists tucatinib plus trastuzumab under "Subsequent-Line Therapy for Biliary Tract Cancers if Disease Progression" for patients with HER2-positive biliary tract cancer. NCCN recommendation was based on the results of the Phase II SGNTUC-019 (NCT04579380) trial of tucatinib plus trastuzumab in 30 patients with HER2-positive metastatic biliary tract cancer. In the Phase II SGNTUC-019 (NCT04579380) trial, the confirmed overall response rate was 46.7% (14/30) (90% CI=30.8-63.0), with a 3.3% (1/30) complete response rate, 43.3% (13/30) partial response rate and 30% (9/30) stable disease rate, the median progression-free survival was 5.5 months (90% CI=3.9-8.1) and the median overall survival was 15.5 months (90% CI=6.5-16.7) (PMID: 37751561).15.0MIXEDHepatobiliary CancerSOLIDMIXED0.0SOLID['Amplification']Trastuzumab + DocetaxelLEVEL_2LEVEL_Fda2['28006087', '30452336']Trastuzumab is an intravenously infused, anti-HER2 monoclonal antibody that is FDA-approved as a single agent and in combination with docetaxel for the treatment of patients with HER2-overexpressing breast cancer. The NCCN Head and Neck Cancer Guidelines (V3.2024) lists trastuzumab, trastuzumab plus docetaxel, ado-trastuzumab emtansine, trastuzumab deruxtecan and trastuzumab plus pertuzumab as HER2 targeted therapies for the treatment of patients with HER2-positive (defined as immunohistochemistry [IHC] 3+) salivary gland cancer. In a case report of two patients with HER2-positive salivary gland cancer treated with trastuzumab monotherapy, one patient with HER2-positive (IHC 3+) salivary duct carcinoma achieved a complete response (CR) and one patient with HER2-amplified (FISH amplification ratio 5.6) carcinoma ex pleomorphic adenoma demonstrated disease control for over 21 months (PMID: 28006087). In a pooled analysis of a Phase II trial of trastuzumab plus docetaxel in 57 patients with HER2-positive (IHC 3+) advanced salivary duct carcinoma, the overall response rate was 70.2% (95% CI=56.6-81.6), with a 14% (n=8) CR rate and 56.1% (n=32) partial response rate, and the median progression-free survival was 8.9 months (95% CI=7.8-9.9) (PMID: 30452336).9.0DarkRedSalivary Gland CancerSOLIDHead and Neck0.0SOLID['Amplification']Trastuzumab DeruxtecanLEVEL_3ALEVEL_Fda3['37286557', '39102634', '37870536', '38547891']Trastuzumab deruxtecan (T-DXd) is an intravenously infused, HER2-targeted antibody and topoisomerase inhibitor conjugate that is FDA-approved for the treatment of adult patients with unresectable or metastatic HER2-positive (defined as immunohistochemistry (IHC) 3+) solid tumors who have received prior systemic treatment and have no satisfactory alternative treatment options. FDA approval was based on the results of the Phase II DESTINY-PanTumor02 (NCT04482309), DESTINY-Lung01 (NCT03505710) and DESTINY-CRC02 (NCT04744831) trials of T-DXd in patients with HER2-positive (defined by IHC 3+) solid tumors. Since the correlation between ERBB2 amplification and HER2 expression has yet to be defined in many solid tumor types and this FDA approval directly specifies HER2-positivity (IHC 3+) as the patient selection criteria, ERBB2 amplification is considered a Level 3A biomarker for this specific indication. In the Phase II DESTINY-PanTumor02 (NCT04482309) trial of T-DXd in 111 patients with HER2-expressing (IHC 3+/2+ by local or central testing) solid tumors, the overall response rate (ORR) was 51.4% (95% CI=41.7-61.0), with a 2.7% complete response (CR) rate and 48.6% partial response (PR) rate, and the median duration of response (DOR) was 19.4 months (range 1.3 months to 27.9+ months) (PMID: 37870536). In the Phase II DESTINY-Lung01 (NCT03505710) trial of T-DXd in seventeen patients with HER2-overexpressing (IHC 3+/2+) non-small cell lung cancer, the ORR was 52.9% (95% CI=27.8-77.0), with a 5.9% CR rate and 47.1% PR rate, and the median DOR was 6.9 months (range 4.0 months to 11.7+ months) (PMID: 38547891). In the Phase II DESTINY-CRC02 (NCT04744831) trial of T-DXd in 64 patients with HER2-expressing (IHC 3+, IHC 2+/in situ hybridization [ISH]+ or IHC 2+/ISH-) metastatic colorectal cancer, the ORR was 46.9% (95% CI=34.3-59.8), with a 46.9% PR rate, and the median DOR was 5.5 months (range 1.3+ months to 9.7+ months) (PMID: 37286557). In the Phase II HERB trial of T-DXd in 22 patients with HER2-positive (IHC3+ or IHC2+/ISH+) biliary tract cancer, the ORR was 36.4% (95% CI=17.2-59.3), with a 9.1% (n=2) CR rate, 27.3% (n=6) PR rate and 45.5% (n=10) SD rate (PMID: 39102634).5.0All Solid TumorsSOLID-1.0SOLID['Amplification']ZanidatamabLEVEL_3ALEVEL_Fda3['37276871', '41264278']Zanidatamab is an intravenously infused, bispecific HER2-directed antibody that is FDA-approved for the treatment of adults with previously treated, unresectable or metastatic HER2-positive (defined as immunohistochemistry (IHC) 3+) biliary tract cancer (BTC), as detected by an FDA-approved test. HER2 expression in BTC for treatment with zanidatamab was detected by the VENTANA PATHWAY anti-HER-2/neu (4B5) Rabbit Monoclonal Primary Antibody companion diagnostic device. Since the correlation between ERBB2 amplification and HER2 expression has yet to be defined in many solid tumor types and this FDA approval directly specifies HER2-positivity (IHC 3+) as the patient selection criteria, ERBB2 amplification is considered a Level 3A biomarker for this specific indication. FDA approval was based on the results of the Phase II HERIZON-BTC-01 (NCT04466891) trial of zanidatamab in patients with HER2-positive (IHC 2+ or 3+ by central assessment) unresectable, locally advanced, or metastatic BTC. _In the Phase II HERIZON-BTC-01 (NCT04466891) trial, the HER2-positive cohort (n=80 [n=62, IHC 3+, n=18, IHC2+]) demonstrated an overall response rate (ORR) of 41.3% (95% CI=30.4-52.8), with a 1% (n=1) complete response (CR) rate and a 40% (n=32) partial response (PR) rate, a median duration of response (DOR) of 12.9 months (95% CI=6.0-NE) and a median progression-free survival of 5.5 months (95% CI=3.7-7.2) (PMID: 37276871). _In the final results of the Phase II HERIZON-BTC-01 (NCT04466891) trial, the overall cohort (n=80) demonstrated an ORR of 41% (95% CI=30-53), with a 4% (n=3) CR rate, 38% (n=30) PR rate and 28% (n=22) stable disease (SD) rate, a median DOR of 14.9 months (95% CI=7.4-24.0) and a median PFS of 5.5 months (95% CI=3.7-7.3) (PMID: 41264278). Of the IHC 3+ cohort (n=62), the ORR was 52% (95% CI=39-65), with a 5% (n=3) CR rate, 47% (n=29) PR rate and 27% (n=17) SD rate, the median DOR was 14.9 months (95% CI=7.4-24.0) and the median PFS was 7.2 months (95% CI=5.4-9.4) (PMID: 41264278). Of the IHC 2+ cohort (n=18), the ORR was 6% (95% CI=1-27), with a 6% (n=1) PR rate and 28% (n=5) SD rate, the median DOR was not evaluable and the median PFS was 1.7 months (95% CI=1.1-3.3) (PMID: 41264278).153.0BILIARY_TRACTGreenBiliary TractBiliary Tract CancerSOLIDBiliary TractTISSUE1.0SOLID['Amplification']ZanidatamabLEVEL_3ALEVEL_Fda3['37276871', '41264278']Zanidatamab is an intravenously infused, bispecific HER2-directed antibody that is FDA-approved for the treatment of adults with previously treated, unresectable or metastatic HER2-positive (defined as immunohistochemistry (IHC) 3+) biliary tract cancer (BTC), as detected by an FDA-approved test. HER2 expression in BTC for treatment with zanidatamab was detected by the VENTANA PATHWAY anti-HER-2/neu (4B5) Rabbit Monoclonal Primary Antibody companion diagnostic device. Since the correlation between ERBB2 amplification and HER2 expression has yet to be defined in many solid tumor types and this FDA approval directly specifies HER2-positivity (IHC 3+) as the patient selection criteria, ERBB2 amplification is considered a Level 3A biomarker for this specific indication. FDA approval was based on the results of the Phase II HERIZON-BTC-01 (NCT04466891) trial of zanidatamab in patients with HER2-positive (IHC 2+ or 3+ by central assessment) unresectable, locally advanced, or metastatic BTC. _In the Phase II HERIZON-BTC-01 (NCT04466891) trial, the HER2-positive cohort (n=80 [n=62, IHC 3+, n=18, IHC2+]) demonstrated an overall response rate (ORR) of 41.3% (95% CI=30.4-52.8), with a 1% (n=1) complete response (CR) rate and a 40% (n=32) partial response (PR) rate, a median duration of response (DOR) of 12.9 months (95% CI=6.0-NE) and a median progression-free survival of 5.5 months (95% CI=3.7-7.2) (PMID: 37276871). _In the final results of the Phase II HERIZON-BTC-01 (NCT04466891) trial, the overall cohort (n=80) demonstrated an ORR of 41% (95% CI=30-53), with a 4% (n=3) CR rate, 38% (n=30) PR rate and 28% (n=22) stable disease (SD) rate, a median DOR of 14.9 months (95% CI=7.4-24.0) and a median PFS of 5.5 months (95% CI=3.7-7.3) (PMID: 41264278). Of the IHC 3+ cohort (n=62), the ORR was 52% (95% CI=39-65), with a 5% (n=3) CR rate, 47% (n=29) PR rate and 27% (n=17) SD rate, the median DOR was 14.9 months (95% CI=7.4-24.0) and the median PFS was 7.2 months (95% CI=5.4-9.4) (PMID: 41264278). Of the IHC 2+ cohort (n=18), the ORR was 6% (95% CI=1-27), with a 6% (n=1) PR rate and 28% (n=5) SD rate, the median DOR was not evaluable and the median PFS was 1.7 months (95% CI=1.1-3.3) (PMID: 41264278).15.0MIXEDHepatobiliary CancerSOLIDMIXED0.0SOLID30659304;12124352;2885917;10716706;23204226;1157164325,1810,8
TUMORp.S310FENSP00000269571.4:p.Ser310Phechr1739711955CTPASSNM_004448missense_variantMODERATEERBB28/27c.929C>Trs1057519816&COSV54062198&COSV54062802SNVdeleterious(0)probably_damaging(0.984)0.000.000.000.000.5335.1800e-01NC_000017.11:g.39711955C>TOncogeniccriteria_provided&_single_submitter2ERBB2S310F/YCOSM94225✓ Hotspotv7.0.LEVEL_Fda2✓ Hotspot09/11/2025LEVEL_1TrueTrueTrueGain-of-functionOncogenicTrastuzumab DeruxtecanAdo-Trastuzumab Emtansine,Neratinib,Neratinib+Trastuzumab+Fulvestrant,ZongertinibNeratinib,Sevabertinib,Trastuzumab+Pertuzumab+DocetaxelLEVEL_1LEVEL_172,580/1S310F/Y0.4461538461538462GRCh38ERBB2CTMissense_MutationSNPC39711955ERBB2_S310F.GT:AD:AF:DP0/1:72,58:0.44:130TENSG00000141736TranscriptENST00000269571protein_coding1104929310S/FtCc/tTc1HGNCHGNC:3430YESMANE_SelectNM_004448.41P1CCDS32642.1ENSP00000269571P04626.275X5DNK3.71UPI000003F55FP04626-1EnsemblCC1PDB-ENSP_mappings:1n8z.C&PDB-ENSP_mappings:1s78.A&PDB-ENSP_mappings:1s78.B&Gene3D:2.10.220.10&PDB-ENSP_mappings:2a91.A&PDB-ENSP_mappings:3be1.A&PDB-ENSP_mappings:3mzw.A&PDB-ENSP_mappings:3n85.A&PDB-ENSP_mappings:3wlw.A&PDB-ENSP_mappings:3wlw.B&PDB-ENSP_mappings:3wsq.A&PDB-ENSP_mappings:5k33.C&PDB-ENSP_mappings:5kwg.C&PDB-ENSP_mappings:5my6.A&PDB-ENSP_mappings:5o4g.C&PDB-ENSP_mappings:6att.A&PDB-ENSP_mappings:6bgt.C&PDB-ENSP_mappings:6j71.A&PDB-ENSP_mappings:6oge.A&PDB-ENSP_mappings:7mn5.B&PDB-ENSP_mappings:7mn6.B&PDB-ENSP_mappings:7mn8.B&PDB-ENSP_mappings:7qvk.AAA&PDB-ENSP_mappings:8ffj.X&PDB-ENSP_mappings:8hgo.B&PDB-ENSP_mappings:8hgp.B&PDB-ENSP_mappings:8pwh.E&PDB-ENSP_mappings:8q6j.E&PDB-ENSP_mappings:8u4k.B&PDB-ENSP_mappings:8u4l.B&AFDB-ENSP_mappings:AF-P04626-F1&Phobius:NON_CYTOPLASMIC_DOMAIN&Pfam:PF00757&PIRSF:PIRSF000619&PANTHER:PTHR24416&Superfamily:SSF57184likely_pathogenic0&1&11&1&126619011&22908275FAIL-2733-334ERBB24539768363068single_nucleotide_variantSO:0001483ERBB2:2064SO:0001583&missense_variant&SO:0001619&non-coding_transcript_variantNeoplasmHuman_Phenotype_Ontology:HP:0002664&Human_Phenotype_Ontology:HP:0003008&Human_Phenotype_Ontology:HP:0006741&MONDO:MONDO:0005070&MeSH:D009369&MedGen:C0027651SCV007129951105751981617:39711955-39711955ERBB2p.S310F.True.The ERBB2 S310F mutation is located in the extracellular domain of the protein (PMID: 22908275, 24997986). This mutation has been found in bladder, lung, breast and colon cancer (PMID: 28572459). Expression of this mutation in murine fibroblast and B-cell cell lines demonstrated that it is activating as measured by increased protein activation, colony formation in soft agar and cytokine-independent growth compared to wildtype (PMID: 22908275, 24997986). In vitro studies demonstrate that this mutation is sensitive to the ERBB2 inhibitors osimertinib, neratinib, afatinib, lapatinib and trastuzumab when expressed in a murine fibroblast cell line as measured by decreased cell proliferation upon drug treatment (PMID: 22908275, 29967253). Single patients with breast cancer harboring this mutation have demonstrated clinical responses to ERBB2 inhibitor combination therapies, trastuzumab + pertuzumab and lapatinib + trastuzumab (PMID: 26358791, 24516025). Twenty-two patients with cancers harboring this mutation in a neratinib basket trial demonstrated various clinical responses to neratinib, ranging from progressive disease to complete response (PMID: 29420467)..ERBB2, a receptor tyrosine kinase, is altered by mutation, amplification and/or overexpression in various cancer types, most frequently in breast, esophagogastric and endometrial cancers...24516025|24997986|28572459|29967253|22908275|26358791|29420467..S310F2064ERBB2GRCh38.MUTATION..The ERBB2 S310F mutation is known to be oncogenic.FalseLEVEL_Fda2The ERBB2 S310F mutation is located in the extracellular domain of the protein (PMID: 22908275, 24997986). This mutation has been found in bladder, lung, breast and colon cancer (PMID: 28572459). Expression of this mutation in murine fibroblast and B-cell cell lines demonstrated that it is activating as measured by increased protein activation, colony formation in soft agar and cytokine-independent growth compared to wildtype (PMID: 22908275, 24997986). In vitro studies demonstrate that this mutation is sensitive to the ERBB2 inhibitors osimertinib, neratinib, afatinib, lapatinib and trastuzumab when expressed in a murine fibroblast cell line as measured by decreased cell proliferation upon drug treatment (PMID: 22908275, 29967253). Single patients with breast cancer harboring this mutation have demonstrated clinical responses to ERBB2 inhibitor combination therapies, trastuzumab + pertuzumab and lapatinib + trastuzumab (PMID: 26358791, 24516025). Twenty-two patients with cancers harboring this mutation in a neratinib basket trial demonstrated various clinical responses to neratinib, ranging from progressive disease to complete response (PMID: 29420467).['24516025', '24997986', '28572459', '29967253', '22908275', '26358791', '29420467']['Oncogenic Mutations']Trastuzumab DeruxtecanLEVEL_1LEVEL_Fda3['34534430']Trastuzumab Deruxtecan is a HER2-directed antibody and topoisomerase inhibitor conjugate that is FDA-approved for patients with HER2-mutant non-small cell lung cancer (NSCLC). FDA approval was based on the data from the Phase II dose optimization DESTINY-Lung02 study of trastuzumab deruxtecan in 52 patients with HER2-mutant NSCLC in which the confirmed overall response rate was 57.7% (95% CI= 43.2-71.3), with one of 54 patients having a complete response, 29 of 54 patients having a partial response, and with a median duration of response of 8.7 months (95% CI= 7.1-NE). FDA approval was supported by the Phase II DESTINY-Lung01 trial of trastuzumab deruxtecan in 91 patients with HER2-mutant NSCLC in which the overall response rate was 55% (95% CI=44-65), the median duration of response was 9.3 months (95% CI=5.7-14.7), the median progression-free survival was 8.2 months (95% CI=6.0-11.9), and the median overall survival was 17.8 months (95% CI=13.8-22.1) (PMID: 34534430).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Oncogenic Mutations']Ado-Trastuzumab EmtansineLEVEL_2LEVEL_Fda3['31588020', '29989854', '30206164']Ado-trastuzumab emtansine (T-DM1) is an antibody-drug conjugate in which an ERBB2-directed monoclonal antibody is conjugated to DM1, a microtubule-inhibitory agent. The NCCN lists ado-trastuzumab emtansine as another recommended therapy for patients with NSCLC harboring ERBB2 mutations. In the lung cancer cohort of a Phase II basket trial of T-DM1 in patients with ERBB2-mutant solid tumors, 44% (95% CI=22%-69%) of eighteen patients had a partial response, with a median progression-free survival of five months (95% CI=3-9) (PMID: 29989854). Of the eight patients who had a partial response, four had been treated with prior anti-HER2 therapy, and all eight had one of the following ERBB2 mutations: A775_G776insYVMA, G778_P780dup, G776_V777insVCV, V659E or S310F (PMID: 29989854). Responses to T-DM1 have also been seen in patients with ERBB2-amplified non-small cell lung cancer (NSCLC) (PMID: 30206164). The addition of poziotinib may enhance the response of patients with NSCLC to T-DM1 (PMID: 31588020).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Oncogenic Mutations']NeratinibLEVEL_2LEVEL_Fda2['38211393']Neratinib is an orally available, small-molecule pan-HER targeted inhibitor that is FDA-approved as a single agent for the extended adjuvant treatment of adult patients with early-stage HER2-positive breast cancer following adjuvant trastuzumab-based therapy. The NCCN Cervical Cancer Guidelines (V1.2025) lists neratinib under "Recurrent or Metastatic Disease - Second-line or Subsequent Therapy - Useful in Certain Circumstances" for patients with ERBB2 mutant cervical cancer. NCCN recommendation was based on the results of the Phase II SUMMIT (NCT01953926) trial of neratinib in 22 patients with ERBB2 mutant cervical cancer (n=10, S310F/Y, n=2, S310F/Y + V842I, n=2, R678Q, n=1: S310F + G660D, V697L, D769H, T733I + R678Q, G776V, E695D, G832E, D769N) (PMID: 38211393).__In the Phase II SUMMIT (NCT01953926) trial, the ERBB2 mutant cervical cohort demonstrated an overall response rate (ORR) of 18.2% (n=4) (95% CI=5.2-40.3), with a 4.5% (n=1 [S310F]) complete response rate, 13.6% (n=3 [S310F (2), S310F + V842I]) partial response rate and 27.3% (n=6 [S310F, S310F + G660D, D769H/N, V697L, R678Q]) stable disease rate, a median progression-free survival (PFS) of 5.1 months (95% CI=1.7-7.2) and a median duration of response (DOR) of 7.6 months (95% CI=5.6-12.3) (PMID: 38211393).110.0TealCervical CancerSOLIDCervix0.0SOLID['Oncogenic Mutations']Neratinib + Trastuzumab + FulvestrantLEVEL_2LEVEL_Fda3['37597578']Neratinib is an orally available, small-molecule pan-HER targeted inhibitor that is FDA-approved as a single agent for the extended adjuvant treatment of adult patients with early-stage HER2-positive breast cancer following adjuvant trastuzumab-based therapy. The NCCN Breast Cancer Guidelines (V3.2025) lists neratinib under "Emerging Biomarkers And Novel Therapies For Patients With Stage IV (M1) Disease" for patients with HER2 activating mutations. NCCN recommendation was based on the results of the Phase I SUMMIT (NCT05372614) basket study of neratinib plus trastuzumab and fulvestrant in patients with HR+/HER2-negative metastatic breast cancer with activating HER2 mutation(s) and prior CDK4/6i therapy._In the Phase I SUMMIT (NCT05372614) trial, patients with HER2 mutant breast cancer (n=48) demonstrated an overall response rate (ORR) of 42% (n=20), with one patient (n=1, multiple ERBB2 mutations) achieving complete response (CR) and 21 patients (n=4, L755S, n=5, exon 20 insertion, n=3, other kinase domain missense, n=5, V777L, n=1, S310F, n=3, multiple ERBB2 mutations) achieving partial response (PR), and a median progression-free survival (PFS) of 10.2 months (95% CI=6.1-18.6) (PMID: 37597578).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Oncogenic Mutations']ZongertinibLEVEL_2LEVEL_Fda2['40293180']Zongertinib is an orally available, HER2-selective tyrosine kinase inhibitor. Zongertinib is recommended in the NCCN Non-Small Cell Lung Cancer (NSCLC) Guidelines (V8.2025) as a "Molecular and Biomarker-Directed Therapy for Advanced or Metastatic Disease: Subsequent Therapy" treatment option for patients with ERBB2 (HER2) mutations who received prior systemic therapy. NCCN recommendation is based on the results of the Phase I Beamion LUNG-1 (NCT04886804) trial of zongertinib in patients with previously treated ERBB2-mutant NSCLC._In the Phase I Beamion LUNG-1 (NCT04886804), patients with previously treated NSCLC with an ERBB2 mutation in the tyrosine kinase domain (n=75 [ERBB2 mutations include: A775_G776insYVMA (43), P780_Y781insGSP (8), A775_G776insYVMA+other (5), G776>VC (3), L755P (2), G776V (2), other (12)]) demonstrated an overall response rate (ORR) of 71% (95% CI=60-80), with a 7% (n=5) complete response (CR) rate and 64% (n=48) partial response (PR) rate, and a disease control rate (DCR) of 96% (95% CI=89-99) (PMID: 40293180). Of patients who were previously treated with a HER2-directed antibody drug conjugate (ADC) (n=31 [ERBB2 mutations include: A775_G776insYVMA (18), P780_Y781insGSP (3), G776>VC (3), other (7)]), the ORR was 48% (95% CI=32-65), with a 3% (n=1) CR rate and 45% (n=14) PR rate, and the DCR was 97% (95% CI=84-99) (PMID: 40293180). Patients with previously treated NSCLC with an ERBB2 mutation not in the tyrosine kinase domain (n=20 [ERBB2 mutations include: S310F (6), V659E (6), S310Y (4), P1199S (1), D277Y (1), S113F (1), G660D (1)]) demonstrated an ORR of 30% (95% CI=15-52), with a 30% (n=5 [S310F (3), V659E (3)]) PR rate, and a DCR of 65% (95% CI=43-82) (PMID: 40293180).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Oncogenic Mutations']NeratinibLEVEL_3ALEVEL_Fda3['17311002', '23220880', '29420467']Neratinib is a small molecule inhibitor of the ERBB2 and EGFR kinases that is FDA-approved for HER2-positive breast cancer previously treated with adjuvant trastuzumab and is a category 2B NCCN recommendation for patients with HER2-mutant breast cancer. In a Phase II basket trial of patients across multiple tumor types with ERBB2 activating mutations, the overall response rate at eight weeks in patients with HER2 non-amplified breast cancer (N=25) was 32% [95% CI= 15-54%]. ERBB2 mutations associated with a response in breast cancer included the HER2 hotspot extracellular domain mutation S310, HER2 kinase domain hotspot mutations, exon 20 insertions, and the non-hotspot complex insertion/substitution L755_E757delinsS. Responses were observed in patients with estrogen receptor (ER)+ (30%, 6/20) and ER- (40%, 2/5) tumors (PMID: 29420467). In vitro studies of cells engineered to express ERBB2 activating mutations have demonstrated that these mutations are sensitive to neratinib as measured by a decrease in colony formation in soft agar and a decrease in tumor volume in xenograft models (PMID: 23220880, 17311002).66.0HotPinkBreast CancerSOLIDBreast0.0SOLID['Oncogenic Mutations']NeratinibLEVEL_3ALEVEL_Fda3['23220880', '29420467']Neratinib is a small molecule inhibitor of the ERBB2 and EGFR kinases that is FDA-approved for HER2-positive breast cancer previously treated with adjuvant trastuzumab. In a Phase II basket trial of patients across multiple tumor types with ERBB2 activating mutations, clinical benefit was observed in patients with non-small cell lung cancer harboring ERBB2 S310, L755, V777, P780_Y781insGSP, and A775_G776insYVMA mutations (PMID: 29420467). In vitro studies of cells engineered to express ERBB2 activating mutations have demonstrated that these mutations are sensitive to neratinib as measured by a decrease in colony formation in soft agar and a decrease in tumor volume in xenograft models (PMID: 23220880).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Oncogenic Mutations']SevabertinibLEVEL_3ALEVEL_Fda3['41104928']Sevabertinib is an orally available, reversible dual EGFR/HER2-selective tyrosine kinase inhibitor that is FDA-approved for the treatment of adult patients with locally advanced or metastatic non-squamous non-small cell lung cancer (NSCLC) whose tumors have ERBB2 tyrosine kinase domain (TKD) activating mutations, as detected by an FDA-approved test, and who have received a prior systemic therapy. There are promising clinical data that support the use of sevabertinib in patients with ERBB2 non-TKD-mutant NSCLC. _In the Phase I/II SOHO-01 (NCT05099172) trial, cohort D (previously treated patients who had not received ERBB2-targeted therapy) (n=81 [n=73, ERBB2 TKD mutations, n=7, ERBB2 non-TKD mutations, n=1, not applicable]) demonstrated an overall response rate (ORR) of 64% (95% CI=53-75), with a 2% (n=2) complete response (CR) rate, 62% (n=50) partial response (PR) rate and 25% (n=20) stable disease (SD) rate, a median duration of response (DOR) of 9.2 months (95% CI=6.3-13.5) and a median progression-free survival of 8.3 months (95% CI=6.9-12.3) (PMID: 41104928). _Cohort E (patients who had previously received ERBB2-directed antibody drug conjugate treatment) (n=55 [n=52, ERBB2 TKD mutations, n=3, ERBB2 non-TKD mutations]) demonstrated an ORR of 38% (95% CI=25-52), with a 5% (n=3) CR rate, 33% (n=18) PR rate and 42% (n=23) SD rate, a median DOR of 8.5 months (95% CI=5.6-16.4) and a median PFS of 5.5 months (95% CI=4.3-8.3) (PMID: 41104928). _Cohort F (patients who had not previously received treatment) (n=73 [n=71, ERBB2 TKD mutations, n=2, ERBB2 non-TKD mutations]) demonstrated an ORR of 71% (95% CI=59-81), with a 2% (n=2) CR rate, 62% (n=50) PR rate and 25% (n=20) SD rate, a median DOR of 11.0 months (95% CI=8.1-NE) and a median PFS that was not evaluable (95% CI=9.6-NE) (PMID: 41104928).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Oncogenic Mutations']Trastuzumab + Pertuzumab + DocetaxelLEVEL_3ALEVEL_Fda3['15059883', '19934333', '28959366', '35073148']Trastuzumab and pertuzumab are both monoclonal antibodies against ERBB2/HER2 and docetaxel is an antineoplastic agent that acts by disrupting the microtubular network in cells that is essential for mitotic and interphase cellular functions. The triple combination of these therapeutic agents is FDA-approved for the treatment of patients with HER2-positive metastatic breast cancer who have not received prior anti-HER2 therapy or chemotherapy for metastatic disease. In a multicenter, nonrandomized phase II study (FCT 1703-R2D2, NCT03845270) of trastuzumab, pertuzumab and docetaxel in 45 patients with ERBB2-mutated, advanced non-small cell lung cancer who progressed after at least one platinum-based treatment, the objective response rate was 29% (n = 13/45) in which 58% of patients had stable disease (n = 26/45) and the median progression-free survival was 6.8 months (95% CI=4.0 to 8.5) (PMID: 35073148). Preclinical studies in HER2-overexpressing breast cancer cell lines and HER2-positive breast and nonsmall cell lung cancer xenograft models have shown that combining trastuzumab and pertuzumab resulted in greater antitumor activity compared to treatment with either antibody alone due to more comprehensive signaling blockade provided by the antibodies binding to different HER2 epitopes (PMID: 15059883, 19934333). In a separate preclinical study, treatment of a HER2-positive mouse xenograft model of breast cancer with trastuzumab, pertuzumab, and docetaxel resulted in enhanced apoptosis, infiltration of mononuclear cells, a strong reduction in the phosphorylation of HER2, EGFR, HER3, ERK, and AKT, as well as a slower tumor growth rate compared to controls (PMID: 28959366).59.0GainsboroNon-Small Cell Lung CancerSOLIDLung0.0SOLID['Oncogenic Mutations']NeratinibLEVEL_4LEVEL_Fda3['36746967']Neratinib is an orally available, small-molecule pan-HER inhibitor that is FDA-approved as an extended adjuvant treatment of adult patients with early-stage HER2-positive breast cancer, to follow adjuvant trastuzumab-based therapy. There are anecdotal clinical data to support the use of neratinib in patients with ERBB2 mutant biliary tract cancer. _In the Phase II SUMMIT (NCT01953926) trial of neratinib in patients with ERBB2 mutant solid tumors, patients with gallbladder cancer (n=10 [n=5, S310F/Y, n=3, V777L, n=1, T733I, n=1, L755S]), cholangiocarcinoma (n=11 [n=4, S310F, n=2, V842I, n=2, R678Q, n=1, V777L, n=1, V695E, n=1, D769Y]) and ampullary cancer (n=4 [n=1, S310F, n=1, G776C+H878Y, n=1, S310F+V777L, n=1, L755S]) demonstrated an overall response rate of 16.0% (95% CI=4.5-36.1) (PMID: 36746967). In the gallbladder cancer cohort, the median progression-free survival (PFS) was 3.7 months (95% CI=0.8-6.4), the median overall survival (OS) was 9.8 months (95% CI=2.4-NE), three patients achieved partial responses (PR) (S310F, V777L) and four patients demonstrated stable disease (SD) (T733I, L755S, S310Y) (PMID: 36746967). In the cholangiocarcinoma cohort, the median PFS was 1.4 months (95% CI=0.5-9.1), the median OS was 5.4 months (95% CI=0.8-16.2), two patients achieved PR (V659E, V777L) and two patients demonstrated SD (S310F, D769Y) (PMID: 36746967). In the ampullary cancer cohort, the median PFS was 1.1 months (95% CI=1.1-3.8), the median OS was 5.0 months (95% CI=3.7-10.2) and one patient demonstrated SD (G77C+H878Y) (PMID: 36746967).153.0BILIARY_TRACTGreenBiliary TractBiliary Tract CancerSOLIDBiliary TractTISSUE1.0SOLID['Oncogenic Mutations']NeratinibLEVEL_4LEVEL_Fda3['36746967']Neratinib is an orally available, small-molecule pan-HER inhibitor that is FDA-approved as an extended adjuvant treatment of adult patients with early-stage HER2-positive breast cancer, to follow adjuvant trastuzumab-based therapy. There are anecdotal clinical data to support the use of neratinib in patients with ERBB2 mutant biliary tract cancer. _In the Phase II SUMMIT (NCT01953926) trial of neratinib in patients with ERBB2 mutant solid tumors, patients with gallbladder cancer (n=10 [n=5, S310F/Y, n=3, V777L, n=1, T733I, n=1, L755S]), cholangiocarcinoma (n=11 [n=4, S310F, n=2, V842I, n=2, R678Q, n=1, V777L, n=1, V695E, n=1, D769Y]) and ampullary cancer (n=4 [n=1, S310F, n=1, G776C+H878Y, n=1, S310F+V777L, n=1, L755S]) demonstrated an overall response rate of 16.0% (95% CI=4.5-36.1) (PMID: 36746967). In the gallbladder cancer cohort, the median progression-free survival (PFS) was 3.7 months (95% CI=0.8-6.4), the median overall survival (OS) was 9.8 months (95% CI=2.4-NE), three patients achieved partial responses (PR) (S310F, V777L) and four patients demonstrated stable disease (SD) (T733I, L755S, S310Y) (PMID: 36746967). In the cholangiocarcinoma cohort, the median PFS was 1.4 months (95% CI=0.5-9.1), the median OS was 5.4 months (95% CI=0.8-16.2), two patients achieved PR (V659E, V777L) and two patients demonstrated SD (S310F, D769Y) (PMID: 36746967). In the ampullary cancer cohort, the median PFS was 1.1 months (95% CI=1.1-3.8), the median OS was 5.0 months (95% CI=3.7-10.2) and one patient demonstrated SD (G77C+H878Y) (PMID: 36746967).15.0MIXEDHepatobiliary CancerSOLIDMIXED0.0SOLID['Oncogenic Mutations']Pertuzumab + TrastuzumabLEVEL_4LEVEL_Fda3['38748939']Pertuzumab and trastuzumab are intravenously administered, humanized monoclonal HER2-targeted antibodies that are NCCN-compendium listed in combination for the treatment of patients with HER2-positive biliary tract cancers. There are anecdotal clinical data to support the combined use of pertuzumab and trastuzumab in patients with ERBB2 mutant biliary tract cancer. _In the Phase II TAPUR (NCT02693535) trial of pertuzumab plus trastuzumab in seven patients with ERBB2 mutant biliary tract cancer (n=4, S310F, n=1, S310Y, n=1, R678Q, n=1, G776V), two patients achieved partial response (S310Y, S310F) (PMID: 38748939).153.0BILIARY_TRACTGreenBiliary TractBiliary Tract CancerSOLIDBiliary TractTISSUE1.0SOLID['Oncogenic Mutations']Pertuzumab + TrastuzumabLEVEL_4LEVEL_Fda3['38748939']Pertuzumab and trastuzumab are intravenously administered, humanized monoclonal HER2-targeted antibodies that are NCCN-compendium listed in combination for the treatment of patients with HER2-positive biliary tract cancers. There are anecdotal clinical data to support the combined use of pertuzumab and trastuzumab in patients with ERBB2 mutant biliary tract cancer. _In the Phase II TAPUR (NCT02693535) trial of pertuzumab plus trastuzumab in seven patients with ERBB2 mutant biliary tract cancer (n=4, S310F, n=1, S310Y, n=1, R678Q, n=1, G776V), two patients achieved partial response (S310Y, S310F) (PMID: 38748939).15.0MIXEDHepatobiliary CancerSOLIDMIXED0.0SOLID['Oncogenic Mutations']Trastuzumab DeruxtecanLEVEL_4LEVEL_Fda3['38710187']Trastuzumab deruxtecan is an intravenously administered, HER2-targeted antibody that is FDA-approved for patients with unresectable or metastatic HER2-positive breast cancer previously treated with anti-HER2-based regimens in the metastatic setting. There are anecdotal clinical data to support the use of trastuzumab deruxtecan in patients with ERBB2 mutant biliary tract cancer. _In the Phase II DESTINY-PanTumor01 (NCT04639219) trial of trastuzumab deruxtecan in patients with ERBB2 mutant solid tumors, the biliary tract cancer cohort (n=19) demonstrated an overall response rate (ORR) of 10.5% (n=2) (95% CI=5.7-43.7) (PMID: 38710187).153.0BILIARY_TRACTGreenBiliary TractBiliary Tract CancerSOLIDBiliary TractTISSUE1.0SOLID['Oncogenic Mutations']Trastuzumab DeruxtecanLEVEL_4LEVEL_Fda3['38710187']Trastuzumab deruxtecan is an intravenously administered, HER2-targeted antibody that is FDA-approved for patients with unresectable or metastatic HER2-positive breast cancer previously treated with anti-HER2-based regimens in the metastatic setting. There are anecdotal clinical data to support the use of trastuzumab deruxtecan in patients with ERBB2 mutant biliary tract cancer. _In the Phase II DESTINY-PanTumor01 (NCT04639219) trial of trastuzumab deruxtecan in patients with ERBB2 mutant solid tumors, the biliary tract cancer cohort (n=19) demonstrated an overall response rate (ORR) of 10.5% (n=2) (95% CI=5.7-43.7) (PMID: 38710187).15.0MIXEDHepatobiliary CancerSOLIDMIXED0.0SOLID24516025;24997986;28572459;29967253;22908275;26358791;29420467Neratinib,Pertuzumab+Trastuzumab,Trastuzumab Deruxtecan34534430;31588020;29989854;30206164;38211393;37597578;40293180;17311002;23220880;29420467;41104928;15059883;19934333;28959366;35073148;36746967;38748939;38710187130Tmissense_variantERBB22064GeneENST00000269571.5ENST00000269571.5:c.929C>T497https://civicdb.org/links/variants/497ERBB2_S310F/Y493ENST00000269571.5:c.929C>T/NC_000017.10:g.37868208C>T376189/376188